ID: 963042842

View in Genome Browser
Species Human (GRCh38)
Location 3:141081991-141082013
Sequence TTGGGGATACAGGAGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 359}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963042842_963042852 10 Left 963042842 3:141081991-141082013 CCATGTCCCTCCTGTATCCCCAA 0: 1
1: 0
2: 2
3: 37
4: 359
Right 963042852 3:141082024-141082046 CAGTGCTGGTGGCTGCCGCATGG 0: 1
1: 0
2: 1
3: 33
4: 248
963042842_963042849 -4 Left 963042842 3:141081991-141082013 CCATGTCCCTCCTGTATCCCCAA 0: 1
1: 0
2: 2
3: 37
4: 359
Right 963042849 3:141082010-141082032 CCAACAGCCATGAACAGTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 172
963042842_963042853 11 Left 963042842 3:141081991-141082013 CCATGTCCCTCCTGTATCCCCAA 0: 1
1: 0
2: 2
3: 37
4: 359
Right 963042853 3:141082025-141082047 AGTGCTGGTGGCTGCCGCATGGG 0: 1
1: 0
2: 1
3: 20
4: 162
963042842_963042850 -1 Left 963042842 3:141081991-141082013 CCATGTCCCTCCTGTATCCCCAA 0: 1
1: 0
2: 2
3: 37
4: 359
Right 963042850 3:141082013-141082035 ACAGCCATGAACAGTGCTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 219
963042842_963042854 12 Left 963042842 3:141081991-141082013 CCATGTCCCTCCTGTATCCCCAA 0: 1
1: 0
2: 2
3: 37
4: 359
Right 963042854 3:141082026-141082048 GTGCTGGTGGCTGCCGCATGGGG 0: 1
1: 0
2: 2
3: 21
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963042842 Original CRISPR TTGGGGATACAGGAGGGACA TGG (reversed) Intronic
901153226 1:7118237-7118259 TTGGGAGTACAGGAGTGGCAGGG + Intronic
902273914 1:15325822-15325844 TTGGAGATACAGGAGAGGGAAGG - Intronic
903562734 1:24240646-24240668 TTGGAGAAACATGAGGGAAAAGG + Intergenic
903688305 1:25149149-25149171 CTGGGGATTCAGGATGGACAAGG - Intergenic
903757289 1:25671427-25671449 TTGGGGATACAGAGGGGAATAGG + Intronic
904772639 1:32888866-32888888 TTGGGGACCCAGGTGGGACTTGG + Exonic
904927826 1:34062503-34062525 CAGGGGGTACAGGAAGGACATGG + Intronic
905017771 1:34789295-34789317 TTTGGGACAGAGGAGTGACATGG - Intronic
905392095 1:37643056-37643078 CTGGGGATTCAGGAGAGACAAGG - Intergenic
905412396 1:37779579-37779601 TGGAGGACACAGAAGGGACAGGG + Intergenic
905821081 1:40991986-40992008 TTGGGGAACCAGGAGAGGCAGGG - Intronic
906201938 1:43966102-43966124 TCAGGAATACAGGAGGGACATGG + Intronic
906484044 1:46220921-46220943 TGGAGGATTGAGGAGGGACATGG + Exonic
906506438 1:46383230-46383252 TTTGGGAAAGAGGAGGGGCAGGG + Intergenic
907951624 1:59189036-59189058 TGGGGGATGGAGGAGGGACTGGG + Intergenic
909763781 1:79328256-79328278 TCTGAGATACATGAGGGACATGG + Intergenic
910247311 1:85153382-85153404 TGGGATATACAGGGGGGACAGGG + Intergenic
910477201 1:87620062-87620084 TGGGGGAGACAGAAGGGAGATGG - Intergenic
911207084 1:95102655-95102677 TTGGGGGAACAGGGAGGACAGGG + Intergenic
912375019 1:109202874-109202896 TTGGGGACAAAGGAGAGAAATGG - Intronic
915162297 1:153929232-153929254 TGGGGTATAGATGAGGGACAAGG + Intergenic
915721573 1:157989721-157989743 TTGGGGATTCTTGAGGGGCAAGG - Intergenic
915800496 1:158786828-158786850 TTGGGGACTCAGGGGGGAAAAGG + Intergenic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
917218254 1:172700215-172700237 TTGGGGCTCCAGTGGGGACAAGG - Intergenic
918465229 1:184814908-184814930 TTAAGGATTCAGGAAGGACAAGG - Intronic
920006777 1:202839071-202839093 TTGTTAATACAGGAGGGAGAAGG - Intergenic
920395463 1:205642392-205642414 GATGGGGTACAGGAGGGACAGGG - Intergenic
920506471 1:206518671-206518693 TTGCGGAGTCAGGAGGGCCAAGG - Intronic
921338739 1:214113170-214113192 TTGGGGAAAAAGGTGGGACGGGG - Intergenic
921920694 1:220666102-220666124 TTGGAGATGGAGGGGGGACAGGG - Intergenic
923348447 1:233080306-233080328 TTGGGGAGACAGCAGGTACTGGG - Intronic
