ID: 963046508

View in Genome Browser
Species Human (GRCh38)
Location 3:141106477-141106499
Sequence CACACCCTAGGGTATCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963046500_963046508 6 Left 963046500 3:141106448-141106470 CCTTTCTCACCAGACCAGAGACC 0: 1
1: 0
2: 0
3: 17
4: 173
Right 963046508 3:141106477-141106499 CACACCCTAGGGTATCCATCAGG 0: 1
1: 0
2: 0
3: 8
4: 64
963046497_963046508 13 Left 963046497 3:141106441-141106463 CCCCATGCCTTTCTCACCAGACC 0: 1
1: 0
2: 0
3: 22
4: 273
Right 963046508 3:141106477-141106499 CACACCCTAGGGTATCCATCAGG 0: 1
1: 0
2: 0
3: 8
4: 64
963046502_963046508 -8 Left 963046502 3:141106462-141106484 CCAGAGACCCTCTACCACACCCT 0: 1
1: 0
2: 1
3: 20
4: 221
Right 963046508 3:141106477-141106499 CACACCCTAGGGTATCCATCAGG 0: 1
1: 0
2: 0
3: 8
4: 64
963046501_963046508 -3 Left 963046501 3:141106457-141106479 CCAGACCAGAGACCCTCTACCAC 0: 1
1: 0
2: 0
3: 9
4: 127
Right 963046508 3:141106477-141106499 CACACCCTAGGGTATCCATCAGG 0: 1
1: 0
2: 0
3: 8
4: 64
963046499_963046508 11 Left 963046499 3:141106443-141106465 CCATGCCTTTCTCACCAGACCAG 0: 1
1: 0
2: 1
3: 28
4: 295
Right 963046508 3:141106477-141106499 CACACCCTAGGGTATCCATCAGG 0: 1
1: 0
2: 0
3: 8
4: 64
963046498_963046508 12 Left 963046498 3:141106442-141106464 CCCATGCCTTTCTCACCAGACCA 0: 1
1: 0
2: 2
3: 18
4: 273
Right 963046508 3:141106477-141106499 CACACCCTAGGGTATCCATCAGG 0: 1
1: 0
2: 0
3: 8
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963046508 Original CRISPR CACACCCTAGGGTATCCATC AGG Intronic