ID: 963044887

View in Genome Browser
Species Human (GRCh38)
Location 3:141095107-141095129
Sequence GGTGGGGAAGAGGCCGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1141
Summary {0: 1, 1: 0, 2: 8, 3: 83, 4: 1049}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963044884_963044887 -8 Left 963044884 3:141095092-141095114 CCTATTTGAGTTAGAGGTGGGGA 0: 1
1: 0
2: 0
3: 11
4: 118
Right 963044887 3:141095107-141095129 GGTGGGGAAGAGGCCGAGGCAGG 0: 1
1: 0
2: 8
3: 83
4: 1049
963044882_963044887 -7 Left 963044882 3:141095091-141095113 CCCTATTTGAGTTAGAGGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 120
Right 963044887 3:141095107-141095129 GGTGGGGAAGAGGCCGAGGCAGG 0: 1
1: 0
2: 8
3: 83
4: 1049
963044877_963044887 17 Left 963044877 3:141095067-141095089 CCAAACGGGGCGTGTCTCGTCGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 963044887 3:141095107-141095129 GGTGGGGAAGAGGCCGAGGCAGG 0: 1
1: 0
2: 8
3: 83
4: 1049

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963044887 Original CRISPR GGTGGGGAAGAGGCCGAGGC AGG Intronic
900013603 1:135164-135186 TGTGAGGCCGAGGCCGAGGCTGG + Intergenic
900043671 1:491147-491169 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
900065109 1:726150-726172 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
900160544 1:1221257-1221279 GGATGGGGAGAGGCCAAGGCAGG + Intronic
900178977 1:1303104-1303126 GTTGGGGGAGAGGCCGAGGGAGG - Intronic
900368706 1:2322062-2322084 TGTGGGGAAGGGGCCAGGGCGGG - Intronic
900522917 1:3114862-3114884 GGGGAGGAAGAGGCCCTGGCCGG + Intronic
900566318 1:3333839-3333861 AGTGGGCAAGAGGGAGAGGCTGG - Intronic
900611427 1:3546181-3546203 GTGGGGGAGGAGGCCGAGGAGGG - Intronic
900691798 1:3985231-3985253 GGATGGGAAGAGGCTGGGGCAGG - Intergenic
900970131 1:5987465-5987487 GGTGGGGCAGAGGCAGCAGCAGG + Intronic
901007292 1:6178281-6178303 GGAGGGGAAGAGGCCAGGGAAGG - Intronic
901061491 1:6473961-6473983 GGGTGGGAAGGGGCCCAGGCTGG - Intronic
901134266 1:6982872-6982894 GGTGGGGACCAGGCCAATGCAGG + Intronic
901464614 1:9413316-9413338 GGTGGGGGTGGGGCGGAGGCTGG + Intergenic
901473181 1:9471902-9471924 GGTGGGGATGAGGGCGGGGTGGG - Intergenic
901633933 1:10660986-10661008 GGTGGGGAAGATGCTCTGGCCGG + Intronic
901648480 1:10729116-10729138 GGTGGGGAGGAGGGGGCGGCCGG + Intronic
901791598 1:11656100-11656122 GGTGGGGTACAGGCCGGGTCTGG + Exonic
902039683 1:13483650-13483672 GGTGGTGAAGTGGCCCAGCCTGG - Intronic
902547948 1:17201904-17201926 GGTAGGGCAGGGGCCCAGGCAGG + Intergenic
902633630 1:17720446-17720468 GGTGAGGAGGAGGCCTAGGCAGG - Intergenic
902674543 1:17999592-17999614 GGTGAGGAAGTGGCAGAGCCAGG - Intergenic
902785620 1:18730909-18730931 GGTGGGGTAGGGGCCGTGGCGGG + Intronic
902864551 1:19269540-19269562 GGTCGGGAATAGGCTGAGTCAGG + Intergenic
902866774 1:19284975-19284997 GGTCGGGAATAGGCTGAGACAGG + Intronic
903250862 1:22052592-22052614 GAAGGGGAAGAGGCTGGGGCGGG - Intergenic
903455422 1:23483986-23484008 GGAGGTGAGGGGGCCGAGGCGGG - Exonic
903546090 1:24124224-24124246 GGTAGGGTAGAGGCAGAGGGAGG + Intronic
903593660 1:24477623-24477645 GGTGGGTAAGTGGCAGAGCCTGG + Intergenic
903750157 1:25616641-25616663 GGCGGGGCAGAGGCCGAGCGCGG - Intergenic
903774581 1:25784658-25784680 GATTGGGAAGAGGCCCAGGGAGG + Exonic
904322812 1:29707883-29707905 GGTGGGGAGGAGGAAGAGGAGGG - Intergenic
904467811 1:30718574-30718596 GGGGGGGCAGAGGCGGAGACGGG - Intronic
904483265 1:30807301-30807323 GGTGGGGCAGAACCCGAGCCTGG + Intergenic
904567456 1:31436087-31436109 GCTGGGGCAGGGGCCGAGGAGGG + Intergenic
904771491 1:32883845-32883867 GGTGGGGTAGAAGCAGAGGCAGG - Intergenic
904771986 1:32885953-32885975 GGTGGGGAAGGGGGCGTGTCTGG + Intergenic
904775974 1:32906795-32906817 GGTGGTGAAGAGGCCAGGACAGG - Intergenic
905035962 1:34918534-34918556 GATGGGGCAGAGGCCCGGGCAGG + Intronic
905331146 1:37198904-37198926 GGAGGGGAAGAGGTGTAGGCAGG + Intergenic
905770880 1:40637117-40637139 GGAGGGGGAGAGGCCAGGGCAGG + Intronic
905957899 1:42014404-42014426 GGTGGGGAAAAGGCAGAGAAAGG + Intronic
906293701 1:44636229-44636251 GGAAGCCAAGAGGCCGAGGCTGG + Intronic
906323862 1:44832366-44832388 GGGGGGGAAAGGGCCTAGGCGGG + Intronic
906658998 1:47569194-47569216 GTTGGGGCAGAGGCCAGGGCGGG - Intergenic
907049684 1:51321759-51321781 GGTGAGGAAGAGGTCCAGGGCGG + Exonic
907246765 1:53113929-53113951 GGAGGGGAAGATGGGGAGGCAGG - Intronic
907903583 1:58763904-58763926 GGTAGGGAAGAGACAGGGGCTGG - Intergenic
908252019 1:62273209-62273231 GGCGGGGAGGAGGAGGAGGCCGG + Exonic
909054111 1:70803023-70803045 AGTGGGTAACAGGCAGAGGCTGG + Intergenic
909392518 1:75133699-75133721 GGCGGGGAAGCGGCGGAGGGAGG - Intronic
910646951 1:89524760-89524782 GGAGGGGACGGGGCGGAGGCAGG - Intergenic
910849871 1:91639546-91639568 AGTGTTTAAGAGGCCGAGGCAGG - Intergenic
911154511 1:94625117-94625139 GGTGGGTAAGAGGCAGCTGCAGG + Intergenic
911304067 1:96211530-96211552 GGTGGGTAGGAAGCCCAGGCAGG + Intergenic
912723090 1:112036297-112036319 GGAGAGGCAGAGGCTGAGGCAGG - Intergenic
912814679 1:112819603-112819625 AGTGGGGAAGATGCCCTGGCAGG + Intergenic
912852763 1:113141208-113141230 GGTGGGGAAGAGGGGGAAGAAGG - Intergenic
912989872 1:114474643-114474665 GGAGGCCAAGAGGCCAAGGCAGG + Intronic
913703316 1:121395987-121396009 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
913703401 1:121396287-121396309 GGCGGGCAAGAAGCCGAGGCGGG - Intergenic
913938927 1:125085592-125085614 GGCGGGCAACAAGCCGAGGCGGG + Intergenic
913939005 1:125085873-125085895 GGTGGGCAAAAAGCCGAGGCAGG + Intergenic
913939076 1:125086123-125086145 GGCGGGCAAAAAGCCGAGGCGGG + Intergenic
913939304 1:125086940-125086962 GGCGGGCAAAATGCCGAGGCGGG + Intergenic
913939352 1:125087114-125087136 GGTGGGCAAAAAGCCGAGGCAGG + Intergenic
913939414 1:125087349-125087371 GGCGGGCAAAAAGCCGAGGCGGG + Intergenic
913979699 1:143497866-143497888 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
913979748 1:143498023-143498045 GGCGGGCAAAAAGCCGAGGCAGG - Intergenic
913979795 1:143498183-143498205 GGTGGGCAAGAAGCCGAGGCGGG - Intergenic
914043920 1:144076599-144076621 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
914044025 1:144076950-144076972 GGTGGGCAAAAAGCCGGGGCGGG - Intergenic
914074033 1:144323293-144323315 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
914074058 1:144323380-144323402 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
914074077 1:144323444-144323466 GGCGGGCAACAAGCCGAGGCGGG - Intergenic
914074101 1:144323525-144323547 GGCGGGCAAAAAGCCGAGGCAGG - Intergenic
914074150 1:144323685-144323707 GGTGGGCAAGAAGCCGAGGCGGG - Intergenic
914105026 1:144642761-144642783 GGTGGGCAAGAAGCCGAGGCGGG + Intergenic
914105076 1:144642922-144642944 GGCGGGCAAAAAGCCGAGGCAGG + Intergenic
914105100 1:144643003-144643025 GGCGGGCAACAAGCCGAGGCGGG + Intergenic
914105119 1:144643067-144643089 GGCGGGCAAAAAGCCGAGGCGGG + Intergenic
914134127 1:144883826-144883848 GGCGGGCAAAAAGCCGAGGCGGG + Intergenic
914428482 1:147599833-147599855 GGGCGGGAGGAGGCCGCGGCGGG + Intronic
914474758 1:148013855-148013877 GCTGGGGAGGAGGAGGAGGCCGG + Intergenic
914869081 1:151458689-151458711 GCTGGGGAAGGGGCGGGGGCGGG - Intronic
915116977 1:153607446-153607468 GGTGGGCAGGAGGCTGAGGAGGG + Exonic
915310999 1:155005758-155005780 GAGGGGGAAGAGGCCAGGGCGGG - Intronic
915401262 1:155623634-155623656 GTTGGGGAAAAAGCTGAGGCAGG - Intergenic
915436626 1:155911441-155911463 GGGCGGGAAGAGGGCGGGGCAGG - Intergenic
915913418 1:159928113-159928135 GGTGGGACTGAGGCGGAGGCAGG + Intronic
917133372 1:171764305-171764327 GGTGGGGAAGGGCCCCAGGTGGG - Intergenic
917975084 1:180233229-180233251 GGCGAGGAAGAGGCCAAGTCTGG - Intronic
918066548 1:181105452-181105474 TGTGGGGAGGCGGCCGCGGCGGG + Intergenic
919058072 1:192595429-192595451 GGTGGGGAGGAGGAGGAGGTAGG + Intergenic
919884110 1:201920304-201920326 GGTGGGTGGGAGGCTGAGGCGGG - Intronic
919914777 1:202132633-202132655 GGTGAAGGAGAGGCCGAGGGAGG + Exonic
919944160 1:202307660-202307682 GATGGGGATGGGACCGAGGCAGG - Intronic
920033700 1:203052074-203052096 GGTGGGCAAGAGGTGGGGGCTGG + Intronic
920132664 1:203744739-203744761 GGAGGGGAAGGGGCTGAGGCGGG + Intergenic
920869722 1:209783986-209784008 TTTGGGGCAGAGGCGGAGGCGGG + Intronic
921177727 1:212608597-212608619 GGTGGAGGAGGGGCCAAGGCGGG - Intronic
922100216 1:222472987-222473009 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
922102240 1:222486820-222486842 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
922345034 1:224689497-224689519 GGGAGGGAGGAGGCCCAGGCCGG - Intronic
922719469 1:227893011-227893033 AGTGGGGAAGGGGCCTGGGCTGG - Intergenic
923482458 1:234397476-234397498 GATGGGGAAGAGGGGGAGGGGGG + Intronic
923630137 1:235644381-235644403 GGTGTGGAGGTGGCCGAGGAGGG - Intronic
923684041 1:236142145-236142167 GATGGGGAAGGGGCCGGGGACGG + Intergenic
923836289 1:237614763-237614785 GGTGAGGAAGAAGCCAAGGGGGG + Exonic
924012330 1:239679287-239679309 GCAGGGGAGGAGGCAGAGGCAGG - Intronic
924441260 1:244087328-244087350 TGTGGTGAAGAGGCCGAGATTGG + Intergenic
924584374 1:245348844-245348866 CGTGGGGAAGCGACCCAGGCAGG - Intronic
1062899573 10:1132723-1132745 GCTGGGGCTGAGGCTGAGGCTGG + Intergenic
1062936015 10:1390312-1390334 TGTGGGGAAGAGGCGGAAGTGGG + Intronic
1062976056 10:1683838-1683860 GGTGGGGCTGAGTCCGAGGCCGG + Intronic
1063469324 10:6271922-6271944 GGTGTGGAAGTGGGAGAGGCAGG + Intergenic
1064143469 10:12809003-12809025 GGTGCGCAGGAGGCTGAGGCAGG + Intronic
1064509731 10:16076869-16076891 GGTGGAGATGAGGGTGAGGCTGG + Intergenic
1065287686 10:24201690-24201712 GGTGGGGCGGAAGCAGAGGCGGG - Intronic
1065450333 10:25849708-25849730 GGATGGGAAGAGGCAGAGGGGGG + Intergenic
1065505150 10:26422834-26422856 GGTGGTCAGGAGGCTGAGGCAGG + Intergenic
1065687667 10:28302656-28302678 GGTGGGGGCGGGGCCGGGGCAGG - Intronic
1066040868 10:31547068-31547090 GGTGGGTAACAGGCCGAGATTGG - Intergenic
1066429151 10:35336259-35336281 GGAGTGGAGGAGGCAGAGGCCGG + Intronic
1066465206 10:35643775-35643797 GGAGGGGAAGAGGAGGAGGGGGG - Intergenic
1066733275 10:38451740-38451762 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1066745053 10:38600409-38600431 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
1066745249 10:38601123-38601145 GGGGGGCAAAAAGCCGAGGCGGG - Intergenic