923986080 1:239384113-239384135 TTGGGGTAACTGGAGGCACATGG - Intergenic
1062828201 10:587571-587593 GTGGGGTTTCAGGAGGGTCAGGG - Intronic
1062828213 10:587617-587639 GTGGGGTTTCAGGAGGGTCAGGG - Intronic
1062828237 10:587709-587731 GTGGGGTTTCAGGAGGGTCAGGG - Intronic
1063438333 10:6052551-6052573 TTGAGGGTACAGGAGGAAGAGGG - Intronic
1064215050 10:13393334-13393356 TTGGGGAGACGGGAGGGGCACGG + Intergenic
1064839493 10:19574774-19574796 TTAGGGAAACAGAAGGCACAGGG + Intronic
1066216696 10:33295262-33295284 TTGGGAACACAGGAGTAACATGG + Intronic
1066952726 10:42137487-42137509 GTGGGGAGACAAGAGGGAGAGGG - Intergenic
1067479292 10:46584867-46584889 CTCGGGAAACAGGAGGGGCAGGG - Intronic
1067615447 10:47756934-47756956 CTCGGGAAACAGGAGGGGCAGGG + Intergenic
1069611210 10:69773884-69773906 TTGGGGGTCCAGGAGCCACATGG + Intergenic
1069846117 10:71372895-71372917 TTGAGGAGGGAGGAGGGACAGGG + Intergenic
1070100430 10:73380927-73380949 GTAGGGACACAGGAGAGACAGGG + Intronic
1070311359 10:75276122-75276144 GTGGGGACGCAGGAGGGGCAGGG + Intergenic
1070681354 10:78451538-78451560 GTGGGGAGGCAGGAGGGATATGG - Intergenic
1071412190 10:85407745-85407767 TTGGGCATGCAGAAAGGACAGGG - Intergenic
1073325512 10:102642515-102642537 GTGGGGAAACGGGAGGGCCAGGG - Intergenic
1074723310 10:116282673-116282695 TTGGAGAGGCAGGAGGGAAAGGG - Intergenic
1075258722 10:120945032-120945054 ATGGGGCTCCAGGAGGGACTGGG + Intergenic
1075688622 10:124380481-124380503 TTGGGGAGTCAGGAGGAGCATGG - Intergenic
1075776801 10:124994392-124994414 TTGTGGGCACAAGAGGGACACGG - Intronic
1076584166 10:131533831-131533853 ATGGGGGTCCAGGAGAGACATGG - Intergenic
1076585833 10:131546884-131546906 TTGGGGACACTGCAAGGACATGG - Intergenic
1076888909 10:133274568-133274590 TTGGGTAGACAGGAAGGACACGG + Intronic
1078079843 11:8195953-8195975 TTGGGGGTACAGGGGTAACAGGG + Intergenic
1079100603 11:17539271-17539293 GTGGGGAGACAGGAGGGTAAAGG - Intronic
1080368086 11:31600897-31600919 ATGGGGGTACAGGAGGAAAACGG - Intronic
1081646080 11:44791622-44791644 CTGGGGACACAGGGGGGACCAGG - Intronic
1082689234 11:56279534-56279556 TTAGGGACTCAGGAAGGACAAGG - Intergenic
1083048123 11:59754862-59754884 CTGGAGATACAGGACGGTCAGGG - Intronic
1083514789 11:63246804-63246826 TTGGAGACAGAGGAGGGAGAAGG - Intronic
1083799129 11:65036134-65036156 TTGGGGATGCTGGAGGTAGAAGG + Intronic
1084711063 11:70844040-70844062 TTGGGGACTCAGATGGGACAGGG - Intronic
1086039802 11:82462510-82462532 TTGGGGAGAAAGGAGTCACAAGG + Intergenic
1086596147 11:88573656-88573678 ATGGGGATACAGAACTGACAAGG + Intronic
1087887354 11:103496094-103496116 TGGGGCATGCAGGAGGGCCAAGG - Intergenic
1089681601 11:120121846-120121868 AGGGAGAGACAGGAGGGACAGGG + Intronic
1089935798 11:122362847-122362869 CTGGGGATACAGCAGCGAGATGG - Intergenic
1090078038 11:123591697-123591719 TTGGGGGTGGAGGAGGGAGAGGG + Intronic
1091793027 12:3282254-3282276 TTGAGGATTCAGGAGGGAAGGGG + Intronic
1092090430 12:5799324-5799346 CTGGGGACATGGGAGGGACATGG - Intronic
1092953535 12:13529322-13529344 TTGGGGAAACAGGAGAGAGGAGG - Intergenic
1094361734 12:29638400-29638422 ATGGGGATCCAGAAGGGAGATGG - Intronic
1095345189 12:41141816-41141838 TTGGGGATGCAGGAGAGGGAAGG + Intergenic
1095898620 12:47305496-47305518 TGGGGGATCCAGAAGGGAGACGG + Intergenic
1096008667 12:48193994-48194016 GTGTGTATGCAGGAGGGACAAGG + Intergenic
1097254493 12:57662999-57663021 TTAAGGATTCAGGAAGGACAAGG - Intergenic
1097260351 12:57716316-57716338 TTGGTGATAGAGGAGGGGAAGGG + Intronic
1097399401 12:59110545-59110567 ATGGTGCTACAGGAGGGACAGGG + Intergenic
1097687950 12:62708736-62708758 TTTTGGATTCAGGAGGTACATGG + Intronic
