ID: 963043434

View in Genome Browser
Species Human (GRCh38)
Location 3:141085420-141085442
Sequence CTATGGGAATGGAAGCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963043434_963043438 -7 Left 963043434 3:141085420-141085442 CCTTGTGGCTTCCATTCCCATAG 0: 1
1: 0
2: 2
3: 20
4: 207
Right 963043438 3:141085436-141085458 CCCATAGGTACCTCATTGTCTGG 0: 1
1: 0
2: 1
3: 6
4: 64
963043434_963043440 -2 Left 963043434 3:141085420-141085442 CCTTGTGGCTTCCATTCCCATAG 0: 1
1: 0
2: 2
3: 20
4: 207
Right 963043440 3:141085441-141085463 AGGTACCTCATTGTCTGGAATGG 0: 1
1: 0
2: 0
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963043434 Original CRISPR CTATGGGAATGGAAGCCACA AGG (reversed) Intronic
900493736 1:2966690-2966712 CTGTGAGAGTGGAAGCCACAGGG - Intergenic
900848372 1:5121712-5121734 CAATTGGAATGGAAGCTCCAAGG + Intergenic
901215226 1:7551172-7551194 CTCTGGGCAGGGAAGCCCCAGGG - Intronic
901798963 1:11696222-11696244 CTATGGGAAGGGGAGACAGAGGG - Intronic
904451519 1:30615868-30615890 CTATGGGGAAGGGAACCACATGG + Intergenic
904826118 1:33274978-33275000 CTATTGGAATGGTAGCTATAGGG - Intronic
905246232 1:36616009-36616031 CTAATGGAATAGAAGCTACAAGG - Intergenic
907622890 1:55999961-55999983 CTTTGGCAATGGAATTCACATGG - Intergenic
908139691 1:61171674-61171696 CCATAGGAATGATAGCCACAGGG - Intronic
909480868 1:76128140-76128162 CTATGGGCTTGGAATCCCCAAGG + Intronic
909592711 1:77370009-77370031 CTTTGGGAAGGAAAGCAACATGG - Intronic
911362294 1:96893166-96893188 TTAGGGGAAAGGGAGCCACAAGG + Intergenic
912822538 1:112879317-112879339 CTACTGGAAGGGAGGCCACAGGG + Intergenic
915866728 1:159509031-159509053 CTATGGAAATGGGTTCCACAAGG - Intergenic
917067667 1:171114301-171114323 CTGTGGGAATGGCAGCCCCAAGG - Exonic
917072802 1:171170510-171170532 CTATGGGAATAGAAGAGGCAAGG + Intergenic
918236498 1:182585525-182585547 CTATGGGAGTGAGAGCCACAGGG - Exonic
918248200 1:182679264-182679286 TGGTGGGAATGGAAGCCAAATGG - Intronic
919754687 1:201059349-201059371 CTCTGGGAATGCAATCTACAGGG - Intronic
919983429 1:202656887-202656909 GTCTGGCAGTGGAAGCCACAGGG - Intronic
922373423 1:224935399-224935421 CCATGCAAATGGAAGCCAAAAGG + Intronic
923227614 1:231953792-231953814 CTTTGAAAATGGAAGCCAAAGGG - Intronic
923554975 1:234993309-234993331 AAATGGTATTGGAAGCCACAGGG + Intergenic
924040857 1:239982377-239982399 CTCCAGGAATGGAAACCACATGG - Intergenic
924768217 1:247053806-247053828 CTATGGGCATGGATGACAGATGG - Intronic
1065279635 10:24121758-24121780 ATATGGGAAGGGAAGTCACTGGG + Intronic
1067097898 10:43314468-43314490 CTTTGGGAATGGGAGCAAAATGG + Intergenic
1067218834 10:44326766-44326788 CTATGGGAAAGGGAGCTACAAGG - Intergenic
1072983390 10:100118361-100118383 CTAATGGAATGGAGGACACATGG - Intergenic
1073970112 10:109038286-109038308 CTAAGGGAAAGGAAACCAGAAGG - Intergenic