1067732131 10:48820175-48820197 GGTGGGAAAGAGCTTGAGGCAGG + Intronic
1067947520 10:50699396-50699418 GGTGAGGAAGGGGCCGGGGATGG - Intergenic
1068221446 10:54051235-54051257 AGTGGGTAACAGGCAGAGGCTGG + Intronic
1068971442 10:62962533-62962555 GGTTGAGCAGAGGCAGAGGCAGG - Intergenic
1069114555 10:64489044-64489066 GCTGGGCAGGAGGCTGAGGCAGG + Intergenic
1069234265 10:66050541-66050563 GCTAGTGAAGAGGCTGAGGCAGG - Intronic
1069747914 10:70727479-70727501 TGTGGGCAGGAGGCAGAGGCTGG + Intronic
1069846629 10:71376873-71376895 GCTGAGGCAGAGGCAGAGGCAGG - Intergenic
1069934311 10:71904878-71904900 GGCAGGGAGGAGGCCGAGGGAGG + Intergenic
1070322230 10:75362947-75362969 GGTGGGGACTTGGCCAAGGCTGG - Intergenic
1070556705 10:77533594-77533616 GGTGGGGGAGGGGCAGAGCCTGG - Intronic
1070751265 10:78965328-78965350 GGCGGGGAGGAGGCCCAGGCAGG + Intergenic
1071466079 10:85940865-85940887 AGAGGAGAAGAGACCGAGGCAGG + Intronic
1072386418 10:94934452-94934474 GGTTGTCAAGAGGCTGAGGCAGG + Intergenic
1072660916 10:97363072-97363094 GGTGGGGAAGCGGCAGACTCTGG - Intronic
1072736953 10:97885642-97885664 GGTGGGGAGGAGGCGGGGGCTGG + Intronic
1073406781 10:103305380-103305402 GCTGGTCAAGAGGCTGAGGCAGG - Intronic
1074287616 10:112113087-112113109 GGTGGGGAAGAGGCAAAGAAAGG + Intergenic
1074489292 10:113924532-113924554 GGCTGGGGAGAGGCTGAGGCTGG + Intergenic
1075072042 10:119326127-119326149 TGTGGGGCAGAGGCACAGGCAGG - Intronic
1075077470 10:119360750-119360772 GGTGTGGAAGAGGAGGAGGGAGG - Intronic
1075088014 10:119426443-119426465 CCTTGGGAAGAGGCAGAGGCGGG - Intronic
1075445410 10:122509541-122509563 GGGTGGAAAGAGGCCAAGGCCGG + Intronic
1075446348 10:122516092-122516114 GGTGGGGAGGATGCCGTGGGTGG + Intergenic
1075488735 10:122848136-122848158 GCTTGGGAAGAGGCCAAGTCAGG - Intronic
1075680794 10:124329886-124329908 GGTGGGGAAGAGGAAGAGAGAGG - Intergenic
1075763474 10:124874399-124874421 CTTTGGGAGGAGGCCGAGGCAGG - Intergenic
1076278921 10:129228834-129228856 GACGGGGAAGAGGCAGAGGGGGG - Intergenic
1076839462 10:133038940-133038962 GGTGTCGGGGAGGCCGAGGCTGG + Intergenic
1076839893 10:133040695-133040717 GGTGGGGAAGGGAGCGGGGCAGG + Intergenic
1076886404 10:133264793-133264815 GGTGGGGCAGAGGCTGCAGCAGG - Intronic
1076969945 11:127378-127400 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
1076998607 11:311168-311190 GAGGGGGAAGCGGCGGAGGCGGG + Intronic
1077000136 11:318591-318613 GAGGGGGAAGCGGCGGAGGCGGG - Intergenic
1077014500 11:393733-393755 GGTGGGGATGAGGCCTAGGAAGG - Intronic
1077062204 11:622569-622591 AGGTGGGCAGAGGCCGAGGCAGG - Intronic
1077207923 11:1353007-1353029 GGTGGGGATGAGGGTGAGGGTGG - Intergenic
1077311151 11:1889629-1889651 GTAGGGGATGAGGCCCAGGCAGG + Exonic
1078764068 11:14276607-14276629 GGAGGGGAAGAGGAAGAGGGAGG + Intergenic
1079237139 11:18698986-18699008 GCTGCCGAAGGGGCCGAGGCGGG + Intronic
1079242080 11:18728469-18728491 AGTGCGGGTGAGGCCGAGGCAGG + Exonic
1079601537 11:22316767-22316789 GGTGGGGGAGAGACAGAGGCAGG - Intergenic
1079899955 11:26170239-26170261 GGTAGGCAGGAGGCTGAGGCAGG + Intergenic
1079929864 11:26544434-26544456 GGTGGAGAGGAGGCAGAGGTTGG + Intronic
1080183566 11:29452538-29452560 GGTTGGGAAGATGCCCAGGAAGG + Intergenic
1080370910 11:31641710-31641732 GCTGGGAAAAAGGCTGAGGCAGG - Intronic
1080416359 11:32073149-32073171 GGTGGGGGTGGAGCCGAGGCGGG - Intronic
1080456868 11:32426912-32426934 GGTGGGGGAGTGGCCGCGCCTGG - Intronic
1080657220 11:34267381-34267403 GATGGGGAAGAGGCCAGGGTTGG - Intronic
1080729431 11:34934414-34934436 GGTAGGGAAGAGCCCGGGGGAGG + Intronic
1081870887 11:46382008-46382030 GGTGGGGAAGGGGACGGGCCAGG + Intronic
1081979029 11:47254740-47254762 GAGGGGGAACAGGCCGGGGCTGG - Intronic
1082003787 11:47408787-47408809 GGGGGAGAGGAGGCCGAAGCGGG - Intronic
1082638985 11:55631269-55631291 GATAGAGAAGAGGCTGAGGCAGG + Intergenic
1083303125 11:61749095-61749117 GCTGGGGCAGAGGCTGGGGCAGG - Intergenic
1083441365 11:62678795-62678817 GCTGGGGCAAAGGCCGAGACAGG + Intronic
1083613481 11:64015310-64015332 AGTGGGGAAGGGGCTGCGGCGGG + Intronic
1083627303 11:64078286-64078308 GCTGGAGAAGAGGCCAGGGCAGG - Intronic
1083784936 11:64939164-64939186 GGTGGAGGTGAGGCTGAGGCAGG - Intronic
1083853519 11:65380869-65380891 GGTGGGGCAGAGGCCCAGAGGGG + Intronic
1084033251 11:66493285-66493307 GGTTGGGAAGTGGCAGAGCCAGG - Intronic
1084208631 11:67610743-67610765 GGTGCGGAGGGGACCGAGGCAGG - Intronic
1084310065 11:68311949-68311971 GGTGGGCAAGAGGCCCTGGCGGG + Intergenic
1084447431 11:69212080-69212102 GGAGGGGAAGAGGGGAAGGCGGG - Intergenic
1084453341 11:69252800-69252822 GGTGGGGAGTTGGCAGAGGCTGG + Intergenic
1084720463 11:70902429-70902451 GGTGGGGAGGCGGCAGGGGCTGG - Intronic
1084844507 11:71888577-71888599 TGTGGGGCCCAGGCCGAGGCTGG + Intronic
1085322584 11:75583829-75583851 GGTGGGGAAGGGGACGCCGCGGG + Intergenic
1086365859 11:86109774-86109796 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
1086595690 11:88567901-88567923 GGTGGCCAGGAGGCCAAGGCAGG + Exonic
1088468981 11:110174336-110174358 GGTGGGGAAGAGACGCAGACAGG - Intergenic
1088497467 11:110445662-110445684 GCTGGGAAAGAAGCCCAGGCAGG - Intronic
1088867775 11:113865085-113865107 CTTTGGGAAGAGGCCGAGACGGG - Intronic
1088938887 11:114434040-114434062 GGTACGCAAGAGGCTGAGGCAGG - Intronic
1089138226 11:116266286-116266308 GGGAGGGAAGAGGCAAAGGCAGG + Intergenic
1089659877 11:119978850-119978872 GGAGGAGAAGAGGGCGAGGGAGG - Intergenic
1089699391 11:120235306-120235328 GCTGAGGCAGAGGCTGAGGCTGG + Intergenic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1089845002 11:121451816-121451838 GGTGGGGATGAGGCCGGGGCCGG + Intergenic
1089970264 11:122687731-122687753 GGTGGGGGAAATGCAGAGGCTGG - Intronic
1090074726 11:123573005-123573027 GCTGGGGCAGAGGCCCAGGTAGG + Intronic
1090095923 11:123741576-123741598 GGTGGGAGAGAAGCCGGGGCAGG - Exonic
1090334013 11:125950884-125950906 GATGGGGAAGTGGGTGAGGCTGG - Intergenic
1090699293 11:129279569-129279591 GGAGCGGAGGAGGCGGAGGCTGG - Intergenic
1090777688 11:129979719-129979741 GGAGGGGCAGAATCCGAGGCTGG - Intronic
1090778328 11:129984507-129984529 GGGTGGGCCGAGGCCGAGGCAGG - Intronic
1091070494 11:132558361-132558383 GGAGGGGAAGAGGAGGAGGAGGG - Intronic
1091268634 11:134290024-134290046 AGTGGGGAGGAGGGCGGGGCTGG + Intronic
1091393376 12:139116-139138 AGAGGGGCCGAGGCCGAGGCAGG + Exonic
1091473805 12:753040-753062 GGAGTGGGAGGGGCCGAGGCGGG - Exonic
1091658544 12:2363589-2363611 GGGTGGGGAGAGGCAGAGGCTGG - Intronic
1091854732 12:3730329-3730351 GGTGGGGAAGATGCCAGAGCGGG + Intronic
1092246369 12:6866541-6866563 GGTGGGGGAAAGACTGAGGCAGG - Exonic
1092690121 12:11099450-11099472 GGTGTGGAGGAGGCTGAGGAGGG + Intronic
1093896970 12:24584470-24584492 GGCGGTGGAGAAGCCGAGGCCGG - Intergenic
1095436607 12:42195883-42195905 GGTGGGGAAGAGTGGAAGGCAGG + Intronic
1096155258 12:49338078-49338100 TGTGGGGAAGATGCGGGGGCAGG + Intergenic
1096466278 12:51848911-51848933 GGCGGGGAAGAAGCCGGGGGTGG - Intergenic
1096466391 12:51849197-51849219 CATGGGGACGGGGCCGAGGCCGG + Intergenic
1096520533 12:52182179-52182201 GGTGGGGCAGAGGAGCAGGCCGG + Intronic
1096523128 12:52195171-52195193 AATGGGGAAGAGGCTTAGGCTGG + Intergenic
1096528813 12:52230868-52230890 GGTGGGGTGGAGACAGAGGCTGG + Intergenic
1096562108 12:52443136-52443158 GGTGGGTAAGAGGCAGAGCCAGG - Intergenic
1096682408 12:53265199-53265221 GGCTGGGAGGAGGCTGAGGCAGG - Intergenic
1096743810 12:53712781-53712803 GTTGGGGAAGGGGTAGAGGCAGG + Intronic
1096867453 12:54573255-54573277 GGTGGGGATGTGGCAGGGGCAGG + Intronic
1098771688 12:74560529-74560551 ACTGGGGAACAGGCAGAGGCTGG - Intergenic
1099984564 12:89648170-89648192 GCTGGGTAACAGGCAGAGGCTGG + Intronic
1100468846 12:94873213-94873235 GGTGGGCGACAGGTCGAGGCCGG - Intergenic
1101239550 12:102824528-102824550 GGTGGGGAAGAAGCAGAGCAAGG + Intergenic
1101426280 12:104591162-104591184 GGTGGAGGAGGGGCAGAGGCAGG + Intronic
1101606113 12:106248303-106248325 GGAGGGGACGCGGCCGAGGTGGG + Intronic
1101892563 12:108730733-108730755 GCTTGGGAAGAGGCTGAGCCCGG - Intronic
1101997042 12:109533033-109533055 GGTGAGGGCGAGGCGGAGGCTGG - Intronic
1102031916 12:109744502-109744524 GGTGGTGAAGTTGCAGAGGCGGG - Intronic
1102206442 12:111094260-111094282 GGAGGGGAACAGGCTGCGGCTGG + Intronic
1102248189 12:111368402-111368424 CGTGGGGAAGAGGGTGTGGCAGG + Intronic
1102256415 12:111418167-111418189 GGCGCGGAAGAGGGCGAGGAGGG - Exonic
1102463541 12:113114937-113114959 GGTGGGGCTGAGGGCGAGGCCGG + Intronic
1102789864 12:115635967-115635989 GGAGGGGAAGAGGAAGAGGAGGG + Intergenic
1103362262 12:120361427-120361449 GGTGGGGTTGAGGCCAGGGCAGG + Intronic
1103563460 12:121804247-121804269 GGGGAGGGAGAGGCCGCGGCCGG + Intronic
1103565303 12:121812228-121812250 GGTGGGGGAGCGGCGCAGGCGGG + Intronic
1103568097 12:121827131-121827153 GCTGGGGCAGAGGCCCAGGGAGG + Intronic
1103615203 12:122147489-122147511 GGTGGGGAAGAGGCCCAGGGTGG + Intergenic
1103706484 12:122876872-122876894 GCAGGGGCAGAGGCAGAGGCAGG + Intronic
1103757714 12:123222688-123222710 GCTGGGCAGGAGGCCGAGGTGGG + Intronic
1103905407 12:124325134-124325156 GGAGGGGAAGGGGCCGGGGAGGG - Exonic
1104444594 12:128823328-128823350 GCAGGGGAAGAGGCTGGGGCTGG + Intronic
1104725808 12:131075007-131075029 CGTGGGGCAGAGGCGGGGGCTGG + Intronic
1104771144 12:131365598-131365620 AGTGGGGGAGAGGTGGAGGCAGG - Intergenic
1104897770 12:132172704-132172726 GCTGGGGAAGTGGCTGAGTCTGG - Intergenic
1104973659 12:132542552-132542574 GGTGGGAGAGGGGCTGAGGCAGG - Intronic
1106555418 13:30804454-30804476 GGTGGGGAGGAGGCGAAGTCGGG + Intergenic
1107628466 13:42316666-42316688 AGTGGGGAAGTGGCTGAGCCAGG - Intronic
1108234749 13:48391861-48391883 CTTTGGGAGGAGGCCGAGGCAGG - Intronic
1108938023 13:55910662-55910684 GATGGGGAATAGGCAGATGCAGG - Intergenic
1110309797 13:74036034-74036056 GCTGGGGATGTGGCCGTGGCTGG - Intronic
1110359575 13:74610069-74610091 GGTGGGTAACAGGCAGAGGCTGG + Intergenic
1111847890 13:93534515-93534537 GGTGGGAAAGAGGAGGAGACAGG - Intronic
1112026776 13:95418801-95418823 GGTGGGGAAGAGGACAAAGTGGG - Intergenic
1112506904 13:99981080-99981102 GGAGGGGAGGAGGGGGAGGCTGG - Intergenic
1112507705 13:99985123-99985145 GGCCGGGAGGAGGGCGAGGCAGG + Intronic
1113664552 13:112132131-112132153 GGTGCGGAGGAAGCCGAGGATGG + Intergenic
1113874396 13:113585149-113585171 GGTGGGGCCGGGGCCGGGGCCGG + Intronic