1097983270 12:65755862-65755884 TTGGGGATAAAGGAAGGTCAAGG + Intergenic
1098358763 12:69635158-69635180 TCGGGGTAGCAGGAGGGACAAGG + Intergenic
1099869901 12:88333888-88333910 TTTGGGATAGAAGAGGGAGATGG + Intergenic
1101558793 12:105836027-105836049 ATGGGGATAGAGGAAGGACTAGG + Intergenic
1102507684 12:113394051-113394073 TGGGGGAAACAGGAGAGAGATGG + Intronic
1103340730 12:120219884-120219906 TGGGGGCTACAGGAGGTAGAAGG + Intronic
1103894889 12:124266469-124266491 TTGGGAACACAGGTGAGACACGG + Intronic
1104210756 12:126685977-126685999 TTTGGGATGCAGAAGGGAGAGGG - Intergenic
1104385801 12:128350614-128350636 TGGGGGATGCATCAGGGACATGG + Intronic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1105938043 13:25120104-25120126 TTGGAGAGTCAGGAGAGACAGGG - Intergenic
1106286207 13:28320158-28320180 TATGGGATAAAGGAGAGACAAGG + Intronic
1106618190 13:31349861-31349883 TTGTGGATAAAAGAGGGTCATGG - Intergenic
1111184859 13:84720422-84720444 ATGGGGAGCCAGGAGGGAGATGG - Intergenic
1115342172 14:32304492-32304514 TCAGGGATCCAGGAGAGACAGGG + Intergenic
1116870465 14:50064987-50065009 TTGCTGATCCATGAGGGACATGG - Intergenic
1117361784 14:54982465-54982487 TTGGGGACAGAGTAGTGACAAGG - Intronic
1119888120 14:78161449-78161471 TTTTGGTTACAGGAGGGAGAGGG + Intergenic
1120017205 14:79487554-79487576 TTGGGGAAACAGGAAGAAAAAGG - Intronic
1120970264 14:90201115-90201137 TTGGGGATACAAATGAGACATGG + Intergenic
1121391311 14:93577298-93577320 TTGGGCATAGAGTAGGGCCAAGG + Intronic
1122269424 14:100561875-100561897 TTGGGGTTACAGGTGGGGCCAGG - Intronic
1123476179 15:20593764-20593786 CTGGGGATTCAGCAGGGACGTGG - Intergenic
1123641833 15:22406600-22406622 CTGGGGATTCAGCAGGGACGTGG + Intergenic
1125428407 15:39572826-39572848 TGGGTCATACAGGAGAGACAAGG - Intergenic
1125790481 15:42361759-42361781 CTGGGGAAAGAGGATGGACATGG - Intronic
1126132663 15:45357899-45357921 TTGGGGGTACAGGCGAGAAATGG + Intergenic
1126441874 15:48698006-48698028 GTGGGGATGGAGGAGGAACACGG + Intergenic
1127521166 15:59744510-59744532 TTGGTGATGCAGGAGTGAAAGGG + Intergenic
1128046062 15:64618608-64618630 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1128336665 15:66790618-66790640 TTGGGGAAAGAGGAGGCACTAGG + Intergenic
1128515727 15:68340745-68340767 TCGGGGATACAGGAGAGAGAGGG - Intronic
1129657918 15:77537030-77537052 TTGGGGAGAGGGGAGGAACAGGG - Intergenic
1129712137 15:77825831-77825853 TTGAGGACTCAGAAGGGACATGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132148565 15:99443433-99443455 TTGGGGAGCCAGGAGAGACGTGG + Intergenic
1132268838 15:100504681-100504703 TCGGGGACACAGAAAGGACAGGG + Intronic
1133523093 16:6577786-6577808 GTAGGGATACAGGAGGGAAAAGG - Intronic
1133605579 16:7384580-7384602 ATGGGGAAATAGGAGGGAGAGGG + Intronic
1133887515 16:9844347-9844369 TTGGGGACACAGGATGAAAAAGG + Intronic
1134084850 16:11349316-11349338 GTGGGGATGCAGGAAGGAGAGGG + Intronic
1134907947 16:17997775-17997797 TTGGGGCTACAGAAGAGTCAAGG + Intergenic
1135550913 16:23397736-23397758 TTGGGAAGACAGGAGGCAGATGG - Intronic
1135973721 16:27091113-27091135 TTGGGGACTCAGGGGGGAAACGG + Intergenic
1136107538 16:28040837-28040859 ATGGGGATACTGGATGGAAAAGG - Intronic
1137494234 16:48957331-48957353 TTGGGGAAACAGGTGGTACTTGG - Intergenic
1137727594 16:50667543-50667565 CTGGGGATACAGCAGTGACCAGG - Intronic
1138492964 16:57387300-57387322 TGGGGGATCCAGGAGGTAGAGGG + Intergenic
1138538017 16:57670024-57670046 CTGTGGCTACAGGAGGGAAATGG + Intronic
1138615548 16:58162736-58162758 TTGGGGACTCAGGAGCAACATGG - Intronic
1138887861 16:61102072-61102094 ATGGGGGTAAAGGAGGGACGGGG + Intergenic
1140479381 16:75254166-75254188 TTCGGGGCACAGAAGGGACAGGG + Intronic