1075739511 10:124685768-124685790 CCATGGGAAAGGAAGGCAGATGG - Intronic
1075819685 10:125296292-125296314 CTTTGGGATTAGAAGCCATAAGG - Intergenic
1077289637 11:1782944-1782966 CTCTGGGAATGGGAGACACAGGG + Intergenic
1077531660 11:3099687-3099709 CAACAGCAATGGAAGCCACAAGG + Intronic
1080982063 11:37419862-37419884 CTGTGGAAATGGCAGCAACAAGG + Intergenic
1081673791 11:44956677-44956699 CTCTGGGAAAGGAAGTCACAGGG + Intergenic
1081677597 11:44979985-44980007 GTTTGGGAATGGAAGACACAGGG + Intergenic
1083775185 11:64891166-64891188 CTATGGAATTGGCAGCCAGAGGG + Intergenic
1084432647 11:69120128-69120150 CCATGAGAATGCAAGCCACAAGG - Intergenic
1084968730 11:72757883-72757905 TTCTGGGGATGGAAGGCACAGGG + Exonic
1085819901 11:79781102-79781124 CCCTGGGAATGGAAACCACAAGG - Intergenic
1086487734 11:87326537-87326559 TTATGGGATTGGATGCCAAAAGG + Intergenic
1088923469 11:114278881-114278903 CTATGGGATGGGAAGGCATAAGG + Intronic
1089376762 11:118000083-118000105 CTGTAGGAATGGAAGCTTCAGGG + Exonic
1090175804 11:124648414-124648436 CTAAGGTAATTAAAGCCACAGGG + Intronic
1091089229 11:132754074-132754096 CTAAGGGAAGGGAAGCCAGCAGG + Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094301082 12:28966174-28966196 CTGTGGGAAATGAAGCCCCAGGG + Intergenic
1096518358 12:52170618-52170640 CCCTGGGAGTGGAAGCCAGATGG - Exonic
1100366758 12:93928592-93928614 ATATGGGAATGGAAGCAAAGAGG + Intergenic
1101003822 12:100382277-100382299 AGATAGGAATGGAGGCCACAGGG + Intronic
1102418955 12:112788755-112788777 CTTTGGGATTGGAAGCCAAGAGG + Intronic
1103180933 12:118910740-118910762 CTATGTGGATGGAAGCCAGATGG + Intergenic
1104034946 12:125091659-125091681 CTATGGGGAAAGAAGCCAGAAGG + Intronic
1104381005 12:128307980-128308002 CCATGGGAATGAGAGGCACAGGG + Intronic
1104969213 12:132523637-132523659 CGATGGGAAAGGCTGCCACAGGG - Intronic
1105825986 13:24123961-24123983 CCATGGGAAAGGAAGGCTCAGGG + Intronic
1107707628 13:43123080-43123102 TTGTGGGGATGGAAGCCAAATGG + Intergenic
1109336643 13:61003252-61003274 CTATGGTAGTGGTGGCCACAAGG - Intergenic
1112610903 13:100953566-100953588 CTATGGGAATTTAGGCCCCAGGG + Intergenic
1113696240 13:112348265-112348287 CTGTGTGAATGGAAGCCACAGGG + Intergenic
1118461047 14:65987426-65987448 ACATGGGAATGGAAACCAGATGG + Intronic
1124042161 15:26115701-26115723 CTATCGGAATGTAGGCCACTAGG + Intergenic
1124396425 15:29305986-29306008 CTACCGAACTGGAAGCCACATGG + Intronic
1125610036 15:40963712-40963734 ATGTGGGGCTGGAAGCCACATGG + Intergenic
1126787291 15:52187456-52187478 CTATGGGAATGGAAGGCGAGAGG + Intronic
1128736849 15:70058322-70058344 CTAGGAGAATGGAAGCCTCATGG - Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129985952 15:79919883-79919905 CTAAGGAAAAAGAAGCCACAGGG - Intronic
1131944018 15:97599171-97599193 CTATGGAATTGGAAGGCACATGG + Intergenic