1114073085 14:19131422-19131444 GGTGGGAAAGTGGGCGGGGCAGG + Intergenic
1114089181 14:19268561-19268583 GGTGGGAAAGTGGGCGGGGCAGG - Intergenic
1114174592 14:20309274-20309296 GGAGAGGCAGAGGCAGAGGCAGG - Intergenic
1114483556 14:23049512-23049534 GTTGGGTAGAAGGCCGAGGCAGG + Intronic
1114594839 14:23902820-23902842 GGATGGGAAGAGGGTGAGGCTGG - Intergenic
1114656092 14:24316425-24316447 CGTGGGGAAGCGGCTGAGCCTGG + Exonic
1115120017 14:29927716-29927738 GGAGGGAAAATGGCCGAGGCGGG + Exonic
1115235290 14:31203519-31203541 GCTACTGAAGAGGCCGAGGCAGG + Intronic
1115457696 14:33623688-33623710 TGTGGGGAGGAGGCCTTGGCAGG - Intronic
1116255502 14:42549253-42549275 GCTGGGTAACAGGCAGAGGCAGG - Intergenic
1117338528 14:54775044-54775066 GGTGCCCAAGAGGCCCAGGCGGG - Exonic
1117791180 14:59343728-59343750 AGTTGGAAAGAGGCCAAGGCAGG + Intronic
1117840876 14:59859597-59859619 AGTGGGTAAGAGGCAGAGGTTGG + Intronic
1117875855 14:60249523-60249545 GCTGGGGAAGGGGCGGAGGAGGG - Intronic
1117912281 14:60647736-60647758 GGTGGGGAGGTGGCTGTGGCGGG - Intronic
1118217725 14:63824986-63825008 GCTGGGCAGGAGGCTGAGGCAGG + Intergenic
1118514162 14:66508341-66508363 CGTGGGGGAGAGGCCGCGCCGGG - Exonic
1118845893 14:69547755-69547777 GTGGGGGAAGCGGCCGAGACAGG - Intergenic
1119390631 14:74288998-74289020 GCTACGGAAGAGGCTGAGGCAGG + Intronic
1119541161 14:75438989-75439011 GGTGGGGAAGAGGCTGGGATCGG + Intronic
1119739140 14:77002785-77002807 GGTGGGGCATAGGCAGGGGCAGG - Intergenic
1121002718 14:90463871-90463893 GGTGAGGAGGAGGCCGAGACAGG - Intergenic
1121052748 14:90830153-90830175 GGTGGGGAGGAGACGGAGGACGG + Intergenic
1121544422 14:94753003-94753025 TGTGAGGAAGAGGCCACGGCAGG + Intergenic
1122061295 14:99138401-99138423 CGTGGGGAAGAGGGAGTGGCTGG - Intergenic
1122203688 14:100137680-100137702 GGTGGGGCAGAGGCGGGCGCTGG + Intronic
1122235815 14:100330153-100330175 TGTGGGGAAGAAGCCGAGCCGGG - Exonic
1122480229 14:102042467-102042489 GGTGAGGAAGAGTCGGAAGCAGG - Exonic
1122597482 14:102903429-102903451 GGTGAGGCAGGGGCCGGGGCCGG + Exonic
1122792774 14:104191349-104191371 GGTGGGTGAGAGGCAGAGGTGGG + Intergenic
1122847930 14:104510880-104510902 GGTGGGGCAGTGGCCAGGGCTGG + Intronic
1122948000 14:105021989-105022011 GCTGGGGCAAAGCCCGAGGCAGG + Intergenic
1123396491 15:19943486-19943508 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
1123396523 15:19943591-19943613 GGCGGGTAAGAAGCCGCGGCAGG - Intergenic
1123396632 15:19943959-19943981 GGCGGGGAAAAAGCCAAGGCGGG - Intergenic
1123468674 15:20534324-20534346 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123468842 15:20535365-20535387 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123468850 15:20535407-20535429 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123468858 15:20535449-20535471 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123649198 15:22465241-22465263 GGAGGAGAAGATGCGGAGGCAGG + Exonic
1123649206 15:22465283-22465305 GGAGGAGAAGATGCGGAGGCAGG + Exonic
1123649396 15:22466423-22466445 GGAGGAGAAGATGCGGAGGCAGG + Exonic
1123649418 15:22466570-22466592 GGAGGAGAAGATGCGGAGGCAGG + Exonic
1123649440 15:22466738-22466760 GGAGGAGAAGATGCGGAGGCAGG + Exonic
1123710063 15:22980419-22980441 CGGGAGGAAGAGGCCGAGCCGGG - Intronic
1123728993 15:23129535-23129557 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123729117 15:23130348-23130370 GGAGGAGAAGATGCGGAGGCTGG - Exonic
1123729125 15:23130390-23130412 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123729133 15:23130432-23130454 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123747157 15:23327000-23327022 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1123747285 15:23327834-23327856 GGAGGAGAAGATGCGGAGGCTGG - Intergenic
1123747293 15:23327876-23327898 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1123747301 15:23327918-23327940 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1123916301 15:25031838-25031860 CGCGGGCATGAGGCCGAGGCAGG - Intergenic
1123937926 15:25202967-25202989 GGTGGGGAAGAGGGTGGGGGTGG - Intergenic
1124198145 15:27651661-27651683 TTTGGGGAGGAGGCCAAGGCAGG + Intergenic
1124279425 15:28350316-28350338 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1124279447 15:28350484-28350506 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1124279473 15:28350652-28350674 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1124279658 15:28351750-28351772 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1124279666 15:28351792-28351814 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1124303032 15:28559816-28559838 GGAGGAGAAGATGCGGAGGCAGG + Intergenic
1124303040 15:28559858-28559880 GGAGGAGAAGATGCGGAGGCAGG + Intergenic
1124303225 15:28560956-28560978 GGAGGAGAAGATGCGGAGGCAGG + Intergenic
1124303251 15:28561124-28561146 GGAGGAGAAGATGCGGAGGCAGG + Intergenic
1124303273 15:28561292-28561314 GGAGGAGAAGATGCGGAGGCAGG + Intergenic
1124504453 15:30261269-30261291 GGAGGGAAACAGGGCGAGGCTGG - Intergenic
1124532172 15:30517732-30517754 GGAGGAGAAGATGCAGAGGCAGG + Intergenic
1124739098 15:32277366-32277388 GGAGGGAAACAGGGCGAGGCTGG + Intergenic
1124766481 15:32489913-32489935 GGAGGAGAAGATGCAGAGGCAGG - Intergenic
1124999264 15:34754299-34754321 GATGGGGAGGAGGCAGAGGACGG + Intronic
1125567976 15:40692455-40692477 GGTGGGCATGAGGCAGAGGATGG - Intergenic
1125699191 15:41666028-41666050 GGTGGCCAGGAGGCTGAGGCAGG - Intronic
1125929494 15:43590130-43590152 GGTGGGGGAGTGGCTGGGGCTGG - Intronic
1125942661 15:43689962-43689984 GGTGGGGGAGTGGCTGGGGCTGG - Intergenic
1126010368 15:44296912-44296934 GGTGAGGCAGAGGCAAAGGCAGG - Intronic
1126487516 15:49198813-49198835 GGAGGGGAAGAGGGGGAGGAAGG - Intronic
1126852336 15:52805094-52805116 GGTGGCGAGGAGGCCGACGAAGG - Intergenic
1127260473 15:57323372-57323394 GGTGGGGAGCAGGCCTTGGCAGG + Intergenic
1128223217 15:65982986-65983008 TGTGGGGAAGAGGGAGAAGCGGG - Intronic
1128376050 15:67076799-67076821 CCTGGGGAAGAGGCCCACGCAGG - Intronic
1128564713 15:68693280-68693302 GGTGGGGAAGAGGTCACAGCAGG + Intronic
1128613670 15:69093208-69093230 GGTGGGGCAGAGGGAGAGGTGGG + Intergenic
1128753752 15:70167028-70167050 GGAGGGGAAGAGGTCATGGCCGG + Intergenic
1128940287 15:71782369-71782391 CGTGGGGAAGGGGTCAAGGCAGG - Exonic
1129141419 15:73601677-73601699 GGTGGGGAAGAGGGTGGGGTAGG - Intronic
1129405176 15:75312246-75312268 TGTGGGGAAGGGGCAAAGGCAGG + Intergenic
1129413150 15:75360871-75360893 GGTGGGGGAGAAGCTGAAGCTGG - Intronic
1129432753 15:75512785-75512807 GGTGTGGAAGAGGAAGAGGATGG - Intronic
1129478849 15:75807144-75807166 TGTGGGGAAGGGGCAAAGGCAGG + Intergenic
1129513686 15:76143350-76143372 GGTGTGGACGAGGCTGAAGCTGG - Intronic
1129526072 15:76215418-76215440 GCTGGGGAAGGGCCCCAGGCTGG + Exonic
1129665968 15:77579570-77579592 GGAGGGGCAGATGCCGAGGCAGG + Intergenic
1129896446 15:79111336-79111358 GGGGGGCAGGAGGCTGAGGCAGG - Intergenic
1129924272 15:79348939-79348961 GGTGGGGGAGGGCCCGAGGTGGG - Intronic
1130107563 15:80940517-80940539 GGTGGGGAAGCTGGGGAGGCAGG - Intronic
1130510244 15:84583199-84583221 TGTGGGGAAGGGGCAAAGGCAGG - Intergenic
1130559368 15:84946522-84946544 AGCTGGGAAGAGGCAGAGGCAGG + Intergenic
1130584835 15:85172796-85172818 TGTGGGGAAGGGGCAAAGGCAGG + Intergenic
1131166095 15:90143278-90143300 GGTGTGGAGGAGGCGGGGGCCGG + Intergenic
1131251429 15:90833059-90833081 GGTGGGCAAGAGGAAGAGGGAGG + Intergenic
1131665647 15:94568526-94568548 GGTGGGGCAGAGGAGGAGGCAGG + Intergenic
1131995172 15:98126274-98126296 GGTGGGGAAGAGGGGGAAGTGGG - Intergenic
1132019231 15:98346146-98346168 GGTGGGCAAGAGGCCAGGGAGGG - Intergenic
1132232143 15:100192305-100192327 ACTGGGGATGAGGCCCAGGCAGG + Intronic
1132653094 16:1030449-1030471 GGTGGGGGAGGGGCCCAGACTGG + Intergenic
1132688801 16:1173176-1173198 GGTGTCCAAAAGGCCGAGGCTGG + Intronic
1132709726 16:1261125-1261147 GGTGGGGAAGGGGCCGGGGAAGG - Intergenic
1132726276 16:1339644-1339666 GGTGGGGAAGGGGTTGAGGTGGG - Intronic
1132847028 16:2005408-2005430 GGTGGGGAAGTGGCCCTGTCTGG - Intronic
1132898065 16:2238241-2238263 GGTGGGGCAGGGGCAGGGGCCGG - Intronic
1132935426 16:2478089-2478111 GGAGGTGAAGAGGCCAAGGCCGG + Intronic
1132983848 16:2753202-2753224 GGCGGGGAAGGGGCGGCGGCGGG + Intronic
1133020095 16:2963452-2963474 GGAGGGGAGCAGGCCCAGGCAGG - Intergenic
1133220377 16:4316921-4316943 GGTGGAGGAGGGGGCGAGGCAGG + Intronic
1133235750 16:4386657-4386679 GGAGGGTAAGAGGCAGAGTCAGG - Intronic
1133775028 16:8889266-8889288 GCTGGGGAAGAGGCCGGCCCTGG - Intergenic
1133922036 16:10162060-10162082 GGTGGGGAAGAGGGGGTGGTGGG + Intronic
1134134909 16:11671648-11671670 GGTTGGGGAGATGCCCAGGCTGG - Intronic
1134746621 16:16593705-16593727 CGTGGGGAAGAGGAGGACGCCGG + Intergenic
1134998853 16:18759975-18759997 CGTGGGGAAGAGGAGGACGCCGG - Intergenic
1135113235 16:19706970-19706992 GGCGGTGGAGAAGCCGAGGCCGG + Exonic
1136615800 16:31397717-31397739 GTTGGGGAGGAGGCTGGGGCTGG + Intronic
1136699124 16:32116159-32116181 GGGGGGTAAAAAGCCGAGGCGGG - Intergenic
1136712794 16:32253764-32253786 GGTGGGGCTGAGGAGGAGGCGGG - Intronic
1136755122 16:32675665-32675687 GGTGGGGCTGAGGAGGAGGCGGG + Intronic
1136768540 16:32811845-32811867 GGGGGGCAAAAAGCCGAGGCGGG + Intergenic
1136768544 16:32811862-32811884 GGCGGGCAAAAAGCCGAGGCGGG + Intergenic
1136799662 16:33059525-33059547 GGGGGGCAAAAAGCCGAGGCGGG - Intergenic
1136812991 16:33194704-33194726 GGTGGGGCTGAGGAGGAGGCGGG - Intronic
1136819467 16:33304784-33304806 GGTGGGGCTGAGGAGGAGGCGGG - Intronic
1136826030 16:33361319-33361341 GGTGGGGCTGAGGAGGAGGCGGG - Intronic
1136831096 16:33460090-33460112 GGTGGGGCTGAGGAGGAGGCGGG - Intronic
1136957273 16:34802354-34802376 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
1137481393 16:48854605-48854627 GGTGTGGTGGAGGCTGAGGCAGG + Intergenic
1137698436 16:50478506-50478528 GGTGGGGAAGGAGCGGGGGCCGG + Intergenic
1137864168 16:51876295-51876317 GGAAGGCAAGGGGCCGAGGCTGG - Intergenic
1138468173 16:57209608-57209630 CTTTGGGAGGAGGCCGAGGCAGG - Intronic
1138474784 16:57264243-57264265 GATGGGGAGTAGGCCGAGGAAGG - Intronic
1138583701 16:57957406-57957428 GCTGGTGAAGAGGCCGTGGCAGG - Intronic
1138659168 16:58507772-58507794 GGAGGGGCAGAGGCAGAGGTGGG - Intronic