1140579593 16:76213819-76213841 TTTTAGATACAGGAGGTACATGG - Intergenic
1142266655 16:89067042-89067064 TCGGGGGACCAGGAGGGACACGG - Intergenic
1142821908 17:2475850-2475872 TTGGGGATAGAGGAGGTTAATGG - Intronic
1143281323 17:5756708-5756730 TTTGGGATATAGAAGGGACCTGG + Intergenic
1144743270 17:17596228-17596250 TAGGGGATAGGGGATGGACAGGG - Intergenic
1145416084 17:22715096-22715118 ATGGGGAGAGAGGAAGGACAGGG - Intergenic
1146357026 17:32142795-32142817 TTGGGGCTGCAGGGGCGACAGGG - Intronic
1147196573 17:38770531-38770553 TGGGGGAACCTGGAGGGACAAGG + Exonic
1148164308 17:45472348-45472370 ATGGGGAAACTGGAGGGTCAAGG - Intronic
1149980026 17:61303335-61303357 TTGGGGATACAGCAGCGGCCTGG + Intronic
1150993289 17:70286227-70286249 TTTGGGAAACAGGAGGGTGATGG - Intergenic
1151145229 17:72034388-72034410 AGGGGGAAGCAGGAGGGACATGG - Intergenic
1151784884 17:76270555-76270577 GTGGGGACACAGGAGGGCCAGGG + Exonic
1152266698 17:79299085-79299107 TCGGAAATACGGGAGGGACATGG + Intronic
1152581735 17:81168348-81168370 TTGGGGCTCCAGGAAGGACAGGG + Intergenic
1152799746 17:82325323-82325345 TTGGAGAAACAGGAGGGAGCTGG - Intronic
1153990481 18:10394731-10394753 TGGGGGAGACAGAAGGGAGATGG + Intergenic
1155517843 18:26640889-26640911 TTGGGGACACAGAGAGGACAAGG + Intronic
1157242324 18:46022742-46022764 TTGAGGATACAGAAGTGACCAGG - Intronic
1157762088 18:50272775-50272797 TTGGGGCTACAGCAGGGTCAGGG + Intronic
1158302088 18:56063660-56063682 TTGGGGCTATAGGAGGGATTTGG - Intergenic
1158520552 18:58168939-58168961 TTGGGGATGCAGGATGGTCAGGG + Intronic
1160389725 18:78521087-78521109 TCGGGGATACAGAAAGGTCAAGG + Intergenic
1160410017 18:78668846-78668868 GTGGAGATACAGGAAGGAGATGG + Intergenic
1160665511 19:326230-326252 TTGGGGACACAGCAGAGCCACGG + Intronic
1160743566 19:699292-699314 ATGGGGACACAGTAGGGAGAGGG + Intergenic
1161053640 19:2179018-2179040 TAGGGGAGACAGGAGACACAAGG - Intronic
1161934414 19:7362758-7362780 CTGTGGAGAAAGGAGGGACAAGG - Intronic
1162612652 19:11768048-11768070 TTGGGAAGAAAGAAGGGACAGGG - Intronic
1162722451 19:12670434-12670456 TTGGGGGAACAGCAAGGACAGGG - Exonic
1163184016 19:15623780-15623802 CTGGGGCTACAGTGGGGACAGGG + Intronic
1163229270 19:15989085-15989107 TGGGGGGTACAGGTGGTACATGG + Intergenic
1166384990 19:42375874-42375896 CTGGGGATCCAGGAGGAGCAGGG + Exonic
1167072465 19:47228653-47228675 ATGGGCACACAGGAGGGACAGGG + Intronic
1167774312 19:51544838-51544860 TAGGGGGTAGAGGAGGGTCAGGG - Intergenic
1167804551 19:51771688-51771710 TAGGGGAAACAGGAGGGAAAGGG - Intronic
925571405 2:5316412-5316434 TTGGTGAGACAGGAGTGACATGG + Intergenic
926276545 2:11407556-11407578 TTGGTGATACAGGATGGATTAGG + Intergenic
927073112 2:19550083-19550105 TTCTGGGTAGAGGAGGGACAAGG - Intergenic
927939927 2:27097126-27097148 CTGGGGAAGCAGGAAGGACAGGG + Intronic
929426023 2:41845612-41845634 TTGGGGAAGAAGTAGGGACATGG - Intergenic
930127365 2:47812126-47812148 TTGAGGCTACAGAAGGGGCAAGG - Intronic
930534606 2:52630412-52630434 TTGGGGGAACAAGAAGGACAGGG + Intergenic
931586261 2:63832767-63832789 CTGGGGATACAAGAGAGACATGG + Intergenic
932333626 2:70916527-70916549 TTGGGGATGGAGGAAGGACCTGG - Intronic
932427139 2:71645285-71645307 TTGGGGAGCCAGAAGGGAGATGG + Intronic
932547809 2:72733399-72733421 TTGGGGAGACAAGAGGAAAAAGG + Intronic
933398831 2:81765653-81765675 TGGGGGAGCCAGGAGGGAGATGG - Intergenic
935210478 2:100935626-100935648 TTAGACATTCAGGAGGGACATGG + Intronic
936058791 2:109281186-109281208 CTGGGGTCGCAGGAGGGACAGGG - Intronic
937539140 2:122926693-122926715 CTGGGGATCCTGGAGGGAGAGGG + Intergenic
937968615 2:127533516-127533538 TAGGGGGAACAGGCGGGACAGGG + Intergenic
