ID: 963046901

View in Genome Browser
Species Human (GRCh38)
Location 3:141109366-141109388
Sequence CCTTTCCACTGTAAGATGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963046901_963046912 22 Left 963046901 3:141109366-141109388 CCCCTCATCTTACAGTGGAAAGG 0: 1
1: 1
2: 1
3: 11
4: 145
Right 963046912 3:141109411-141109433 TCCAGCTCACCTGCTGTTCAGGG 0: 1
1: 0
2: 1
3: 23
4: 182
963046901_963046911 21 Left 963046901 3:141109366-141109388 CCCCTCATCTTACAGTGGAAAGG 0: 1
1: 1
2: 1
3: 11
4: 145
Right 963046911 3:141109410-141109432 CTCCAGCTCACCTGCTGTTCAGG 0: 1
1: 0
2: 1
3: 22
4: 212
963046901_963046908 -7 Left 963046901 3:141109366-141109388 CCCCTCATCTTACAGTGGAAAGG 0: 1
1: 1
2: 1
3: 11
4: 145
Right 963046908 3:141109382-141109404 GGAAAGGCCCAGAGAAGGTGGGG 0: 1
1: 0
2: 7
3: 63
4: 479
963046901_963046907 -8 Left 963046901 3:141109366-141109388 CCCCTCATCTTACAGTGGAAAGG 0: 1
1: 1
2: 1
3: 11
4: 145
Right 963046907 3:141109381-141109403 TGGAAAGGCCCAGAGAAGGTGGG 0: 1
1: 0
2: 8
3: 36
4: 385
963046901_963046906 -9 Left 963046901 3:141109366-141109388 CCCCTCATCTTACAGTGGAAAGG 0: 1
1: 1
2: 1
3: 11
4: 145
Right 963046906 3:141109380-141109402 GTGGAAAGGCCCAGAGAAGGTGG 0: 1
1: 0
2: 3
3: 61
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963046901 Original CRISPR CCTTTCCACTGTAAGATGAG GGG (reversed) Intronic
903757751 1:25674576-25674598 CCTGGGCACTGAAAGATGAGTGG + Intronic
903951815 1:26999977-26999999 CCTTGCCACTGTAAAGTGAAAGG - Exonic
906799691 1:48725603-48725625 CCTCTTCCCTGAAAGATGAGTGG - Intronic
907279111 1:53333931-53333953 CCTTTCCTCTGCAAGATGAAGGG - Intergenic
907323415 1:53619764-53619786 CCATTCCACTGTAAGGTGGCAGG + Intronic
909343982 1:74564050-74564072 CCATTCCACTGAAAGATTAAAGG + Intergenic
912483547 1:110004815-110004837 CCTTTCCTCTGAAAAAGGAGTGG + Intronic
913272084 1:117104250-117104272 CCTTTCATCTGTAAAATGTGTGG + Exonic
913996032 1:143652466-143652488 CCTGTCCACTGTAAGCTCAGAGG - Intergenic
914448048 1:147766825-147766847 ACATTCCACTGTATGGTGAGTGG - Intronic
915542805 1:156579460-156579482 CCCTTCCTCTGTGAAATGAGGGG + Intergenic
919972209 1:202588407-202588429 CCTTTCAACCCTAAGATGAATGG + Exonic
920130335 1:203727264-203727286 CCTTCCCACTGGAAGAGCAGTGG - Intronic
921490436 1:215769473-215769495 CCTTTCTGCTGCAAGTTGAGTGG + Intronic
924273555 1:242360774-242360796 TTTTTCCATTGTAAAATGAGTGG - Intronic
1063481187 10:6378016-6378038 CCTTTCATCTGGAAGATGATGGG + Intergenic
1064293358 10:14055089-14055111 CCTTTCCCCAGGAAGATGGGAGG + Intronic
1064825694 10:19396776-19396798 CCTCTCCTCTGTAACATGTGTGG - Intronic
1069643523 10:69973298-69973320 TCTTTCATCTGTAAGATGCGAGG - Intergenic
1070660865 10:78304338-78304360 CCTCTCCACTGTATGATGTTGGG + Intergenic
1074412980 10:113243802-113243824 CCTTTCTCCTGGAAGAAGAGGGG - Intergenic
1075927368 10:126263256-126263278 CATTTCCACTCTAAGATGTTCGG - Intronic
1076689156 10:132212103-132212125 CATTTCCACTGAATGCTGAGGGG - Intronic
1079557185 11:21774166-21774188 CCTGTTCAGTGTAAGATTAGTGG + Intergenic
1084361226 11:68669769-68669791 GCTGTCCACTGTAGGAAGAGGGG - Intergenic
1084480457 11:69416937-69416959 CCTTTGCACAATAAAATGAGGGG - Intergenic
1085935498 11:81136882-81136904 CTTTTGCTCTATAAGATGAGAGG - Intergenic
1086941566 11:92803636-92803658 CCTGTGCACTGTAGGATGTGTGG + Intronic
1086982270 11:93211333-93211355 CCTGTCCATTGTAAAATGTGGGG - Intergenic
1087172292 11:95061575-95061597 ATTTTCCACTGAAAGATGAGTGG - Intergenic
1087652965 11:100889712-100889734 CTTTTTCTCTGGAAGATGAGAGG + Intronic
1088774435 11:113068745-113068767 CCTTACCACTGGAATATGTGGGG + Intronic