1138840254 16:60493574-60493596 GCTTGGGAGGAGGCTGAGGCAGG - Intergenic
1139346547 16:66307528-66307550 GCAGGGGCAGAGGCAGAGGCAGG - Intergenic
1139508611 16:67413047-67413069 AGTGGCTAGGAGGCCGAGGCGGG - Intronic
1139698934 16:68695368-68695390 GGTGGCGAAGAGGACCAGGTGGG + Exonic
1140058567 16:71547260-71547282 GGTGGGAAAGAGACCCAGGAAGG - Intronic
1140343072 16:74184464-74184486 CCTGGGGAGGAGGCAGAGGCAGG + Intergenic
1140392856 16:74602976-74602998 GGTGATGAAGAGGCTGAGACAGG + Intronic
1140406402 16:74714136-74714158 GGTCGGGAAGGGGCCAGGGCCGG + Exonic
1140410222 16:74736705-74736727 GATGGGGAAGAGGATGTGGCTGG + Intronic
1140890336 16:79279485-79279507 CCTGGGGAAGAGGCTGAAGCGGG + Intergenic
1140893757 16:79307287-79307309 GGCAGGGAAGAAGCCCAGGCTGG - Intergenic
1141180958 16:81753129-81753151 GGTGTGGAAGGGTGCGAGGCCGG - Intronic
1141659641 16:85435139-85435161 GGTCAGGCAGAGGCCCAGGCAGG + Intergenic
1141820778 16:86444154-86444176 GGAGGAGGAGAGGGCGAGGCAGG - Intergenic
1142121391 16:88388247-88388269 GGTGGGCCAGAGCCAGAGGCAGG + Intergenic
1142261706 16:89045523-89045545 GGTGAGGAAGAGGACGTGCCAGG - Intergenic
1142411972 16:89921488-89921510 GGTGGGGAAGGGGTCGGGGGTGG + Intronic
1142450735 16:90171754-90171776 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1202991568 16_KI270728v1_random:17674-17696 GGTGGGGCTGAGGAGGAGGCGGG - Intergenic
1203057264 16_KI270728v1_random:936004-936026 GGTGGGGCTGAGGAGGAGGCGGG + Intergenic
1203070948 16_KI270728v1_random:1073913-1073935 GGGGGGCAAAAAGCCGAGGCGGG + Intergenic
1203070951 16_KI270728v1_random:1073930-1073952 GGCGGGCAAAAAGCCGAGGCAGG + Intergenic
1142456830 17:61937-61959 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
1142474328 17:180624-180646 GCTGGGGAGGGGCCCGAGGCTGG - Intronic
1142598649 17:1041925-1041947 GGGGGAGAGAAGGCCGAGGCAGG + Intronic
1142648032 17:1328055-1328077 GGAGGCCAAGAGGCCGAGGAGGG + Intergenic
1142670465 17:1485540-1485562 CAGGGGGAGGAGGCCGAGGCGGG - Intronic
1142805618 17:2369735-2369757 GGGTGGGAAGAGGCCCAGCCAGG - Intronic
1143102651 17:4512938-4512960 GGTAGGGAAGAGGCCCAAGCTGG + Intronic
1143105015 17:4525200-4525222 GGTCGGGGAGAAGCCGAGCCGGG - Intronic
1143310111 17:5980806-5980828 GGTAAGGAAGAGGCAGAGCCAGG - Intronic
1143375667 17:6465640-6465662 GGTGGGGCTGGGGCCGAGGCTGG - Intronic
1143510657 17:7393682-7393704 CGAGGGGAAGAGGGCGAAGCCGG + Exonic
1143521291 17:7445656-7445678 GCTGGGGACGAGGCAGGGGCTGG + Intronic
1143582639 17:7835673-7835695 GGAGGGGCAGCGGCGGAGGCTGG + Intergenic
1143768760 17:9154510-9154532 TTTGGGAAAGGGGCCGAGGCAGG - Intronic
1144058219 17:11559765-11559787 GGCGGGGAAGAGGCTGAGGTGGG - Exonic
1144197461 17:12908441-12908463 CATGAGGCAGAGGCCGAGGCGGG - Intronic
1144341817 17:14316323-14316345 GCTGAGGCTGAGGCCGAGGCCGG + Intronic
1144422301 17:15109783-15109805 GGTGGGGATTAGGCTGAGGGTGG - Intergenic
1144484959 17:15656670-15656692 GCTGGGGTAGAGGGGGAGGCTGG - Intronic
1144784417 17:17823801-17823823 GGTGGGGCGGGGGCCGGGGCCGG - Intronic
1144851677 17:18247110-18247132 GGTGGGGGGCAGGCCGAGGGCGG - Intronic
1145095677 17:20023585-20023607 AAGGGGGAAGAGGGCGAGGCAGG + Intronic
1145103920 17:20099020-20099042 AGTGGGGAAGTGGCAGAGCCAGG - Intronic
1145291743 17:21551738-21551760 GGAGGGGACGAGGCGGAGCCGGG + Intronic
1145405992 17:22594635-22594657 TTTGGGAAGGAGGCCGAGGCAGG + Intergenic
1145693182 17:26766080-26766102 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
1145693197 17:26766138-26766160 GGTGGGCAAAAAGCCGTGGCGGG - Intergenic
1145693252 17:26766315-26766337 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
1145693256 17:26766332-26766354 AGTGGGGAAAAAGCCGTGGCGGG - Intergenic
1145693298 17:26766483-26766505 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
1145868554 17:28256066-28256088 GATGTGGAAGAGGCAGAGGGAGG + Intergenic
1145868630 17:28256363-28256385 GGTGGGGAGGAGGGCCAGGGAGG - Intergenic
1145908034 17:28527003-28527025 GGCAGGGGAGAGGCTGAGGCTGG - Intronic
1146579132 17:34021401-34021423 GGTGGGCAAGAGTCCAAGGCAGG - Intronic
1147494819 17:40905547-40905569 AGTGGGAACGAGGCAGAGGCTGG + Intergenic
1147586269 17:41655448-41655470 GGTGGAGCAGAGGCTGAGGTTGG + Intergenic
1147723934 17:42554861-42554883 CCTGGGGCAGAGGACGAGGCCGG + Exonic
1147762960 17:42812607-42812629 GGAGGAGAGGAGGCTGAGGCAGG + Intronic
1148152237 17:45403719-45403741 GGTGGGGAAGTGGGGGTGGCAGG + Intronic
1148323162 17:46769635-46769657 GGTGGGGAGGAGGCCAAGCCTGG + Intronic
1148744324 17:49910108-49910130 CGTGGGGAGGAGGCCAGGGCGGG - Intergenic
1148787438 17:50152204-50152226 GGAGGGGAAGAGGGCGGGGGAGG - Intergenic
1149553723 17:57558497-57558519 GGTGGGGATGAGACCCTGGCTGG + Intronic
1149673249 17:58434438-58434460 ACTTGGGAAGAGGCTGAGGCAGG + Intronic
1149699274 17:58641749-58641771 CTTTGGGAGGAGGCCGAGGCAGG - Intronic
1150126553 17:62639230-62639252 GTTGGGGAGGGGGCTGAGGCAGG + Intronic
1150322134 17:64223919-64223941 GTTGGCCAGGAGGCCGAGGCAGG + Intronic
1151135224 17:71940170-71940192 GTTGGGCAGGAGGCTGAGGCAGG + Intergenic
1151392759 17:73798704-73798726 GGGGGGGGGGGGGCCGAGGCAGG + Intergenic
1151393601 17:73804300-73804322 GGTGGGGGAGGGGAGGAGGCAGG + Intergenic
1151498389 17:74473427-74473449 GGTGTGGAGGAGGCAGCGGCAGG - Intronic
1151511126 17:74560875-74560897 GGCGGGGGAGAGGCAGAGCCTGG - Intergenic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152395557 17:80030757-80030779 GCAGGGGCAGAGGCAGAGGCAGG + Intronic
1152409855 17:80117821-80117843 GGTGGGGGAGAGGCCCAGGTGGG + Intergenic
1152599018 17:81252254-81252276 GGAGGGGAAAAGGCCAAGGGGGG - Exonic
1152599071 17:81252450-81252472 GGTTGGGAAGAGGCCTGGACAGG - Exonic
1153472481 18:5462619-5462641 TGTGGGGAAGAACCCGAGGGTGG + Intronic
1154106816 18:11530834-11530856 GGTGGGGAGGAGGCAACGGCAGG + Intergenic
1154107970 18:11540569-11540591 CTTTGGGATGAGGCCGAGGCAGG + Intergenic
1155445255 18:25904805-25904827 GGTGGAGAAGAGACAGAGACAGG - Intergenic
1155603901 18:27581682-27581704 GGTGGCCAAGAGGCCAAGGCGGG - Intergenic
1156282717 18:35656782-35656804 GGACTGGAAGAGGACGAGGCAGG + Intronic
1157233410 18:45940444-45940466 GGTGGGGAAAGGGCAGAAGCGGG + Intronic
1157553098 18:48594807-48594829 GGTGAGGAGGAGGCCCAAGCGGG - Intronic
1157593817 18:48851761-48851783 GGTGGGGAAGAGGCAGAACCCGG - Intronic
1157763453 18:50281436-50281458 GAAGGGGAGGAGGGCGAGGCGGG - Exonic
1158391439 18:57048644-57048666 GGAGGGGAGGAAGCCGAGGACGG + Intergenic
1158543079 18:58374461-58374483 GGTGGGGAGGAGGCCGGGAAAGG - Intronic
1158620318 18:59027227-59027249 ACTTGGGAGGAGGCCGAGGCAGG - Intergenic
1159241677 18:65750727-65750749 GGAGGGGAAGAGGGCGACGATGG - Intronic
1160026039 18:75217062-75217084 GGTGGTGGAGAGGCCTGGGCAGG + Intronic
1160152392 18:76405342-76405364 TGTGGGGTGGAGGCTGAGGCGGG - Intronic
1160227777 18:77024694-77024716 GGTGGGGCTGAGGCCAGGGCCGG + Intronic
1160319780 18:77879701-77879723 AGTGGAGTGGAGGCCGAGGCTGG + Intergenic
1160453163 18:78979230-78979252 GGCGGCGCAGAGGCCCAGGCGGG + Intergenic
1160592733 18:79952868-79952890 CGTGGAGAAGAGGCCGCGGCTGG - Intergenic
1160604141 18:80036479-80036501 TGTGGGGAAGAGGCTGAAGATGG - Intronic
1160646747 19:197296-197318 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
1160703098 19:517716-517738 TGGGAGGAGGAGGCCGAGGCTGG + Intronic
1160703131 19:517799-517821 TGGGAGGAGGAGGCCGAGGCTGG + Intronic
1160703188 19:517941-517963 GGTTGGGAGGAGGCCCAGGCTGG + Intronic
1160703205 19:517990-518012 GGTTGGGAGGAGGCCGAGGCTGG + Intronic
1160703413 19:518505-518527 GGGGGAGGAGAGGCCCAGGCTGG + Intronic
1160753825 19:747643-747665 GATGGAGAAGAGGCCGGGGGCGG - Exonic
1160779072 19:869872-869894 GGTCAGGAAGTGGCCGAGTCAGG - Intronic
1160864419 19:1250679-1250701 GCGGGGGAGGGGGCCGAGGCAGG - Intronic
1160866515 19:1258581-1258603 GGTGGGGGACAGGCAGAGCCAGG - Exonic
1160931130 19:1569893-1569915 GGTGGGGAAGGGCTCCAGGCAGG - Intergenic
1161006866 19:1941434-1941456 GGGGGCGAAGGGGCCGGGGCGGG - Intronic
1161083709 19:2324099-2324121 AGTGGGGTGGCGGCCGAGGCAGG - Intronic
1161352840 19:3803448-3803470 AGTGGGGAGGAGGCAGATGCAGG - Intergenic
1161433233 19:4246513-4246535 GGTGGGGAGGAGGCTGGGGAAGG + Intergenic
1161453386 19:4358849-4358871 GCTGGGGATGAGGCCGAACCAGG + Intronic
1161714593 19:5868152-5868174 CCTGGGGGAGAGGCTGAGGCTGG + Intronic
1161716727 19:5880513-5880535 GGTGGGGAAGGGGCAGGGGGAGG - Intronic
1161898446 19:7099709-7099731 AGTGGGGAAGGGGCCGTGGATGG + Intergenic
1162087598 19:8257961-8257983 GGTGGGAAAGAGGACCAGTCGGG - Exonic
1162486009 19:10961006-10961028 GGGGGGGCGGTGGCCGAGGCGGG + Exonic
1162967219 19:14161608-14161630 GGTGGGGAAGTGGCTGGGCCTGG + Exonic
1163436927 19:17301444-17301466 GGTGGGGCAGCGGCTGGGGCGGG + Exonic
1163463996 19:17455660-17455682 GGTGGGGAGGAGGGCGGGGCCGG - Exonic
1163489062 19:17606405-17606427 GGTGGGGACGGGGCCGTGGGCGG - Intronic
1163547236 19:17947809-17947831 GGTGGGGGCGGGGCCGGGGCCGG - Intergenic
1163636197 19:18438179-18438201 GGCGGGGAAGGGGGCGGGGCGGG - Exonic
1164578594 19:29420601-29420623 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578605 19:29420650-29420672 GGTGGAGACGAGGCCGGGGGAGG - Intergenic
1164578623 19:29420748-29420770 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578634 19:29420797-29420819 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578655 19:29420883-29420905 GGTGGAGATGAGGCCGGGGGAGG - Intergenic
1164578665 19:29420932-29420954 GGTGGAGAGGAGGCCGGGGAAGG - Intergenic
1164578675 19:29420981-29421003 GGTGGAGACGAGGCCGGGGGAGG - Intergenic
1164578685 19:29421030-29421052 GGTGGAGACGAGGCCGGGGGAGG - Intergenic
1164860888 19:31561315-31561337 GGTGGGGAAAAGACCGAGGGTGG - Intergenic
1165016896 19:32887957-32887979 GGTGGGGAAGGGGTTGAGGCAGG - Intronic
1165420849 19:35721226-35721248 GGTGGGGAGGGGGCCGGGGGAGG - Exonic
1165433338 19:35784448-35784470 GGGGAGGGAGAGGCCGGGGCGGG - Intronic
1165495731 19:36151235-36151257 GGTGGGGCTGAGGCCCAGGGAGG - Intronic
1165651571 19:37495510-37495532 CTTTGGGAGGAGGCCGAGGCAGG - Intergenic
1165792906 19:38502749-38502771 GGTGGGGCAGGGGCAGGGGCAGG + Intronic
1165800101 19:38544048-38544070 GGAGGGGCAGAGGAGGAGGCGGG - Intronic
1165815068 19:38636977-38636999 GGTGGGCAAGGGGCAGAGGCAGG - Intergenic
1166046383 19:40233196-40233218 GGTGGGGAGGAGGCCGGACCAGG + Exonic