938565604 2:132515712-132515734 TCAGGGAGAAAGGAGGGACAAGG - Intronic
939996863 2:148927902-148927924 TTGGTGGGAGAGGAGGGACAGGG - Intronic
941493155 2:166167400-166167422 ATGGGGAGACAGGAGGGAAGTGG + Intergenic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
942604640 2:177677531-177677553 CTGGGGACTCAGGAGGGACCTGG + Intronic
943923031 2:193734619-193734641 TACGGGATTCAGGAGGGATATGG + Intergenic
944634375 2:201660682-201660704 TCGGGGAGAGAGGAGGGAGAAGG - Intronic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946301411 2:218826807-218826829 TGGGGGGTACAGGATGGACTGGG - Intronic
946668769 2:222079605-222079627 TTTGGAATAGAGGAGGGAGAAGG - Intergenic
947026100 2:225739789-225739811 TTGGTGTTACATGAGGCACAAGG - Intergenic
947740370 2:232482096-232482118 TGGAGGAGACAGGAGGGAAACGG + Intronic
949017544 2:241721956-241721978 ATGGGGATGAAGGAGTGACAAGG + Intronic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1169671228 20:8105470-8105492 TGGGAGGTACAGGAGGGAAAGGG - Intergenic
1169936881 20:10893307-10893329 TTGGGGTAACAGGAGTGTCAGGG - Intergenic
1170587496 20:17745727-17745749 TTGGGGATACGGGAGAGAGAGGG + Intergenic
1170722711 20:18897857-18897879 TAGAGCATGCAGGAGGGACATGG + Intergenic
1170788896 20:19491638-19491660 TTGGGAACAGAGGAGGGGCAGGG - Intronic
1171208190 20:23297296-23297318 TTGGGGATGCTGGCTGGACAAGG + Intergenic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1171321522 20:24248611-24248633 TCTGGGATACAGGAGGAAAAAGG - Intergenic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172566633 20:35935667-35935689 ATGAGGATTCAGAAGGGACAAGG - Intronic
1172585177 20:36078166-36078188 TTGGGGAGCCAGAAGGGAAATGG + Intergenic
1172656293 20:36540862-36540884 TTGGGCAGACAGGAGGTGCAGGG - Intergenic
1172883547 20:38217050-38217072 CTGGGGGCACAGCAGGGACAGGG - Intronic
1173075208 20:39811889-39811911 TTGGGAATACAGGAGCCACTTGG + Intergenic
1173658395 20:44716539-44716561 TTGGGGCTCTAGGAGGGAGAAGG + Intronic
1174295746 20:49543847-49543869 CTGGGGATACAGCAGGGAACAGG - Intronic
1174400425 20:50273059-50273081 TTGGGGATACAGCAGTGACCAGG + Intergenic
1174894546 20:54434908-54434930 TTGGGGAGTCAGGAGGGTCAGGG - Intergenic
1175491377 20:59383125-59383147 ATGGGGACACAGGAGGTACCAGG - Intergenic
1175766129 20:61594156-61594178 TTGGGGAAAGAGGGGGGAAAGGG + Intronic
1177759138 21:25382929-25382951 TTGGGGATTCAAGAGTGACCAGG + Intergenic
1179246558 21:39638491-39638513 TGGGGGAGCCAGGAGGGAGATGG - Intronic
1179967810 21:44817299-44817321 TTGGGGAGACACGAAGGAGAGGG + Intronic
1180957412 22:19747197-19747219 GTGGGCATGCAGGAGGGCCAGGG - Intergenic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1181979086 22:26753276-26753298 TTGGGGATTCAGGAGGAGCCTGG + Intergenic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1184266820 22:43351894-43351916 TTGGGGATACAGCAGTGAGGGGG + Intergenic
1185013971 22:48332998-48333020 TTAGGGGGACAGGAGTGACAGGG - Intergenic
1185106384 22:48872171-48872193 ATGGGGAGGCAGGAGGGACAGGG - Intergenic
950221588 3:11200410-11200432 TGGAGAATACAGCAGGGACATGG + Intronic
950483057 3:13256651-13256673 CTGGGGATGCAGAAGGGACCAGG + Intergenic
951054453 3:18131713-18131735 TTGGGGATACAGTAGATATAAGG + Intronic
954285463 3:49615940-49615962 TGAGGAATACGGGAGGGACAAGG + Intronic
954687704 3:52379572-52379594 TTGGGGTTAGGGGAGCGACAGGG + Intronic
955060659 3:55489135-55489157 TTGGGGACTCCGGAGGGGCAGGG + Intronic
958660808 3:97064000-97064022 TTGTGGACACAGAAGAGACAAGG + Intronic
958969398 3:100594760-100594782 TTGGGGATACAGGTGGTATTTGG + Intergenic
961140878 3:124554949-124554971 TCTGGGATCCAAGAGGGACAAGG + Intronic
961917607 3:130393364-130393386 TGGGGGATACAGTGGGGACACGG - Intronic