1132235352 15:100215979-100216001 TCTTGGGAATGTAAGCCACAGGG + Intronic
1132377379 15:101338449-101338471 CTTTGGGAAGGTAAGCCACATGG + Intronic
1132769183 16:1551485-1551507 CTAAGGCGATGGGAGCCACAAGG + Intronic
1133066303 16:3209671-3209693 CAGTGGGACTGGAAGCCCCAGGG - Intergenic
1133643877 16:7744640-7744662 CTGAGGGAATGGGAGACACAGGG - Intergenic
1134330939 16:13250629-13250651 CTCTGGGAATGGCACCCACCAGG + Intergenic
1137622130 16:49883071-49883093 CTATGAGGATGGAAGCTGCAGGG + Intergenic
1137687593 16:50397369-50397391 CTAAGGGAAGAGAAGCCCCAGGG + Intergenic
1140079494 16:71731821-71731843 ATAGGGGTATGGAAGCTACAAGG + Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1143232007 17:5364364-5364386 TAATGGGAATGTAAGCTACAAGG + Intronic
1146427412 17:32754742-32754764 CTATGGGTAGGGAAGTCTCAGGG + Intronic
1146436993 17:32859459-32859481 CCAGGGGAAGGGGAGCCACAGGG - Intronic
1148130759 17:45261478-45261500 CTATGGGAAGGGGAGACACAGGG + Intronic
1149147266 17:53509851-53509873 CTTTGGAGATGGGAGCCACATGG - Intergenic
1150299078 17:64033649-64033671 CTATGGTGATGGAAGCCAGAGGG + Intergenic
1151020327 17:70608938-70608960 CTAGGGTAATGGAAACAACAGGG - Intergenic
1154487722 18:14889338-14889360 CAATGGTAATGGAAGATACAAGG + Intergenic
1155233316 18:23794781-23794803 CCATGGTAAATGAAGCCACATGG - Intronic
1155687659 18:28575199-28575221 ATAAGGGAATGAAAGACACAGGG + Intergenic
1155693249 18:28652710-28652732 CTAGGAGATTGGAAGGCACATGG + Intergenic
1156137700 18:34063212-34063234 CTATGGGAAATAAAGCCAAATGG + Intronic
1158179410 18:54697150-54697172 ATGTGGCACTGGAAGCCACAGGG - Intergenic
1159107274 18:64016753-64016775 TTATGGGTATGGAAGACAAATGG + Intergenic
1160371665 18:78377440-78377462 CTATGGCAATGAAAGCCTCCAGG + Intergenic
1160671839 19:368833-368855 CTGTGTGCATGGAAGCCGCAGGG - Intronic
1160752905 19:743097-743119 CTTTGGGAATCCAAACCACAGGG - Intronic
1161786376 19:6328600-6328622 CTTTGGGAAGTGAAGGCACAAGG + Intronic
1162305652 19:9871769-9871791 CCCTGGGAAAGGAAACCACAGGG + Intronic
1168534562 19:57158260-57158282 ATACAGGAAGGGAAGCCACATGG - Intronic
925762132 2:7195397-7195419 GTATGGAAATGGAAGCCATGCGG - Intergenic
926171146 2:10553222-10553244 CCTTGGGAATGGAAGGAACAGGG + Intergenic
926827097 2:16916347-16916369 CCGTGGGAATGGCAGTCACATGG - Intergenic
926862648 2:17325309-17325331 CTATGGGAAGGGATGACAAAAGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
929098624 2:38287340-38287362 CTAGGGGAATAGAAGACACCAGG + Intergenic
930404866 2:50942255-50942277 CTGTGGGAATGGAGCCCACATGG + Intronic
930422489 2:51170618-51170640 GTATCAGAATAGAAGCCACAAGG + Intergenic
932740837 2:74290106-74290128 CTTAGGGAATGGCAGGCACAGGG - Intronic
934524977 2:95046218-95046240 CTATGTGAATTCAAACCACAGGG + Intronic