1166067648 19:40369580-40369602 GGTGGGGGCGAGGCTCAGGCAGG - Intronic
1166222560 19:41375135-41375157 GGTGAGGAGGAAGCAGAGGCAGG - Intronic
1166312181 19:41969211-41969233 GGTGGGGAAGAAGGCCTGGCAGG + Intronic
1166643311 19:44512802-44512824 GCTGGGGAAGAGGCTGGTGCTGG - Intronic
1166759623 19:45216330-45216352 CTTTGGGAGGAGGCCGAGGCGGG + Intronic
1166762717 19:45234860-45234882 GGGGGGGAGGAGGGCGATGCCGG + Intronic
1166872178 19:45877326-45877348 GTTGGAGCAGAGGCCGGGGCAGG + Intergenic
1166984271 19:46650080-46650102 GGAGAGGCAGAGGCAGAGGCAGG - Intronic
1166996761 19:46723121-46723143 TGTGGGGAAGGTGCAGAGGCAGG + Exonic
1167112846 19:47472013-47472035 GAGGGGGAGGAGGCGGAGGCGGG + Exonic
1167158310 19:47752488-47752510 TGTGGAGAAAAGGCCGAGGCAGG - Intronic
1167202348 19:48074691-48074713 GGTGGGGAAGAGCAAGAGGGGGG + Intronic
1167381423 19:49140458-49140480 GCTGCTCAAGAGGCCGAGGCAGG - Intronic
1167434985 19:49474242-49474264 GGTGTGGAAGGGGCCAAGCCGGG - Intronic
1167458435 19:49611216-49611238 GGTGGGTAGGTGGCTGAGGCAGG + Intronic
1167473171 19:49686561-49686583 GGGGGGCAGCAGGCCGAGGCCGG + Intronic
1167487774 19:49773154-49773176 GGAGGGGGAGAGGTTGAGGCTGG + Intronic
1167616253 19:50535850-50535872 GGTGGGGAAGGGTGGGAGGCGGG - Intronic
1168078118 19:53991605-53991627 GGTGGGGACGAGGCCGGGCGCGG + Intergenic
1168137078 19:54359234-54359256 GGTGGGGAAGGGGCCGCGAATGG + Intronic
1168161003 19:54509895-54509917 GGTGGGGAAGGGGCCGCGAATGG - Intronic
1168242530 19:55094642-55094664 GGAGGTGAAGAGGCCAGGGCAGG - Exonic
1168346582 19:55652900-55652922 GTTCGGGAAGGGGCCGCGGCCGG - Exonic
1168462045 19:56567536-56567558 GGCGGGGCAGCGGCCGAGGCTGG + Exonic
1168529245 19:57114066-57114088 GGTGGGGAGGAGGAGGAAGCGGG - Intergenic
1202680391 1_KI270712v1_random:3454-3476 GGCGGGCAAGAAGCCGAGGCGGG + Intergenic
1202680469 1_KI270712v1_random:3743-3765 GGCGGGCAAGAAGCCGAGGCGGG + Intergenic
1202680482 1_KI270712v1_random:3784-3806 GGCGGGCAACAAGCCGAGGCGGG + Intergenic
1202680688 1_KI270712v1_random:4520-4542 GGCGGGCAAGAAGCCGAGGCGGG + Intergenic
1202680701 1_KI270712v1_random:4561-4583 GGCGGGCAACAAGCCGAGGCGGG + Intergenic
1202680871 1_KI270712v1_random:5199-5221 GGCGGGCAAGAAGCCGAGGCGGG + Intergenic
1202680911 1_KI270712v1_random:5333-5355 TGTGGGCAAAAAGCCGAGGCGGG + Intergenic
1202680957 1_KI270712v1_random:5488-5510 GGCGGGCAAAAAGCCGAGGCAGG + Intergenic
1202681014 1_KI270712v1_random:5685-5707 GGCGGGCAACAAGCCGAGGCGGG + Intergenic
1202681047 1_KI270712v1_random:5795-5817 GGCGGGCAAAAAGCCGAGGCGGG + Intergenic
1202681130 1_KI270712v1_random:6100-6122 GGCGGGCAAGAAGCCGAGGCGGG + Intergenic
1202681162 1_KI270712v1_random:6228-6250 GGCGGGCAAAAAGCCGAGGCAGG + Intergenic
1202681341 1_KI270712v1_random:6833-6855 GGCGGGCAAAAAGCCGAGGCGGG + Intergenic
1202683127 1_KI270712v1_random:28823-28845 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
1202683159 1_KI270712v1_random:28934-28956 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
1202683254 1_KI270712v1_random:29263-29285 GGTGGGCAAAAAGCCGGGGCGGG - Intergenic
1202683937 1_KI270712v1_random:31643-31665 GGGGGGCAAAAAGCCGAGGCGGG - Intergenic
925091186 2:1157131-1157153 GGTGAGGAAGGGGCCGAGTCAGG - Intronic
925160335 2:1678832-1678854 GGTGGGGAAGCAGCGCAGGCAGG + Intronic
925178592 2:1801968-1801990 GGTGGGGAAGGGGCGGTGGTAGG - Intronic
925265712 2:2565012-2565034 GGTGGGGAACATTCCCAGGCAGG - Intergenic
925380676 2:3423492-3423514 GGTGGGGAGGAGGGCCGGGCAGG - Intronic
925534919 2:4906181-4906203 GGTGGTGCAGAGGCTGAGGCAGG - Intergenic
925593736 2:5535097-5535119 GGTGGGGAGGAGGGAGAGGATGG + Intergenic
925740626 2:7002781-7002803 GGTGTGGAACAGCCTGAGGCAGG + Intronic
926063002 2:9815826-9815848 GCTGTGGAAGAGGCTCAGGCAGG + Intergenic
926154751 2:10447823-10447845 GTTGGGAAAGAGGCCGGCGCGGG + Intronic
926341248 2:11906473-11906495 GGTGGTGAGGAGGCCAGGGCAGG + Intergenic
926401150 2:12498494-12498516 GGTAGGGAAAAGGCACAGGCTGG - Intergenic
926738713 2:16093805-16093827 GGTGGGGCAGAGGGTGAGGCTGG + Intergenic
927184897 2:20475053-20475075 TCTGGGCAAGAGGCTGAGGCTGG + Intergenic
927496670 2:23555798-23555820 GGTGGGGCAGAGGCCAGCGCTGG - Intronic
927646351 2:24879339-24879361 GGTGGGCAGGAGGCTGAGGCAGG + Intronic
927846800 2:26476370-26476392 GGTGGGGAAGGGGCAGGGGCCGG + Intronic
927912530 2:26911633-26911655 GGTGGAGAAGAGGGGTAGGCTGG + Intronic
927929125 2:27032980-27033002 GCCGGGGAAGTGGCCGAGGAGGG + Exonic
927973400 2:27320123-27320145 GCTGCTGAAGAGGCTGAGGCAGG + Intronic
928097482 2:28413428-28413450 GGTGGGGGAAAGGCGGAGCCCGG - Exonic
928511745 2:32010005-32010027 GGTGGGGGAGGCGGCGAGGCCGG + Intronic
928511761 2:32010069-32010091 GGCGGGGAAGAGGGCGCGGACGG - Intronic
928518322 2:32064126-32064148 GCCGGGGCCGAGGCCGAGGCAGG - Exonic
929057823 2:37893668-37893690 GGTGGGTAGGAGGAAGAGGCAGG + Intergenic
929560996 2:42956393-42956415 GGTGGGGAAGTGGAAGGGGCGGG - Intergenic
929830905 2:45345521-45345543 GGTGGGGATGGGGTGGAGGCTGG + Intergenic
929967297 2:46544618-46544640 GTTTGGGAAGAGGCTGAAGCTGG - Intronic
931851725 2:66258148-66258170 GCTAGGGAAGAGGCCCATGCAGG + Intergenic
931923524 2:67046138-67046160 GGTGGGGATGAGGAGGATGCTGG - Intergenic
931978251 2:67666697-67666719 GAAGGGGAAGGGGCCAAGGCAGG + Intergenic
932036707 2:68252819-68252841 GGCGGGGAAGAAGGCAAGGCTGG + Intronic
932162359 2:69473206-69473228 GGGGGAGAAGAGGCCTGGGCAGG - Exonic
932468848 2:71940708-71940730 GCTTGGGAAGAGGCAGAGGGAGG + Intergenic
932792034 2:74662215-74662237 GGTGGGGAATAGGAGGAGGATGG + Intronic
932812418 2:74835606-74835628 GGTGGGGATGGGGCCGGGGCCGG + Intronic
932858059 2:75259665-75259687 TGTGTGGAAGAGGGAGAGGCAGG - Intergenic
933543775 2:83682887-83682909 GGTAGTGAAGTGGCCGAGGGTGG + Intergenic
933772890 2:85755012-85755034 GGTGGGCGAGTGGCCGGGGCGGG + Intronic
933912921 2:86960021-86960043 GGTGGGGAACAACCTGAGGCAGG - Intronic
933987588 2:87604697-87604719 GATGGGGAAGAGGGGGAGGTGGG - Intergenic
934010074 2:87809869-87809891 GGTGGGGAACAACCTGAGGCAGG + Intronic
934248640 2:90326242-90326264 GGCGGGCAAAAAGCCGAGGCGGG + Intergenic
934248678 2:90326371-90326393 GGCGGGCAAAAAGCCGAGGCGGG + Intergenic
934260930 2:91477214-91477236 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
934261019 2:91477528-91477550 GGTGGGCAAAAAGCCGGGGCGGG - Intergenic
934307525 2:91839846-91839868 GGAGGGCAAAAAGCCGAGGCGGG - Intergenic
934573871 2:95388511-95388533 GGTGGGAAAGGGGCAAAGGCAGG + Intergenic
934869354 2:97847075-97847097 GGGGGGGGGGGGGCCGAGGCAGG + Intronic
934993494 2:98937038-98937060 GCCGGGGAAGAGGCCGGGACGGG - Intergenic
935139262 2:100337693-100337715 GGTAGGAGGGAGGCCGAGGCAGG - Intergenic
935326810 2:101945105-101945127 GGTGGGGAAGAGGCCCAGCTAGG - Intergenic
935773644 2:106450577-106450599 GGTGGGGAACAACCTGAGGCAGG + Intronic
935906420 2:107845363-107845385 GGTGGGGAACAACCTGAGGCAGG - Intronic
936128204 2:109810472-109810494 GGTGGGGAACAACCTGAGGCAGG - Intronic
936155840 2:110047051-110047073 GGTGCAGAGGAGGACGAGGCAGG - Intergenic
936188848 2:110324377-110324399 GGTGCAGAGGAGGACGAGGCAGG + Intergenic
936216493 2:110561013-110561035 GGTGGGGAACAACCTGAGGCAGG + Intronic
936273223 2:111068325-111068347 GGTGGGGCTGAGGCTGGGGCCGG + Intronic
936306252 2:111346111-111346133 GATGGGGAAGAGGGGGAGGTGGG + Intergenic
936425634 2:112415584-112415606 GGTGGGGAACAACCTGAGGCAGG + Intronic
936600448 2:113890038-113890060 GAGGGGGAGGAGGCCGCGGCGGG + Exonic
936847484 2:116854311-116854333 GGTGGGGCACAGGCAGGGGCGGG - Intergenic
937200606 2:120201951-120201973 TGTTGGGGAGAGGCTGAGGCAGG + Intergenic
937357769 2:121209057-121209079 TGTGGGGAAGATGCCCATGCAGG + Intergenic
937951073 2:127388176-127388198 GGCGGGGGCGGGGCCGAGGCCGG - Intronic
937991238 2:127663650-127663672 CCTGGGGAGGAGGCCAAGGCTGG - Intronic
937992240 2:127671088-127671110 GGTGGGAAAGGGGCCAAGGGAGG - Intronic
938000049 2:127726391-127726413 GGTGGGGAGGAGGATGAGGAGGG - Intronic
938144584 2:128822805-128822827 GGAGGGGAAGAGCTTGAGGCAGG + Intergenic
938187692 2:129246698-129246720 GGTGGGGAGGAGGGTGAGGTGGG - Intergenic
938668470 2:133564169-133564191 GGTGGATAAGAGGCAGAGGCAGG - Intronic
938968537 2:136409542-136409564 CTTTGGGAAGAGGCCAAGGCGGG - Intergenic
939032609 2:137094460-137094482 ACTTGGGAAGAGGCTGAGGCAGG + Intronic
939613078 2:144332751-144332773 GGTGGGGAGCAGTGCGAGGCCGG - Intergenic
939924774 2:148159425-148159447 GCTGGGCATGAGGCTGAGGCTGG - Intronic
940877349 2:158911220-158911242 GCTGCGTAAGAGGCTGAGGCAGG - Intergenic
941276024 2:163491683-163491705 GGTCAGGAAGAGGCAGAGTCAGG - Intergenic
941775625 2:169390026-169390048 GCTGGGCAGGAGGCTGAGGCAGG + Intergenic
942319161 2:174721173-174721195 GGTGTGGGAGAGGGCCAGGCAGG - Intergenic
942652607 2:178184182-178184204 GGGAGGGAAGAGGCACAGGCTGG + Intergenic
942832727 2:180255841-180255863 TGTGGGGAAGAGTCCTAGGAAGG + Intergenic
944106282 2:196082930-196082952 GCTGGGTAACAGGCAGAGGCTGG + Intergenic
944221434 2:197308488-197308510 GGTGGGGAAGTGGCCTGGGTGGG - Intronic
944714222 2:202362631-202362653 CTTTGGGAGGAGGCCGAGGCAGG - Intergenic
945073538 2:206014768-206014790 GCTGGGTAACAGGCAGAGGCTGG + Intronic
946180653 2:217947099-217947121 GGTGGGGAGGAGGCTGGGGATGG - Intronic
946306848 2:218860887-218860909 GGTGGGGGTGGGGCCGGGGCGGG + Intronic
946410194 2:219511767-219511789 GGTGGGGAAGAAGCTGGGCCGGG + Intergenic
946481279 2:220059210-220059232 GGTGCTGAGGAGGCTGAGGCAGG - Intergenic
947591773 2:231389976-231389998 GGTGGGGAGGAGCCGCAGGCTGG - Intergenic
947600035 2:231441514-231441536 CTTGGGGAGGAGGCCGAGGCAGG - Intergenic
947666764 2:231910893-231910915 GGAGGGGCAGAGGCGGAGGGTGG - Intergenic
947741543 2:232487108-232487130 GTGGGGGAAGAAGCGGAGGCTGG + Intronic
947748100 2:232519842-232519864 GGGTGGGAAGGGGCAGAGGCAGG - Intergenic
947903899 2:233745719-233745741 GGAGGGTAAGAGGCAGAGGGAGG + Intronic
947963510 2:234259808-234259830 GGTGAGGCTGAGGCTGAGGCTGG - Intergenic
947963520 2:234259849-234259871 GGTGAGGGTGAGGCTGAGGCTGG - Intergenic
948079185 2:235191590-235191612 GGTGGGGAGGAGGCAGAGGCTGG - Intergenic
948136267 2:235638736-235638758 AGTGGAGAACAGGCTGAGGCCGG + Intronic
948454740 2:238099745-238099767 GTTGGAGAGGGGGCCGAGGCAGG + Intergenic
948587202 2:239026891-239026913 GGCGGGGAAGACGCCCTGGCGGG - Intergenic