962407619 3:135113501-135113523 TCGGGGTTACTGGAGGGAGAAGG - Intronic
963042842 3:141081991-141082013 TTGGGGATACAGGAGGGACATGG - Intronic
963178642 3:142329511-142329533 GTGTGGATACAGGAGGGATCTGG + Exonic
966536287 3:181037999-181038021 TTAAGGATTCAGGAAGGACATGG + Intergenic
969105973 4:4807323-4807345 ATGGGGTTTCAGGAGGGCCAGGG + Intergenic
969290169 4:6233743-6233765 CTGGGGACACAGGAAGGACGAGG + Intergenic
969444881 4:7239123-7239145 GTGGGGAGGAAGGAGGGACAGGG - Intronic
969926180 4:10587806-10587828 TAGGGGAGACAGTAGGGACCGGG - Intronic
970054648 4:11957219-11957241 TGGGGGAGACAGAAGGGAGATGG + Intergenic
971371456 4:26022698-26022720 TTGGGGTTGTAGGGGGGACAGGG + Intergenic
971996648 4:33973979-33974001 AGGAGGATACAGGAGGCACAGGG + Intergenic
972275423 4:37552894-37552916 TTGGGGTTACAAGATGGATATGG - Intronic
972653975 4:41048655-41048677 TAGGGGAGACGGGAGGGAGAGGG - Intronic
973818677 4:54642773-54642795 TTGGGGACACTGGAGGGAAAGGG + Intergenic
973929087 4:55771510-55771532 GTGGGGAAAAAGGAAGGACATGG - Intergenic
973965266 4:56155430-56155452 CTGGGGATACATGAGGAACCAGG + Intergenic
974259373 4:59505086-59505108 TTGGGAATTCAGGAATGACAAGG + Intergenic
974479967 4:62430398-62430420 CTCTGGATCCAGGAGGGACAGGG + Intergenic
975529552 4:75386246-75386268 TTGGCGATGAAGGAAGGACAGGG - Intergenic
976687885 4:87836024-87836046 TTGGGGGTATAGAGGGGACAAGG + Intronic
977685311 4:99840461-99840483 TTCGGGATGGAGGAGAGACAAGG + Intronic
978315449 4:107430788-107430810 CTGGAGGTACAGGAGGGAAAGGG - Intergenic
980252142 4:130331170-130331192 TTGGGGATTCTGGAGGTAGAAGG - Intergenic
981027161 4:140088310-140088332 TAGGGGAGAGAGGAGGGAAAGGG - Intronic
981285294 4:143010472-143010494 TTGGGAATACTGGAGTGAGAAGG + Intergenic
983304023 4:165963146-165963168 TGGGGAATACAAGAGGGAGAGGG + Intronic
984814618 4:183825038-183825060 TTGGGGATCGGGGAGGAACATGG + Intergenic
985314674 4:188643940-188643962 GAGGGGAGACAGGAGGAACATGG - Intergenic
986266909 5:6198513-6198535 ATGGGGAGACTGTAGGGACAAGG + Intergenic
989406302 5:41064920-41064942 TTGGGGATACAGGAAAGATCTGG - Intronic
990172826 5:53073712-53073734 TTGGTGGTAGAGGAGGGACCAGG - Intronic
992523037 5:77576189-77576211 TTTGGGAGACAGGAGGGAATGGG - Intronic
993248707 5:85486713-85486735 TTGAGGATTCAGGATGGACAAGG - Intergenic
993671269 5:90764360-90764382 TTGGGCTTACAGGAAGAACAGGG - Intronic
993743777 5:91570637-91570659 TTGGGGAAACAGGAGGTATTTGG - Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996599565 5:125245820-125245842 TGGGGCATTCAGGAGGGCCAGGG + Intergenic
997236741 5:132276490-132276512 TTGAGGATGCAGGAGGGAGCAGG - Intronic
997807599 5:136934481-136934503 TTGGGGAGACCAGAGAGACATGG + Intergenic
999924349 5:156358896-156358918 GTGGGGAGACAGGTGGGAGAGGG + Intronic
1001013514 5:168119739-168119761 TTGGGGACATGGGAGGGAAAAGG - Intronic
1001396799 5:171423560-171423582 GTGGCGCTGCAGGAGGGACAAGG - Intronic
1001940118 5:175734337-175734359 TGGGGGAGACAGAAGGGAGATGG - Intergenic
1002000004 5:176192117-176192139 ATGGAGACACAGGAGGGACCTGG + Intergenic
1003142454 6:3482767-3482789 GTGGGGATACAGGAGTGACCAGG - Intergenic
1003172132 6:3728161-3728183 TTGGGGTTACAGGTGGGTCTTGG + Intronic
1004947940 6:20636146-20636168 CAGGGGAGACAAGAGGGACAAGG + Intronic
1005205542 6:23399293-23399315 CTGGGGACTCAGGAGGGAAAGGG - Intergenic
1005423026 6:25672522-25672544 CTGAGGGTACAGGAGGCACAAGG + Intronic
1005583401 6:27253501-27253523 TTTTGAGTACAGGAGGGACAAGG - Intronic
1006322580 6:33328960-33328982 GAGGGGAGACAGGAGGGAAATGG - Intronic
1006677066 6:35771935-35771957 TTGGGGATACAGATTGGAGATGG - Intergenic
1007105920 6:39282758-39282780 TTGGGTATGGAGGAGGGAAAGGG - Intergenic