935354791 2:102187933-102187955 CTCTGGGAACGGAGGACACACGG - Intronic
935522696 2:104127414-104127436 CTATGTCAATAGAAACCACATGG + Intergenic
938173073 2:129099977-129099999 CTATGGAAAAGGAAAGCACAAGG - Intergenic
938305940 2:130253964-130253986 CTATGGCGATGGGGGCCACATGG + Intergenic
938448214 2:131393807-131393829 CTATGGCGATGGGGGCCACATGG - Intergenic
939222661 2:139322518-139322540 CTGTGAAAATGGAAGCCAGATGG - Intergenic
939563927 2:143764636-143764658 CTATGGGAGTGGAAGCTGGAAGG - Intronic
941744985 2:169077808-169077830 ATGGGGGAAGGGAAGCCACAAGG - Intronic
942409849 2:175697518-175697540 CATAGGGAATGGAAGTCACAGGG + Intergenic
943229881 2:185235296-185235318 GCATGGGAATGGTAGCCAGAGGG - Intergenic
943340190 2:186671454-186671476 ATATGGGAAAATAAGCCACAAGG - Intronic
944324946 2:198393164-198393186 CTATTGGGATGGAGGGCACATGG + Intronic
946114716 2:217451311-217451333 CCACTGGAATGGAAGCCCCATGG + Intronic
947733268 2:232442473-232442495 CCCTGGGACAGGAAGCCACATGG - Intergenic
947946162 2:234104238-234104260 CTATAGGAAGGAAAGCCAGATGG + Intergenic
948230066 2:236342826-236342848 CTAGGGGACTGCAAGCCAAAGGG - Intronic
948374973 2:237515429-237515451 CTCTGGGAGTGAAAACCACAAGG + Intronic
1168736791 20:147163-147185 CTATGGGAAAAGATGCCAGAGGG - Intergenic
1169673318 20:8128802-8128824 CTCTGGGAATGTCAGCCTCAGGG - Intergenic
1169676988 20:8165499-8165521 CTAAGGTAAAGGAAGGCACAAGG - Intronic
1173909796 20:46658107-46658129 CAGTGTCAATGGAAGCCACATGG - Intronic
1174965324 20:55207877-55207899 CTGTGGGAGTGGAACCCTCATGG + Intergenic
1175174709 20:57104241-57104263 CTGTTGGAATGGGAGCAACAAGG - Intergenic
1178553957 21:33569720-33569742 CCATGGGACTGGAAGCCTGAGGG + Intronic
1179171331 21:38975258-38975280 GGATGGGATTGGGAGCCACATGG - Intergenic
1180013464 21:45067068-45067090 TTATGGAAATGCAAGACACAGGG + Intergenic
1181426197 22:22841759-22841781 ATGAGGGAATTGAAGCCACAAGG + Intronic
1184427555 22:44421907-44421929 CTATGGGATTGAAAGCAAAATGG - Intergenic
1184849166 22:47109943-47109965 CTCTGAGAATGGATGGCACATGG - Intronic
1185017414 22:48352814-48352836 CTCTGGGGATGGGAGGCACATGG - Intergenic
1185352944 22:50347466-50347488 TGATGGGGATGGAAGCAACAGGG - Intronic
952566881 3:34669432-34669454 CTGTGGTAGTGGTAGCCACAGGG + Intergenic
952668811 3:35940913-35940935 CTATGGGAATGGTATCCAGTAGG + Intergenic
953843268 3:46406798-46406820 TTAGGAAAATGGAAGCCACAGGG - Intergenic
956332779 3:68129785-68129807 CCATGGGAATCGTAACCACATGG + Intronic
958081028 3:88746711-88746733 CTATGGTTATGGAATCAACAGGG - Intergenic
958139934 3:89549336-89549358 TTTTGAGAATGAAAGCCACATGG - Intergenic
958696852 3:97538783-97538805 TCATGGGAATGGAGGCCAGATGG + Intronic
960426195 3:117510459-117510481 CTCTGAGGATGGAAGCCACATGG + Intergenic
962603512 3:137012675-137012697 CCATTGGAATGTAAGCCTCATGG - Intergenic