948696944 2:239737453-239737475 GCTGGGGATGGGGCCGGGGCTGG - Intergenic
948697073 2:239737736-239737758 GCTGGGGATGGGGCCGGGGCTGG - Intergenic
948697085 2:239737759-239737781 GCTGGGGATGGGGCCGGGGCTGG - Intergenic
948697097 2:239737782-239737804 GCTGGGGATGGGGCCGGGGCTGG - Intergenic
948697115 2:239737821-239737843 GCTGGGGATGGGGCCGGGGCTGG - Intergenic
948697133 2:239737860-239737882 GCTGGGGATGGGGCCGGGGCTGG - Intergenic
948697145 2:239737883-239737905 GCTGGGGATGGGGCCGGGGCTGG - Intergenic
948697197 2:239737990-239738012 GCTGGGGATGGGGCCGGGGCTGG - Intergenic
948697207 2:239738008-239738030 GCTGGGGATGGGGCCGGGGCTGG - Intergenic
948697229 2:239738049-239738071 GCTGGGGATGGGGCCGGGGCTGG - Intergenic
948697241 2:239738072-239738094 GCTGGGGATGGGGCCGGGGCTGG - Intergenic
948697326 2:239738229-239738251 GCTGGGGATGGGGCCGGGGCCGG - Intergenic
1168750250 20:276976-276998 GATGGGGAAGAGGGCGGGGTGGG + Intronic
1168808851 20:689448-689470 GCTGGGGATGAGGCCAGGGCAGG + Intergenic
1168949800 20:1789282-1789304 GGTGGGGAAGAGGCCAGGGAAGG + Intergenic
1169577095 20:6976026-6976048 GTTGGGGAAGATGCTGTGGCAGG + Intergenic
1169601166 20:7262608-7262630 ACTGGGGAGGAGGCTGAGGCAGG - Intergenic
1169910918 20:10646864-10646886 GGTGGGCCAGGGGCAGAGGCAGG + Intronic
1170201343 20:13747451-13747473 CGTGAGGCAGAGGCAGAGGCAGG + Intronic
1170511875 20:17085870-17085892 GGTGGGGCAGGGGCCAAGGAGGG + Intergenic
1170545795 20:17434813-17434835 GGTGGGAAATAGACAGAGGCTGG - Intronic
1170567811 20:17616614-17616636 GGTGGGGAAGCAGCGGAGGCTGG + Intronic
1171123643 20:22584625-22584647 GGTGGGGAGGAGGAGGAGGAAGG + Intronic
1171255919 20:23689012-23689034 GGAGGGTGAGAGCCCGAGGCAGG + Exonic
1171263267 20:23750909-23750931 GGAGGGTGAGAGCCCGAGGCAGG + Exonic
1171488582 20:25500930-25500952 GCTGGAGAAGAGGCGCAGGCTGG + Exonic
1172005956 20:31819320-31819342 GGGTGGGCAGAGGCGGAGGCAGG - Exonic
1172101639 20:32487358-32487380 GGTGGGGGAGAGGCAGAGGATGG + Intronic
1172125083 20:32621036-32621058 GGTGGGGATGAGGCTGGGGGTGG + Intergenic
1172125101 20:32621079-32621101 GGTGGGGAGGAGGCTGGGGTAGG + Intergenic
1172125119 20:32621118-32621140 GGTGGGGAGGAGGCTGGGGGTGG + Intergenic
1172125160 20:32621240-32621262 GGTGGGGAGGAGGCTGGGGTAGG + Intergenic
1172125174 20:32621274-32621296 GGTGGGGAGGAGGCTGGGGTGGG + Intergenic
1172537343 20:35684294-35684316 CTTGGGGAAGGGGCTGAGGCAGG + Intronic
1172878432 20:38180816-38180838 GGTGGGGCTGAGCCTGAGGCTGG + Intergenic
1172922850 20:38500965-38500987 GCTTAGGAAGAGGCCGAGGTTGG + Intronic
1173008221 20:39157383-39157405 GATGGGGAAGAGGAGCAGGCTGG - Intergenic
1173388722 20:42612096-42612118 GGTGGGGAAGGGGAAGAGTCAGG - Intronic
1173469822 20:43314408-43314430 GATGCAGAAGAGGCAGAGGCTGG + Intergenic
1173530568 20:43766473-43766495 GGAGGGGCAGAGGCTGAGGCTGG - Intergenic
1173974324 20:47175633-47175655 GGTGGGAAGGAGGCCAAGCCTGG + Intronic
1174061775 20:47838063-47838085 GATGGGGACTAGGGCGAGGCAGG + Intergenic
1174069734 20:47891161-47891183 GATGGGGACTAGGGCGAGGCAGG - Intergenic
1174147024 20:48459189-48459211 GGTGGGGACGGGTCCAAGGCAGG - Intergenic
1174156646 20:48519986-48520008 GATGGGGACTAGGGCGAGGCAGG + Intergenic
1174246938 20:49188417-49188439 GGTGGGGGTGGGGCCGGGGCCGG - Intergenic
1174339294 20:49886097-49886119 GGTGGGGAGGGGGACGGGGCAGG - Intronic
1174632224 20:51967848-51967870 GGAGGCCGAGAGGCCGAGGCGGG - Intergenic
1174752504 20:53125552-53125574 GGTGGGAAAGAGCCTGAGGTAGG - Intronic
1174838717 20:53881500-53881522 AGTGGGGAAGGGGCAGAGACAGG + Intergenic
1175282260 20:57811792-57811814 GGAGGGGAGGCAGCCGAGGCTGG + Intergenic
1175822395 20:61917432-61917454 GAAGGGGAAGTGGCAGAGGCCGG - Intronic
1175961235 20:62637506-62637528 GGTGGGGAAGGTGCCAAGGCAGG + Intergenic
1176120206 20:63450889-63450911 CTTCGGGAGGAGGCCGAGGCGGG + Intronic
1176623742 21:9074696-9074718 GGTGGAGGGGAGGCCGAGCCAGG - Intergenic
1177185239 21:17786415-17786437 GGTGGGGCAGAGACTGAGGTGGG - Intergenic
1177362208 21:20086767-20086789 GGAGTGGAGGAGACCGAGGCTGG + Intergenic
1178400846 21:32283457-32283479 GGTGGGGAAGGGGCTGTGGCTGG - Intergenic
1179333028 21:40423890-40423912 TGTGGGGAAGAGGGAGATGCTGG + Intronic
1179346695 21:40564942-40564964 GGAAGGGAAGAGGCCCAGGTGGG + Intronic
1179411746 21:41168053-41168075 GGAGGGGAGAAGGCGGAGGCCGG - Exonic
1179473637 21:41629293-41629315 GGTGGGGAAGGGCCCCAGGTGGG - Intergenic
1180005532 21:45018927-45018949 GGCGGGGAAGAGTCCAAGGGCGG - Intergenic
1180058843 21:45374535-45374557 GGTGGGGAGGAGGCAGGGGAGGG - Intergenic
1180120290 21:45741398-45741420 AGTGGGGAGGAGGGCGAGGTAGG + Intronic
1180491526 22:15853775-15853797 GGTGGGAAAGTGGGCGGGGCAGG + Intergenic
1180534627 22:16387041-16387063 GGCGGGCAAAAAGCCGAGGCGGG - Intergenic
1180635231 22:17258482-17258504 GGTGGGGCAGGGGCTGCGGCAGG - Intergenic
1180920679 22:19520017-19520039 GGTGGGGCGGAGGCAGAGGTGGG + Intronic
1181169183 22:20998677-20998699 GCTGGGGCAGAGGCTGAGCCGGG + Exonic
1181281036 22:21720734-21720756 GGTGGGTGGGAGGCCAAGGCGGG - Intronic
1181318701 22:21988368-21988390 GGTGTGGTGCAGGCCGAGGCAGG + Intergenic
1181512150 22:23393877-23393899 GGCGGGCAAGAGGCCGGGGAGGG + Intergenic
1181672458 22:24432110-24432132 GGTGGGGGAGAGGGCGTGGGAGG + Exonic
1182751321 22:32644357-32644379 GGTGGGGAAGAGGAAGAGGGAGG + Intronic
1183238880 22:36640891-36640913 GGTGGGGAAATGGAGGAGGCAGG - Intronic
1183343666 22:37295347-37295369 GGTGGGGGAGGGGAGGAGGCTGG - Intronic
1183436354 22:37797856-37797878 GGTGGGGGCGAGGGAGAGGCGGG - Intergenic
1183575872 22:38688719-38688741 GGTAGGGAAGATGCCCAGCCTGG - Intronic
1183591024 22:38779373-38779395 GGTGGGGAGCAGCCCTAGGCAGG - Exonic
1183665243 22:39242904-39242926 GGTGGGAAAGGGGGCGGGGCAGG - Intronic
1183674586 22:39292309-39292331 CGTGGGGATGTGGCAGAGGCCGG - Intergenic
1183829574 22:40410603-40410625 GGTGGGGCATAGGCCGTGGCAGG + Exonic
1183961316 22:41413533-41413555 AGTGGGGAAGAGCGCGCGGCCGG + Intergenic
1184106742 22:42371759-42371781 GGTGGGAATGAGGACCAGGCAGG - Intergenic
1184256250 22:43288729-43288751 GTTAGGGAAGAGGCAGAGCCAGG - Intronic
1184457333 22:44618590-44618612 GGAGGGGCAGAGGCAGGGGCAGG + Intergenic
1184545454 22:45164319-45164341 GGAGGAGAAGAGGCTGAGGGCGG + Intronic
1185056921 22:48586025-48586047 GCAGGGGCAGAGGCCGAAGCTGG - Intronic
1185253803 22:49820492-49820514 GGCTGGGAGGAGGCTGAGGCGGG + Intronic
1185348212 22:50319806-50319828 GGTGGGGCACAGGCCCTGGCAGG - Intronic
949322229 3:2824213-2824235 CTTTGGGAGGAGGCCGAGGCAGG + Intronic
949679425 3:6495588-6495610 AGTGGGGAAGAGGCCAAGTCAGG - Intergenic
949879716 3:8651833-8651855 GATGGTGAAGAGGCAGAGGAGGG - Intronic
950072621 3:10164851-10164873 GGCGGGGAAGTGGGCGGGGCGGG - Exonic
950386812 3:12666494-12666516 GCTAGGGAGGAGGCTGAGGCTGG + Intergenic
950404673 3:12797098-12797120 GAGGGAGGAGAGGCCGAGGCAGG - Intronic
950423182 3:12910582-12910604 GGTGGGGAGGCGGCCAGGGCAGG + Intronic
950460067 3:13115882-13115904 GGTGGGGAGCAGGTCCAGGCAGG - Intergenic
951393850 3:22140386-22140408 AATGGGGAACAGGCCGAGGTTGG + Intronic
952207175 3:31191711-31191733 GGTGGGGGAGAGCCAGAGGATGG - Intergenic
952278063 3:31896766-31896788 AGTAGGGAAGAGGCATAGGCAGG - Intronic
953045820 3:39293619-39293641 GGAGGGGAAGGGGTCAAGGCTGG - Intergenic
953974055 3:47369502-47369524 AGTGGGGAAGCGGCAGAGGTGGG - Intergenic
954303579 3:49714010-49714032 CGAGGGGAAGTGGCTGAGGCTGG + Intronic
954361329 3:50124311-50124333 GGTGGGGCCGGGGCCGGGGCCGG - Intergenic
954361332 3:50124317-50124339 GGTGGGGGTGGGGCCGGGGCCGG - Intergenic
954374144 3:50185366-50185388 GTGGGGGAAGGGGCTGAGGCTGG + Intronic
954388109 3:50254966-50254988 GTTGGGGAAAAGGGAGAGGCTGG + Intronic
954715764 3:52525979-52526001 GGAGGGGCAGAGGCCCAGGCAGG + Intronic
954762778 3:52889003-52889025 GGGGAGGAGGAGGCAGAGGCTGG - Intronic
955879790 3:63531094-63531116 TGTGGTGAAGAGGAGGAGGCAGG + Intronic
956105615 3:65815043-65815065 GGTGGGGAACTGTACGAGGCAGG - Intronic
956334454 3:68147418-68147440 GCTGGACAAGAGGCAGAGGCAGG - Intronic
956532012 3:70231293-70231315 GGTGTGGAAAAGGCAGGGGCAGG - Intergenic
956622302 3:71233672-71233694 GGGGGGTGCGAGGCCGAGGCAGG - Intronic
956885640 3:73556788-73556810 GGTGGGGAAGACCCTCAGGCTGG - Intronic
957653173 3:83035469-83035491 CATGGGGAGGAGGCCAAGGCAGG - Intergenic
958141758 3:89571156-89571178 GGTGGAGAAGAGACCCAGGGTGG + Intergenic
958980078 3:100709877-100709899 GGTGGGAGGGAGGACGAGGCCGG + Intronic
959575397 3:107927898-107927920 GGCGGGGAAGAGGACGCCGCCGG + Intergenic
960101620 3:113747846-113747868 GGTGTGCAGGAGGCCCAGGCTGG + Intronic
960864370 3:122184573-122184595 GGTGGGGGAGGGGCCGTGGCGGG + Intronic
960965252 3:123100045-123100067 GCTGGGGCAGGGGCCAAGGCTGG - Intronic
961353612 3:126319999-126320021 GGTGGGGAAGCTGGCCAGGCTGG + Intergenic
961673134 3:128549304-128549326 GGTGGGGGTGGGGCCGTGGCTGG + Intergenic
961724791 3:128920588-128920610 GTTGGGAAAAAGGCTGAGGCAGG + Intronic
961749238 3:129085864-129085886 GCTGGGGCAGAGGCCCAGGCAGG + Intergenic
961754841 3:129121641-129121663 GGCGGGGCCGAGGCCGAGGCAGG - Exonic
961756159 3:129128421-129128443 GCTGGGGCAGAGGCCCTGGCAGG - Intronic
961814891 3:129544377-129544399 AGTGGGGAGGAGGCTGGGGCTGG + Intronic
962140036 3:132780613-132780635 GGAGGGGAAGAGCAAGAGGCAGG - Intergenic
962201329 3:133403343-133403365 GGGGGGGAAGAGGCAGCTGCAGG - Intronic
962350395 3:134651756-134651778 GGAGGGGGAGAGGAGGAGGCTGG + Intronic
962808920 3:138945849-138945871 GGTGGGGGTGCGGCGGAGGCGGG + Exonic
963044887 3:141095107-141095129 GGTGGGGAAGAGGCCGAGGCAGG + Intronic
963308037 3:143675995-143676017 GATGGGGAGGAGGGCGAGGTGGG + Intronic
966020790 3:175206553-175206575 GGTGGGGAAGAGTGGGAGGGGGG + Intronic
967453210 3:189650815-189650837 GCTGGGTAACAGGCAGAGGCTGG + Intronic
968166554 3:196470528-196470550 GATGAGGATGAGGCTGAGGCTGG - Exonic
968370934 3:198222226-198222248 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
968434868 4:579237-579259 GGTGGGGAAGGGGCTCTGGCAGG + Intergenic
968493663 4:903706-903728 GGTGGGGGGGCGGCCGAGGAAGG + Intronic
968584210 4:1408482-1408504 GGCGGGGAAGAGGGAGATGCAGG - Intergenic
968872995 4:3250884-3250906 AGTGGGGAAGAGGCCCAGCAAGG + Intronic
968916108 4:3497699-3497721 GGTGGGGGAGGCGCCCAGGCAGG + Intronic