1007336347 6:41157646-41157668 ATGGGTGTGCAGGAGGGACAGGG - Intergenic
1007393285 6:41562805-41562827 ATGGGGAGACAGGAGGGAGGGGG - Intronic
1010083033 6:71886529-71886551 TTGGGGCTGCGGGAGGGAGAGGG - Intergenic
1011170178 6:84496864-84496886 ATGGGGATAGAGCAGGGAAAGGG + Intergenic
1011403102 6:86985746-86985768 TTGGGGCTAAAGGATGGCCATGG - Intronic
1011756006 6:90498811-90498833 TTGGGATGACAGGAGGGAGAAGG - Intergenic
1011829344 6:91352248-91352270 TTGGAGATAGAGGAGAAACAAGG + Intergenic
1013480887 6:110551618-110551640 TTAGGGATAGAGGAGGGTCTTGG - Intergenic
1014792260 6:125686758-125686780 TTGGGGATTCAGGGGGAAGAGGG - Intergenic
1015567931 6:134593120-134593142 TTGGGGACACAGGAAGGGTAGGG - Intergenic
1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG + Intergenic
1016356804 6:143227380-143227402 ATGGGGATGAAGGAGGGGCACGG - Intronic
1016708728 6:147144450-147144472 TTGGGGAAACAGTAGGAATAAGG + Intergenic
1016854138 6:148649670-148649692 TCTGGGACACAGGAGGGAGAGGG - Intergenic
1016882516 6:148924606-148924628 CTGGGGATACAATTGGGACAAGG - Intronic
1016934173 6:149436548-149436570 TTGTGGGTACAGGACGGACACGG - Intergenic
1017160715 6:151363096-151363118 CTGGGGAGACAGGAGTGACCGGG - Intergenic
1017482104 6:154867109-154867131 CTGGGGATACAAGGGTGACAAGG - Intronic
1018584861 6:165346413-165346435 TCGGGGAGAAAGGAGGGAAAAGG - Intronic
1019013004 6:168857634-168857656 CTGGGGATAGAGGGAGGACAAGG + Intergenic
1019116856 6:169772061-169772083 GTGGTGGCACAGGAGGGACAGGG - Intronic
1019521212 7:1461327-1461349 TCGGGGACCCTGGAGGGACATGG - Intergenic
1019886557 7:3910927-3910949 TTGGGGAGAGAGGAGCCACAGGG - Intronic
1020136680 7:5591904-5591926 CTGGTCACACAGGAGGGACATGG - Intergenic
1020689775 7:11339755-11339777 TTGGGGATGCTGGTGGGGCAGGG + Intergenic
1021587365 7:22223581-22223603 TTGATGATGCAGGAGGGAGAAGG + Intronic
1022321598 7:29293265-29293287 TCGAGGATGCAGGAGGGAGAAGG - Intronic
1023111759 7:36819860-36819882 TTGGGGAACCAAGAGTGACATGG - Intergenic
1023146892 7:37160473-37160495 GTGGGGAAACAGGAAGGAAAAGG - Intronic
1023888558 7:44377091-44377113 TCAGGGACACAGGAGGCACAAGG - Intergenic
1024121095 7:46241306-46241328 TTAGGGATTCAGGAGGGAATGGG + Intergenic
1025812781 7:64885683-64885705 TTGGTGATGCAGGAGGGACAGGG + Intronic
1026774682 7:73223963-73223985 GTGGGGACGGAGGAGGGACAGGG + Intergenic
1027015541 7:74777354-74777376 GTGGGGATGGAGGAGGGACAGGG + Intronic
1027072491 7:75168603-75168625 GTGGGGACGGAGGAGGGACAGGG - Intergenic
1028831241 7:95328486-95328508 TTGGGGATAAAGGAGGCAGGAGG + Intergenic
1029289283 7:99489691-99489713 TTGTGGAAACAGAAGGGATATGG - Intronic
1029435764 7:100563248-100563270 TTCGGGACACAGAAGGGACTGGG - Intronic
1029471166 7:100755147-100755169 TTGGGGGTAGAGGAGAGACAGGG + Intronic
1031598192 7:123671735-123671757 GTGGGAAGACAGGAGGGATAGGG - Intergenic
1033049038 7:137987609-137987631 TTGGGGAGACAAGAGATACACGG + Intronic
1033236202 7:139639696-139639718 CTGGAGATACAGCAGTGACATGG - Intronic
1034779033 7:153860264-153860286 TTGGGGCTGCAGGGGGTACAAGG + Intergenic
1034840514 7:154391316-154391338 CTGGGGATGGAGGAGGTACAGGG - Intronic
1035708405 8:1695099-1695121 TGGGGGATGAAGGAGGAACATGG - Intronic
1036649780 8:10634887-10634909 TTGGGGAGACTGGAGGGGCAAGG - Intronic
1037001385 8:13723544-13723566 TTGGGCTTGCATGAGGGACAGGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037580841 8:20245345-20245367 TTGGAGAGGCAGGAGGGCCAGGG - Intergenic
1038006039 8:23431202-23431224 TTGGAGAAACAGGAGAGAAAAGG - Exonic
1038219402 8:25593205-25593227 TTGGGAAGACAGGAGGTAGAAGG + Intergenic
1038418676 8:27417862-27417884 TGGGGGCTCCAGGAGGGACTTGG + Intronic