963043434 3:141085420-141085442 CTATGGGAATGGAAGCCACAAGG - Intronic
963475798 3:145802156-145802178 CTACTGGAAAGGAAGCCTCATGG + Intergenic
964634273 3:158843315-158843337 CCAAGGGAATGGAAGCCGAAAGG + Intergenic
965448046 3:168800418-168800440 CTTTTGGAATGGATGCAACATGG + Intergenic
965620629 3:170639321-170639343 CTATGGAAAATGAAGCCACTTGG + Intronic
965687311 3:171317913-171317935 CCATGGGAAAGGTAGACACATGG - Intronic
966047028 3:175564711-175564733 CTATGGGAATTGTACCCAGAGGG + Intronic
966097578 3:176222870-176222892 TTATGGGAATGAAGACCACAAGG - Intergenic
966443477 3:179974276-179974298 CTGTGGGAGGAGAAGCCACAGGG + Intronic
969199070 4:5587534-5587556 CAATGGGAATGGTAACTACATGG - Intronic
972315015 4:37918135-37918157 CTTTGAGAATGGAAATCACATGG - Intronic
976221695 4:82761532-82761554 CTGTGGGAATGGAGGCTTCAGGG - Intronic
977199310 4:94097074-94097096 CCATGAAAATGGAAGCCAAAAGG - Intergenic
981074130 4:140574756-140574778 GTATGGGGATTGAAGCCCCATGG + Intergenic
982634246 4:157872591-157872613 TTCAGGGACTGGAAGCCACAGGG - Intergenic
983046941 4:162998894-162998916 CAATGGGAATGTATGGCACAGGG - Intergenic
983456100 4:167967019-167967041 CTATAGGAATGAAAACAACATGG - Intergenic
984107727 4:175571090-175571112 CTCTGGGGATGAAAGGCACAAGG + Intergenic
985393549 4:189516472-189516494 CCATTGGAATGGAAGCTCCATGG + Intergenic
986062885 5:4208289-4208311 CAAAGTGAATGGAAGCCAAAGGG + Intergenic
987043483 5:14085127-14085149 CCATGAGGAAGGAAGCCACAGGG - Intergenic
989554187 5:42772853-42772875 CTATTGGAAAGGAAACCACTGGG - Intronic
990486576 5:56265154-56265176 TTATGGGAATGAAAGGCATATGG + Intergenic
990533340 5:56695543-56695565 CTATGAGAATGAAAGCCACATGG - Intergenic
990766080 5:59184215-59184237 CTATTGGAATGGAACCCATTAGG - Intronic
998281515 5:140812700-140812722 CTTTGGGAATCCAAGGCACAAGG - Intronic
998778865 5:145633903-145633925 CTATGGGAATGCAGGGAACATGG - Intronic
999169570 5:149581790-149581812 TTATGAGAATGTAAGCCACCTGG + Intronic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008624129 6:53301083-53301105 CTAAAGGAATGGGAGGCACAGGG + Intronic
1013348728 6:109287340-109287362 TGAAGGGAATGGAAGCCTCAAGG - Intergenic
1013917837 6:115363587-115363609 CTATGGGAAAGGAAGTGAGATGG - Intergenic
1014616082 6:123601383-123601405 CTATGGGTATGCATACCACAGGG - Intronic
1015439412 6:133231244-133231266 CTGTGAGGATGGAAGCCACCCGG - Intergenic
1015597060 6:134875850-134875872 CAATGGGAGTGCTAGCCACAGGG + Intergenic
1017687151 6:156924967-156924989 GAATGAGAAAGGAAGCCACATGG - Intronic
1019750416 7:2725646-2725668 CTCTGGGAGTGGAGCCCACAGGG - Intronic
1020608113 7:10362801-10362823 CTGTGGGAGTGGAACCCTCATGG + Intergenic
1022680705 7:32542816-32542838 AGATGGTAATTGAAGCCACAGGG - Intronic
1033041095 7:137918926-137918948 CTCAGGGAATGGAAACCACAGGG + Intronic