969112410 4:4852136-4852158 GGTGAGCAAGAGGCGGTGGCTGG + Intergenic
969197998 4:5578502-5578524 GCTGGGCAAGAGGCAGAGTCAGG + Intronic
969390790 4:6890086-6890108 GCTTGGGAAGAGGCAGCGGCAGG - Intergenic
969456717 4:7304439-7304461 GATGGAGAAGAGGCGGATGCGGG + Intronic
969598856 4:8163900-8163922 GGTGGGAAAGGGGCTCAGGCGGG - Intergenic
969714608 4:8862117-8862139 AGTGGAGAAGGGGCGGAGGCCGG + Intronic
969785552 4:9454452-9454474 AGTGGGGCCCAGGCCGAGGCAGG + Intergenic
969788333 4:9474918-9474940 GGGGGGCAAGAGGCGCAGGCTGG - Intergenic
969788964 4:9478858-9478880 TGTGGGGCCCAGGCCGAGGCCGG + Intergenic
969996977 4:11323376-11323398 GCTGGGTAAAAGGCAGAGGCTGG + Intergenic
970405095 4:15755248-15755270 GCTACTGAAGAGGCCGAGGCAGG - Intergenic
970472197 4:16389996-16390018 TGAGGGGAAGAGGACGAGGCAGG - Intergenic
971177287 4:24293054-24293076 GGTGGGGATGAGGGGGAGGGAGG - Intergenic
971199516 4:24499464-24499486 GGCTGGGAGGAGGGCGAGGCAGG - Intergenic
971279914 4:25234320-25234342 GCCGGGGAGGAGGGCGAGGCCGG + Exonic
971311267 4:25527676-25527698 GGTGCTCAAGAGGCTGAGGCAGG - Intergenic
971650083 4:29260030-29260052 GGTGGGGAAGGGGGTGAGGTGGG + Intergenic
971963135 4:33515629-33515651 GGTGGAGAAGAGGGAGAGGAGGG - Intergenic
971967893 4:33585745-33585767 GTTGGGGAAGAGAAGGAGGCAGG + Intergenic
971997552 4:33984863-33984885 TTTGGGAAGGAGGCCGAGGCAGG - Intergenic
972294993 4:37729084-37729106 GGTGGGGAAGGGGCAGAGGCGGG + Intergenic
972439208 4:39068986-39069008 GGTGGGCAAGTGGCCCAGGGCGG + Intronic
972449466 4:39182360-39182382 GGTGGGTGAGAGGCGGAGGGTGG - Intergenic
973315530 4:48756119-48756141 GGTGCTCAGGAGGCCGAGGCGGG + Intronic
973966873 4:56171931-56171953 GTTGGGGAAGAGGCTGGGGAAGG + Intronic
975583460 4:75927516-75927538 CTTTGGGAAGAAGCCGAGGCAGG + Intronic
975889211 4:79004985-79005007 GGTGGGGAAGAGGTGGAGTAGGG + Intergenic
977440951 4:97066686-97066708 GGTGGGGAATAGGCTGTGGAGGG + Intergenic
977810077 4:101347564-101347586 GAAGGGGAGGAGGCGGAGGCGGG - Intronic
978072731 4:104491911-104491933 GTTGGGGTGGGGGCCGAGGCGGG + Exonic
979259620 4:118634714-118634736 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
979328753 4:119405910-119405932 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
979670693 4:123357425-123357447 AGTGGGGAATAGGCTGGGGCTGG - Intergenic
980057359 4:128091091-128091113 GTCGAGGAAGAGGCCGAGGACGG + Exonic
980373352 4:131908926-131908948 AGTCGGGAGGAGGCTGAGGCAGG + Intergenic
980988359 4:139717492-139717514 GGTGGGTGAGAAGCCCAGGCAGG - Exonic
981393380 4:144217831-144217853 GCTGGGTAATAGGCAGAGGCTGG - Intergenic
982678119 4:158399533-158399555 GGTGAGGAAGAGCAGGAGGCAGG - Intronic
982832382 4:160079448-160079470 GGTAGGGAAGAGGGAGAGGTTGG - Intergenic
983638674 4:169924259-169924281 GCTGAGGATGAGGCTGAGGCAGG - Intergenic
985117403 4:186605444-186605466 AGTGGGGAAGAGGCAGAGTGGGG + Intronic
985239933 4:187919360-187919382 GGTGGAGAGGAGGAGGAGGCAGG + Intergenic
985621996 5:960686-960708 GGTGGGGAGGAGGCCTCTGCAGG - Intergenic
985878578 5:2619852-2619874 GGTGGGGGAGAAGCAGAGGGTGG - Intergenic
986175450 5:5348342-5348364 CATGGGAAAGAGGCCGAGCCCGG + Intergenic
986316683 5:6593701-6593723 TGTTGGGAAGAAGCCGAGGCAGG - Intergenic
986717338 5:10533713-10533735 GGAGGGGAAGAGACCGATCCCGG - Intergenic
986975306 5:13387185-13387207 AGTGGGTAACAGGCAGAGGCTGG + Intergenic
987120005 5:14758263-14758285 GCTGGGGAGGGGGCCGAGGAGGG + Intronic
987134099 5:14884910-14884932 GGTGGAGAAGAGGCTGGGGAAGG + Intergenic
987350716 5:17019479-17019501 GCTGTGCAAGAGGCTGAGGCAGG + Intergenic
987962835 5:24832423-24832445 GGTGGGGTAAAGGCTGAAGCAGG - Intergenic
989494734 5:42099763-42099785 GTTGGGAAAAAGGCTGAGGCAGG + Intergenic
990407810 5:55509260-55509282 GGTAGGGAAGGGGCAGAGCCTGG + Intronic
990450474 5:55928160-55928182 GGAGGGGAAGACGCCAGGGCAGG + Intergenic
990513733 5:56513216-56513238 GGTGGGGTGGATGACGAGGCTGG - Intronic
990578497 5:57146749-57146771 TGGGAGGCAGAGGCCGAGGCCGG - Intergenic
991002100 5:61792801-61792823 AGTGGGGAGGAGGCTGAGGTAGG - Intergenic
991650984 5:68853142-68853164 GATGTGGAAGAGGTGGAGGCAGG - Intergenic
992249776 5:74865899-74865921 GGTGGCGCCGAGGCGGAGGCCGG + Intronic
992528924 5:77637313-77637335 GGTGCGGAGGGGGCCGAGGACGG - Intronic
994086901 5:95768883-95768905 GGTGGGGGAGAGGCGGAGGGAGG + Intronic
995975845 5:118034058-118034080 GGGGGCGAGGAGGGCGAGGCGGG - Intergenic
996369348 5:122736690-122736712 GGTGCTGAAGAGGCCAGGGCAGG + Intergenic
997340569 5:133141319-133141341 GGTGGGGAGGAGGGGCAGGCAGG + Intergenic
997636132 5:135408522-135408544 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
997743087 5:136274973-136274995 GGTGGGGATGAGGCGTAGGAAGG + Intronic
997830526 5:137145941-137145963 GCTGGAGAAGAGGCTGAGCCTGG + Intronic
998147794 5:139740131-139740153 GGTGGGGAAGGAGCAGAGGGAGG + Intergenic
998152350 5:139764624-139764646 AGTGGGCAGGAGGCCGAGCCTGG + Intergenic
998170789 5:139870997-139871019 GGTGGAGGAGAGGCTCAGGCTGG - Intronic
999062761 5:148653987-148654009 GGTGGGGACGCGGCGGGGGCGGG - Intronic
999088038 5:148910809-148910831 GCTGGGCAGGAGGCCAAGGCAGG - Intergenic
999204459 5:149837966-149837988 GGTGGGGCAGGGGCAGGGGCAGG + Intronic
999240445 5:150124504-150124526 GGAGGGGAAGAGGCCAGGGTAGG + Intronic
999448307 5:151659128-151659150 GCTGGTGAAGCGGCTGAGGCGGG - Intergenic
999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG + Intronic
1001182210 5:169531003-169531025 GGTGTGGTGGAGGCTGAGGCAGG + Intergenic
1001993133 5:176133778-176133800 GGTGGGGACCGGGCAGAGGCAGG + Intergenic
1002394139 5:178940494-178940516 GGTGGGGACGAGGGAGAGGAAGG - Intergenic
1002558499 5:180063030-180063052 GGTGGGGAGGAGGAAGGGGCTGG + Intronic
1002719151 5:181247229-181247251 TTTGGGGAAGACCCCGAGGCTGG + Intronic
1002730172 5:181327782-181327804 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1002901302 6:1411660-1411682 GGTAGGGAAGATGCTGAGGTGGG + Intergenic
1002924634 6:1598200-1598222 GATGGGGGAGAGGCACAGGCAGG + Intergenic
1003170431 6:3717679-3717701 GGTGGGGAGGTGGCCAAGGGTGG - Intergenic
1003175625 6:3751022-3751044 GGCGGGAAAGGGGCCGAGGCCGG - Intronic
1003395145 6:5746641-5746663 GGTGGAGAATAGGCAGAGGTGGG + Intronic
1003459225 6:6314566-6314588 AGTGGGGAAGAGGATGAGGAGGG - Intronic
1004265229 6:14143685-14143707 GGAGGGGCAGAAGGCGAGGCTGG + Intergenic
1004578723 6:16926248-16926270 AGAGGGTAGGAGGCCGAGGCAGG + Intergenic
1005388980 6:25314205-25314227 GCTGGGATGGAGGCCGAGGCGGG - Intronic
1005736436 6:28751979-28752001 GGTGGGGAAAGGGAAGAGGCAGG + Intergenic
1005762212 6:28977649-28977671 GGGGGGGACCAGGCCCAGGCCGG + Intergenic
1005825856 6:29631636-29631658 GGTGGGAAAGAGGAAAAGGCAGG + Intronic
1005832402 6:29681167-29681189 GGAGCGGAAGAGGGCGGGGCCGG - Intergenic
1005953296 6:30647093-30647115 GGGGGGGAAGGGGCTGAGGGAGG - Exonic
1006375692 6:33670600-33670622 GGCGGGGCAGGGGCAGAGGCTGG + Intronic
1006424264 6:33954475-33954497 TGTGGGGCAAAGGCGGAGGCAGG - Intergenic
1006467741 6:34206210-34206232 GGTGGGGAACAACCTGAGGCAGG - Intergenic
1007339750 6:41183267-41183289 GATGGGAAAGAGGCCAGGGCTGG + Intergenic
1007367738 6:41406722-41406744 GGTGGGGAAGAGGGCGGAGAAGG + Intergenic
1007772513 6:44202799-44202821 GGTGGGGGAGGGGCAGTGGCTGG - Intergenic
1007773134 6:44207268-44207290 GGTGGGTGTGAGGCTGAGGCAGG - Intergenic
1007816240 6:44527577-44527599 GGAGAGGCAGAGGCCGTGGCAGG + Intergenic
1008616771 6:53234022-53234044 GGTGGGGCAGTGGCTGAGGCTGG + Intergenic
1008664008 6:53697904-53697926 GGAGAGGAAGAGGCAGAGACAGG + Intergenic
1009194185 6:60664805-60664827 CCTGGGGAAGAGGCAGAGGAAGG + Intergenic
1009527540 6:64765427-64765449 ACTGGGGAACAGGCAGAGGCTGG - Intronic
1009952544 6:70413674-70413696 GCGGGGGAAGAGGCCGAGCCGGG + Exonic
1009982517 6:70742606-70742628 ACTGGGGAACAGGCAGAGGCTGG - Intronic
1013204368 6:107933657-107933679 GCAGGGGCAGAGGCAGAGGCAGG - Intronic
1013968450 6:115985030-115985052 GGTGGGGAAGAGCCTGAGCATGG + Intronic
1015134554 6:129852852-129852874 GCTGGGGGAGAGGCTGAGACTGG - Intronic
1015309848 6:131754799-131754821 GGTGGGGACGGGGCGGAGGAAGG - Intergenic
1015536143 6:134269410-134269432 GGTGAGGTGGAGGCCGAGGCAGG + Intronic
1015890819 6:137968033-137968055 GGTGGGGGAGAAGCTGAGACTGG - Intergenic
1015997282 6:139007754-139007776 GGTGGGGAAGGGGAAGAGGTGGG + Intergenic
1016813546 6:148283243-148283265 GGTGGGGGAGAGGAGGAGGAAGG - Intronic
1017011368 6:150065938-150065960 GGTGGGGCAGAGGCTCAGACTGG - Exonic
1017373057 6:153735848-153735870 GGTGGGGCACAGGCTGAGGGTGG - Intergenic
1017441486 6:154468186-154468208 GCTTGGGAGGAGGCTGAGGCAGG - Intronic
1017879184 6:158547960-158547982 GGGGTGGAAGGGGCAGAGGCTGG - Intronic
1018728878 6:166634271-166634293 GGAGAGCAAGAGGCCGAGGTGGG + Intronic
1018893441 6:167997600-167997622 GGTGAGGAAGGGGCAGGGGCAGG - Intronic
1018986150 6:168638588-168638610 GCTGGGGAGGAGGAGGAGGCTGG + Intronic
1019059831 6:169249006-169249028 GTAGGGGAAGAGGGCGAGGTTGG + Intronic
1019519852 7:1455648-1455670 GGTGGGGCAGAGGCAGAACCAGG + Intronic
1019704344 7:2490360-2490382 GGGGGGCAGGAGGCTGAGGCTGG - Intergenic
1019748177 7:2712356-2712378 GGTGGGGACGTGGCCCAGCCAGG + Exonic
1019955303 7:4409698-4409720 CTTTGGGAGGAGGCCGAGGCAGG + Intergenic
1021510544 7:21428180-21428202 GGTGGGGGTGGGGGCGAGGCGGG - Exonic
1021545890 7:21812540-21812562 GGTGGCAAAGAGGCTGAGGAGGG + Intronic
1022111719 7:27236174-27236196 AGTGGGGAAGAGGCCAAGCCAGG - Intergenic
1022941848 7:35249352-35249374 GGTTGGGATGGGGCAGAGGCTGG - Intronic
1023130455 7:36997727-36997749 GGTGGGGAGGAGGCAGTGGTAGG + Intronic
1023966806 7:44967055-44967077 GGTGGGGAGGTGGGCGTGGCAGG + Intronic
1025232627 7:57212692-57212714 GATGGGGACTAGGGCGAGGCAGG - Intergenic
1025481683 7:60991909-60991931 GGCGGGGAAAAAGCCGCGGCCGG - Intergenic
1025561781 7:62379920-62379942 GGAGGGCAAAAAGCCGAGGCGGG - Intergenic
1025561803 7:62379987-62380009 GGCGGGCAAAAAGCCGAGGCAGG - Intergenic
1025926027 7:65961258-65961280 GGTGCTGGAGAGGCTGAGGCAGG - Intronic
1026458951 7:70596402-70596424 GGGGAGGCAGAGGCAGAGGCCGG + Intronic
1026516093 7:71073856-71073878 GTTGGGAAAGAAGCTGAGGCAGG + Intergenic
1026978154 7:74511322-74511344 GGTGGGGAAGAGGATGAGATTGG - Intronic
1027937732 7:84631533-84631555 AGTGGGTAACAGGCAGAGGCTGG + Intergenic
1028401306 7:90428615-90428637 GGTGGGGCAGAGGCGGGGGGTGG - Intronic