1038427082 8:27470665-27470687 TCTGGGATACAGGAGGCACTCGG - Intronic
1038913304 8:31991757-31991779 TTGGGGAAGGAGGAGGGAGAAGG - Intronic
1039992709 8:42503342-42503364 TTGGTGGTAGAGGAGGGACAGGG + Intronic
1041552749 8:59119471-59119493 GCGGGGATCCAGAAGGGACAGGG + Intergenic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1045032694 8:98152915-98152937 GTGGGGTGACAGCAGGGACAAGG + Intronic
1046799339 8:118408076-118408098 TTGGGTAAAGAGGAGGTACAGGG - Intronic
1046975128 8:120266399-120266421 TGGGGGATGCAGGATGGAAAGGG + Intronic
1047546817 8:125826128-125826150 TTGGGGATGCAGGAGGGCTGGGG + Intergenic
1047617149 8:126572012-126572034 TTGGGGATAATGGAAGGAAAAGG - Intergenic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1049442893 8:142617267-142617289 TTGGGGATGCAGGTGGGGGAAGG + Intergenic
1049528613 8:143142412-143142434 CTGGGGAAGGAGGAGGGACAGGG - Intergenic
1049528763 8:143142901-143142923 CTGGGGAGGGAGGAGGGACAGGG - Intergenic
1050321595 9:4458296-4458318 CTGGGGACACAGTAGTGACAAGG + Intergenic
1053229107 9:36390851-36390873 TTTGGGAAACAGGAAGGACGTGG - Intronic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1055054554 9:72011750-72011772 TTGGAGAAATAGGAAGGACATGG + Intergenic
1057019164 9:91682495-91682517 TGGGGGATACAGCAGTGACCTGG + Intronic
1057309631 9:93933900-93933922 GGTGGAATACAGGAGGGACAGGG - Intergenic
1058428823 9:104900067-104900089 ATGGGGGTACAGGAGAGGCAGGG + Intronic
1058836179 9:108860205-108860227 TGGGGGATACAGGAGGGTCAAGG + Intergenic
1059560638 9:115331441-115331463 TTTGGGATACAGGAGAGAAGAGG - Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060299772 9:122368475-122368497 TTGGGGCTACAAGAGTGACCAGG + Intergenic
1060791037 9:126485826-126485848 TTAGGGAAACAGGAGGGCCCTGG - Intronic
1061007185 9:127934960-127934982 CTGGGGATAAAGCAGGGACTGGG - Intergenic
1061301591 9:129708867-129708889 CTGGGGATACAGCATTGACAAGG + Intronic
1062112506 9:134789867-134789889 TTGGGAAAACAGGAGAGAGATGG + Intronic
1062490691 9:136803531-136803553 CTGGGGATACAGCAGGGACCGGG + Intronic
1187329991 X:18328990-18329012 TGGGGGAGACAGGAGGCACTAGG + Intronic
1187367629 X:18677591-18677613 TTGGGGGTACAGGAGGTTTACGG - Intronic
1188124901 X:26355311-26355333 TTGGGAATACAGGCGTGAGAGGG - Intergenic
1189175465 X:38952750-38952772 TTAGGCATAGAGGAGGGAGAGGG - Intergenic
1189296590 X:39922893-39922915 TTGGAGATACAGTAGGGAACAGG + Intergenic
1192269732 X:69567359-69567381 ATGGGGAGAAAGGAGAGACAAGG + Intergenic
1192502641 X:71663965-71663987 TGGGGGAGACAGGGAGGACAGGG - Intergenic
1193416378 X:81229529-81229551 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1193834647 X:86326690-86326712 TGGAGGACACAGGAGGGACAAGG - Intronic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194339279 X:92689826-92689848 TGAAGCATACAGGAGGGACACGG + Intergenic
1195558803 X:106259083-106259105 TTAGGGACTCAGGAAGGACAAGG + Intergenic
1197222181 X:123924808-123924830 TGGGGGGGGCAGGAGGGACAGGG + Intergenic
1198329147 X:135605745-135605767 TTGGGTTTTCAGGAGGGACATGG - Intergenic
1198337396 X:135679834-135679856 ATGGGTTTTCAGGAGGGACATGG + Intergenic
1198361795 X:135902980-135903002 ATGGGTTTTCAGGAGGGACATGG - Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199808322 X:151324543-151324565 TTGGGGATACAGCAGTGACCAGG + Intergenic
1199871796 X:151904828-151904850 TTGGGGAAAGAGGATGGAGAAGG + Intergenic
1200647666 Y:5806607-5806629 TGAAGCATACAGGAGGGACACGG + Intergenic
1200761997 Y:7047494-7047516 TTAAGGACTCAGGAGGGACAAGG + Intronic
1201020137 Y:9647742-9647764 TTGGGCATATAGGAAGGACCAGG + Intergenic
1202054210 Y:20813252-20813274 ATGGGGTTGCAGGAGGGTCAGGG - Intergenic