1034671172 7:152859767-152859789 CTAAGGAAAAGGAAGCCACTTGG + Intergenic
1035260373 7:157658162-157658184 CTATCAGAATATAAGCCACAGGG + Intronic
1036105459 8:5833356-5833378 CCATGGGAATGGTAAACACATGG + Intergenic
1040792031 8:51242694-51242716 CCATGAGAATGTAAGCCTCATGG - Intergenic
1042865065 8:73349671-73349693 CCACGGGAAAGGAAGGCACAGGG + Intergenic
1043657103 8:82681733-82681755 TTATGAGAAAGGAAACCACAGGG - Intergenic
1046834373 8:118783043-118783065 CTCTGGGTAAGTAAGCCACATGG - Intergenic
1047888179 8:129276576-129276598 CTATGGGAGGGGAGGCCATAAGG - Intergenic
1049400965 8:142427056-142427078 CTGGAGGAATGGAGGCCACATGG - Intergenic
1049854688 8:144853867-144853889 AAATGCGAATGGAAGCCACGGGG + Intergenic
1050013748 9:1211402-1211424 CTATGAGAATGGAGACAACAAGG - Intergenic
1052295921 9:26895819-26895841 TTTTGGGAGTGGAAGCCACCAGG + Intergenic
1052323026 9:27188796-27188818 CTGTGGGAATGTAAGCTCCATGG - Intronic
1055020031 9:71659774-71659796 CTATGGGAATGACAGCACCAAGG + Intergenic
1058904855 9:109474442-109474464 CTAGGGGAGAGGAAGCCCCAGGG + Intronic
1059593019 9:115684094-115684116 CACTGGAAATGGAAGCTACATGG - Intergenic
1060516550 9:124269664-124269686 GGATGGGATTGGAAGGCACAAGG + Intronic
1061051443 9:128198265-128198287 CTGCTGGAATGGAAGTCACAGGG - Intronic
1062123636 9:134847918-134847940 AGATGGGGAGGGAAGCCACACGG + Intergenic
1062746355 9:138215327-138215349 CTAAAGAAATGGAAGCCAAATGG - Intergenic
1186262487 X:7794184-7794206 CTATGGGAAGGGATGCATCACGG + Intergenic
1186896380 X:14008389-14008411 CTTTGGCACTGCAAGCCACACGG - Exonic
1188027104 X:25221229-25221251 CTATTGGAATGTAAGCACCATGG - Intergenic
1188313773 X:28649033-28649055 TTATTGTCATGGAAGCCACAAGG + Intronic
1188497129 X:30792755-30792777 CGATGGGAAGGCAAGGCACAAGG - Intergenic
1189351844 X:40281389-40281411 CTAGGAGAATGGAGACCACATGG + Intergenic
1189368644 X:40410234-40410256 CTGTAGGAATGGAATCCACAAGG - Intergenic
1189442271 X:41048203-41048225 CTGTGTCAATGGAAACCACATGG - Intergenic
1189901313 X:45709811-45709833 CTATGAGAATGTAAGCTACATGG + Intergenic
1190374292 X:49774399-49774421 CTATGGTGTTGGTAGCCACAGGG - Intergenic
1192204801 X:69088738-69088760 CTATAGGAATGGAAAATACAGGG + Intergenic
1192547800 X:72028024-72028046 CTAGAGGAATGGAGGCCAGAGGG + Intergenic
1193830908 X:86288653-86288675 CTATGGTAGTGGTAGCCACTGGG - Intronic
1195703061 X:107719254-107719276 GTATGGGAAGGGAAGGCAAAAGG + Intronic
1196015182 X:110931852-110931874 CTATGGTAATGAAAGCAATATGG + Intergenic
1198387569 X:136144169-136144191 CTTTGTCAATGGAATCCACAGGG - Intergenic
1199869799 X:151888202-151888224 CTACAGGAATGGAGCCCACATGG + Intergenic
1200900462 Y:8426304-8426326 CTATGCACATGGAGGCCACATGG - Intergenic
1201532735 Y:15010105-15010127 CCATGGGAATGGAATTGACATGG + Intergenic