1029084339 7:97999357-97999379 ACTGGGGAGGAGGCTGAGGCAGG + Intergenic
1029096111 7:98086222-98086244 GGTGGTGGAGAGTCCCAGGCGGG + Intergenic
1029498836 7:100915026-100915048 GGAGGCCAAGAGGCCGAGACGGG - Intergenic
1029536364 7:101160112-101160134 AGTGGGGAAAAGGCAGAGGGAGG - Intronic
1029569525 7:101360447-101360469 GGAGAGGCAGAGGCAGAGGCAGG + Intergenic
1029673412 7:102049591-102049613 TGTGATGGAGAGGCCGAGGCAGG + Intronic
1030174972 7:106643074-106643096 CTTTGGGAGGAGGCCGAGGCGGG - Intergenic
1030470196 7:109953763-109953785 GGTGGGGCGGAGGCAGGGGCGGG - Intergenic
1031296441 7:120010027-120010049 GGTGGGTAAGCGGCCAAAGCAGG - Intergenic
1031317271 7:120273367-120273389 GGTGGGGCCGGGGCCGGGGCCGG - Intergenic
1031968386 7:128045252-128045274 GGTGGGGAGGAGGCACAGCCAGG - Intronic
1032320262 7:130880016-130880038 AGTGAGGCTGAGGCCGAGGCAGG + Intergenic
1032354085 7:131193618-131193640 GGAGGCTGAGAGGCCGAGGCGGG - Intronic
1032456302 7:132075746-132075768 GGTGGGGCAGTGGCGGGGGCAGG + Intergenic
1032863722 7:135905363-135905385 GGTGGCCAAGAGGCCAAGGAGGG - Intergenic
1033052877 7:138022199-138022221 GGTGGGGGTGGGGCCGGGGCGGG + Intronic
1033686283 7:143644088-143644110 GGAGTGGAAGAGGCAGATGCAGG - Intronic
1033689455 7:143723227-143723249 GGAGTGGAAGAGGCAGATGCAGG + Exonic
1033698330 7:143813533-143813555 GGAGTGGAAGAGGCAGATGCAGG + Intergenic
1034164708 7:149016628-149016650 TGTGTGGAGGAGGCTGAGGCAGG - Intronic
1034422225 7:150996035-150996057 GGTGGGGTAGGGGCAGAGGGAGG - Intronic
1034422251 7:150996101-150996123 GGTGGGGTAGGGGCAGAGGGAGG - Intronic
1034784564 7:153913819-153913841 GGGGGGGAAGAGGGCTTGGCTGG + Intronic
1035048447 7:155984230-155984252 CATGGGGTAGAGGCAGAGGCTGG - Intergenic
1035181728 7:157094190-157094212 GCTATGCAAGAGGCCGAGGCAGG + Intergenic
1035242826 7:157543355-157543377 GGTGGAGAAGTGGCTGAGGTGGG + Intronic
1035392940 7:158517476-158517498 GGTGGGGCTGAGGCAGAGTCAGG - Intronic
1035453889 7:158996849-158996871 GGACGGGAAGCGGCCGAGGATGG - Intergenic
1035595628 8:855067-855089 GGTGGGGAGGAGGCGGGAGCAGG + Intergenic
1036402172 8:8418661-8418683 GGTGGGTAGTAGGCTGAGGCAGG - Intergenic
1036753441 8:11457067-11457089 GTTGGGGAAGTGGGCGGGGCTGG + Intronic
1036753461 8:11457113-11457135 GTTGGGGAAGTGGGCGGGGCTGG + Intronic
1036787484 8:11697757-11697779 GTTGGAGAAGACGCCCAGGCAGG - Intronic
1037130122 8:15398482-15398504 GCTGCTGAAGAGGCTGAGGCAGG + Intergenic
1037637310 8:20711531-20711553 GGTGGGGCATGGGCCCAGGCAGG + Intergenic
1037663389 8:20945472-20945494 GGTAGGGAGGAAGCTGAGGCTGG - Intergenic
1037876103 8:22549342-22549364 GGTTAGGGAGAGGCTGAGGCTGG - Intronic
1038734368 8:30156088-30156110 GGAGGCCGAGAGGCCGAGGCAGG - Intronic
1038786383 8:30620815-30620837 GCTGCTGAAGAGGCTGAGGCAGG + Intronic
1039527776 8:38231778-38231800 GCTGGGGTAAAGGCCGCGGCCGG + Exonic
1039799101 8:40938859-40938881 GCAGAGGAAGAGGCAGAGGCAGG + Intergenic
1040063124 8:43121651-43121673 GGTGGGGAGGAAGAGGAGGCAGG - Intronic
1040419147 8:47222737-47222759 GGTGGTGAAGATGCTGAGGGTGG - Intergenic
1041377060 8:57215843-57215865 GGCTTGGAAGAGGCCCAGGCAGG + Intergenic
1041661488 8:60405711-60405733 GATGGGGAAGAGGCTGATGGGGG - Intergenic
1044679462 8:94762760-94762782 GGTGGGGTGGGGGCTGAGGCGGG + Intronic
1044752715 8:95431481-95431503 GGTGAGGAAGAGGCAGTGCCAGG + Intergenic
1045033334 8:98157990-98158012 GCGGGGGAAGAGCCCGTGGCTGG + Exonic
1045079139 8:98605164-98605186 AGTGGGTAACAGGCAGAGGCTGG - Intronic
1045251152 8:100484408-100484430 TGTGGAGCAGAGGCCCAGGCAGG + Intergenic
1045529515 8:102971281-102971303 CTTTGGAAAGAGGCCGAGGCAGG + Intronic
1045571086 8:103370484-103370506 GGTGGGGGTGGGGCGGAGGCAGG - Intergenic
1046352347 8:113032211-113032233 AGTGGGTAAAAGGCAGAGGCTGG + Intronic
1046583240 8:116119615-116119637 CTTGGGGAAGAGGCAGAGGATGG - Intergenic
1047259219 8:123241147-123241169 GGAGGGGCCGAGGCCGGGGCCGG + Intronic
1047367206 8:124222486-124222508 GGTGGTGAAGAGGCCCCGACGGG - Intergenic
1048210065 8:132447415-132447437 GGTGGGGAAGAGGTGGTGGAGGG + Intronic
1048285360 8:133137202-133137224 GGTGGGAGAGAGGCCTGGGCTGG - Intergenic
1048292596 8:133192013-133192035 GGTGAGGAAAAGGCAGAGGCAGG + Intronic
1048577981 8:135707819-135707841 GGAGGCCAAGAGGCCAAGGCAGG + Intergenic
1048922296 8:139242179-139242201 GAAGGGGAAGAGGCAGAGGAGGG + Intergenic
1048984643 8:139728695-139728717 GGTGGGGAAGGGCCTGGGGCTGG + Intergenic
1049025207 8:139983762-139983784 GGTGTGAGAGAGGCCGGGGCGGG - Intronic
1049214189 8:141400242-141400264 GGTGGGCAAGGTGCAGAGGCGGG - Intronic
1049363375 8:142224884-142224906 AGTGGGGCAGAGGGCGGGGCTGG + Intronic
1049426658 8:142540866-142540888 GGTGGAGGAGAGGACCAGGCCGG + Intronic
1049541867 8:143212344-143212366 GGTGGGGCAGCGGCAGGGGCTGG - Intergenic
1049558720 8:143296835-143296857 GGTGGGCGCGAGGCCGAGGCCGG + Exonic
1050305254 9:4299664-4299686 GGGGAGGAGGAGGCAGAGGCGGG + Exonic
1052014682 9:23451143-23451165 GGTGTCTAAGAGGCTGAGGCGGG + Intergenic
1053650859 9:40168158-40168180 GCTTGTGAAGAGGCAGAGGCTGG + Intergenic
1053767733 9:41425988-41426010 AGTCGGGAGGAGGCTGAGGCAGG - Intergenic
1054157510 9:61650979-61651001 GGTGGGGAGGGGGGCGGGGCGGG - Intergenic
1054319144 9:63635745-63635767 AGTCGGGAGGAGGCTGAGGCAGG + Intergenic
1054477284 9:65581984-65582006 GGTGGGGAGGGGGGCGGGGCGGG - Intergenic
1054533721 9:66208045-66208067 GCTTGTGAAGAGGCAGAGGCTGG - Intergenic
1054720074 9:68595237-68595259 GATGAGGAAGAGGTCTAGGCAGG - Intergenic
1054812612 9:69446872-69446894 GGTGGGGATGGGGCCTGGGCAGG - Intronic
1056102445 9:83312765-83312787 GCTGGGGAGGAGGGCGGGGCGGG - Intronic
1056179093 9:84064253-84064275 GGATGGGAAGAGGCAGGGGCAGG + Intergenic
1056575499 9:87853257-87853279 GGTGAGGAAGGGGCCGGGGATGG + Intergenic
1056580434 9:87885465-87885487 GGTCGGGAAGATGCCGTGGCTGG - Exonic
1057053810 9:91946450-91946472 GGTGTGGAAGAGGAGGAGGAGGG + Intronic
1057222288 9:93263791-93263813 GGTGGGGGTGGGGCCGTGGCGGG + Intronic
1057592406 9:96383700-96383722 GCCGGGGAAGAGGGCGCGGCAGG + Intronic
1057723778 9:97554194-97554216 GGTGGGGAAAGGCTCGAGGCAGG + Intronic
1058058775 9:100473996-100474018 GGTGGGGCCGGGGCCGGGGCCGG + Intronic
1058618506 9:106860806-106860828 GGTGGGGAGGAGCTCGGGGCAGG + Intergenic
1058851259 9:109013628-109013650 GGCGGGGCAGAGGCCGGGGGTGG - Intergenic
1058919013 9:109595485-109595507 GGCGTGGTGGAGGCCGAGGCAGG + Intergenic
1059318067 9:113444044-113444066 GGTAGGGATGAGGACAAGGCAGG + Intergenic
1059376731 9:113887721-113887743 GGTGGGTGAGCGGCCCAGGCGGG + Intronic
1059445833 9:114337235-114337257 GGTGGGGGAGAGGCTGTGGGCGG + Exonic
1060034996 9:120247593-120247615 AGTTGGGAGGAGGCTGAGGCTGG + Intergenic
1060768707 9:126314648-126314670 GGTGGGGCAGGGGCCCAGGAAGG - Intergenic
1060827172 9:126693889-126693911 GCTGGGGCAGAGGCTGGGGCTGG + Intronic
1061273338 9:129556392-129556414 CTTGGGCAAAAGGCCGAGGCGGG - Intergenic
1061388829 9:130306042-130306064 GGAGGGGAAGAGCCCGGGGCGGG + Intronic
1061415426 9:130444775-130444797 GGTGGGGACGAGGCCTGGGGAGG + Intergenic
1061513965 9:131077737-131077759 GGTGGGGCCCAGGCAGAGGCAGG + Intronic
1061702040 9:132423319-132423341 GATGAGGAAGAGGCTGAGCCTGG + Intronic
1061802801 9:133121289-133121311 GGAGGGGAAGAGGGTGGGGCCGG + Intronic
1061961527 9:133991517-133991539 GTCCGGGAAGAGGCGGAGGCCGG + Intronic
1062161072 9:135080245-135080267 GGAGGGGAAGAGGGCCTGGCAGG - Intronic
1062402792 9:136379766-136379788 GGCGGGGAAGAGGCCTAACCTGG - Intronic
1062402802 9:136379793-136379815 GGTGGGGAAGAGACCTAACCTGG - Intronic
1062440352 9:136566874-136566896 GGTGAGGAAAAGGCAGAGGCCGG + Intergenic
1062447775 9:136602812-136602834 GCTGGGGAAAAGGCCGGGTCGGG - Intergenic
1062458948 9:136654883-136654905 GCTGGGAGGGAGGCCGAGGCTGG + Intergenic
1062573718 9:137196986-137197008 AGTGGGGGAGAGGCTGAGCCTGG - Intronic
1062634019 9:137480573-137480595 GGAGGGGAAGGGGCAGCGGCTGG - Intronic
1062663277 9:137651539-137651561 TGTGGGAGGGAGGCCGAGGCAGG + Intronic
1062754583 9:138280296-138280318 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1203578489 Un_KI270745v1:24456-24478 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1203616807 Un_KI270749v1:73277-73299 CGTGGGGAACAAGCCGCGGCGGG - Intergenic
1203616843 Un_KI270749v1:73430-73452 GGGGGGCAAGAAGCCGCGGCGGG - Intergenic
1187080176 X:15977584-15977606 GGTGGGGAAGAGGAAGAGACAGG + Intergenic
1187274465 X:17805827-17805849 GGTGGGGACTAGGTGGAGGCAGG - Intronic
1188067779 X:25682563-25682585 GTTGGGGGAGAGGCTGAGGTGGG + Intergenic
1188162255 X:26818661-26818683 GGTGGGTAACAGGCAGAGGTTGG + Intergenic
1188601390 X:31970209-31970231 AGTGGGGAAGAAGCGGAGGGAGG + Intronic
1189260286 X:39673617-39673639 GGTGGGGACGAGGGCTGGGCTGG - Intergenic
1189400668 X:40665419-40665441 GCTGGGGAGGAGGTTGAGGCAGG + Intronic
1190050025 X:47142566-47142588 GATGGGTAAGAGGCAGAGGCAGG - Exonic
1190110271 X:47585022-47585044 GCTGGGAAAGAGGCGGGGGCAGG - Intronic
1190244783 X:48684001-48684023 GGTGGGGACGGGGCGGGGGCAGG - Intronic
1190311546 X:49120403-49120425 GGTGGGGAAGAGACCAAATCAGG + Intronic
1190712700 X:53081641-53081663 GTGGGGGAAGGGGCCGAAGCGGG + Intergenic
1192259198 X:69493977-69493999 CTTGGGGAAGAGGGTGAGGCTGG + Intergenic
1192528984 X:71870461-71870483 GCTGGGGGAGAGACGGAGGCCGG - Intergenic
1192631191 X:72779190-72779212 TGTGGGGCAGAGGCTGAGTCTGG - Intronic
1192650518 X:72941611-72941633 TGTGGGGCAGAGGCTGAGTCTGG + Intronic
1193703464 X:84791524-84791546 GGTGGGGAAGGGGCCTTTGCTGG - Intergenic
1194391269 X:93320870-93320892 GGTGGGGATGAGGTTGAGGTGGG - Intergenic
1194542481 X:95191117-95191139 ACTGGGTAAGAGGCAGAGGCTGG - Intergenic
1195349761 X:103985150-103985172 GGGGAGGAAGAGGAAGAGGCAGG - Intergenic
1195357682 X:104053689-104053711 GGGGAGGAAGAGGAAGAGGCAGG + Intergenic
1196010380 X:110880722-110880744 GCTGGGGAATAGGCTGATGCTGG - Intergenic
1196202169 X:112898623-112898645 GGAGGCCAAGAGGCCAAGGCAGG + Intergenic
1197980866 X:132217515-132217537 CGTGGGGAGGAGGGCGAGCCTGG + Exonic
1198077996 X:133212816-133212838 AGAGGGGAAGAGGGGGAGGCGGG + Intergenic
1199600779 X:149540117-149540139 GCTGGGGAGGGGGCCGAGGGCGG - Intergenic
1199920776 X:152400775-152400797 GATGGGGCAGAGGAAGAGGCAGG + Intronic
1201514136 Y:14799028-14799050 GGAGGGGAAGGGGCTGAAGCAGG + Intronic