1091366554 11:135026074-135026096 ACTTTCCACTGTAAGATTTCTGG - Intergenic
1091692292 12:2605438-2605460 TCCTTCCACTGTAAGATGGGAGG + Intronic
1094741741 12:33296929-33296951 CCTTTCCACAGGTAGTTGAGTGG - Intergenic
1095072613 12:37873291-37873313 CTTTTCCACTGTAAGACTAAAGG + Intergenic
1097974977 12:65675685-65675707 CTTTTCCATTGTAAGATCACTGG - Intergenic
1100156409 12:91804920-91804942 CCTTGCCACTGTTATTTGAGGGG + Intergenic
1101531351 12:105576220-105576242 CATTTCCACCCTAAGAGGAGAGG - Intergenic
1104708799 12:130970272-130970294 TCTTTCAACTGTAAGGTGATTGG + Intronic
1106209268 13:27625922-27625944 CCATTCCTCTGTATAATGAGTGG - Intronic
1106489013 13:30200034-30200056 CTCTTCACCTGTAAGATGAGGGG + Intergenic
1107957995 13:45535297-45535319 CCTTTCCTCTGTTTGATGTGAGG + Exonic
1110595678 13:77318153-77318175 CCTTTCCACTGTATAAGGACTGG + Intronic
1111199879 13:84920768-84920790 CAGTTTCACTGAAAGATGAGTGG + Intergenic
1111311395 13:86491258-86491280 CATTTCCAATGTAAGATTATTGG - Intergenic
1112544302 13:100350081-100350103 CTTAACCACTGAAAGATGAGTGG + Intronic
1117478817 14:56122557-56122579 CCATTCAACTGTGAGGTGAGAGG - Intronic
1118675495 14:68180374-68180396 TCTGCCCACTGTTAGATGAGGGG + Intronic
1118988997 14:70781096-70781118 CCTCTCCACTTGAAGCTGAGTGG + Intronic
1119021799 14:71122467-71122489 CCTTTGAACTGTAAGATGAAGGG - Intergenic
1126419032 15:48452034-48452056 CCCTTTCCCTGTAAGATGACTGG + Intronic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1136191723 16:28620254-28620276 TCTTTTCACTGTAGGATCAGAGG - Intronic
1137762277 16:50950360-50950382 ATTTTCCTCTGTAAGATGGGAGG + Intergenic
1138030488 16:53555936-53555958 CCTTTCCACTGTTTAACGAGGGG - Intergenic
1139453886 16:67055694-67055716 CTTTTGGACTGTAAGATGATCGG + Intronic
1142218658 16:88842153-88842175 CCATTCCACTGAAAGACGCGTGG + Intronic
1143445836 17:7008782-7008804 CATATCCACTGCAAAATGAGTGG + Intronic
1144041841 17:11418969-11418991 TCTTTCCACTGGAAGATGAGAGG + Intronic
1144201970 17:12949694-12949716 CCTTTGAACTCTATGATGAGTGG + Exonic
1146848897 17:36204929-36204951 CATTTCCATGGTAAGAAGAGTGG + Intronic
1147156849 17:38548379-38548401 CTTCTCCACTGTGAAATGAGGGG - Intronic
1147342934 17:39765863-39765885 CCTTTCGAGTGTAACATGTGTGG - Exonic
1148462369 17:47846111-47846133 CCCTTCCCCTGTGAGATGAGGGG + Exonic
1149343439 17:55710399-55710421 CCTTTCCTGTGTAAAATAAGAGG - Intergenic
1153509069 18:5832886-5832908 CTTTTCAACTGCAAGAAGAGAGG + Intergenic
1166187087 19:41147592-41147614 CCTTTCCATTGGAAGAAGGGAGG + Intergenic
1167911459 19:52706345-52706367 TCTTTCCAATGTAATAAGAGTGG - Exonic
925761339 2:7187655-7187677 CTTTTCCAATGGAAGCTGAGAGG - Intergenic
925786531 2:7436557-7436579 CCTTTCCACTGTAAAATGAGAGG - Intergenic
926766391 2:16326003-16326025 CTTTTCATCTGTAAAATGAGAGG - Intergenic
930640606 2:53850960-53850982 CATTTCCACTTTAAGATTAATGG + Intergenic
934167238 2:89305395-89305417 CCTATACACTGAAAGAGGAGAGG + Intergenic
936624490 2:114133694-114133716 CCCTTCTTCTGTAAAATGAGAGG - Intergenic
942150626 2:173073028-173073050 TCTTACCACTATAAGAGGAGGGG + Intergenic
943249418 2:185497948-185497970 CCTTTCAACTCTAAGTTTAGTGG - Intergenic
945464263 2:210148504-210148526 TCCTTCCACTGTAAGATGAATGG - Intronic
946401058 2:219468679-219468701 CGTTTCGACTGCAAGATCAGTGG + Exonic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
1173423527 20:42923806-42923828 CCTATCCACTTCAAGATGAATGG + Intronic
1174410413 20:50331385-50331407 TCTCTCCTCTGTAAAATGAGAGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175884582 20:62282156-62282178 TATTTCCACTGGGAGATGAGAGG + Intronic
1179389782 21:40977323-40977345 ACTCTTAACTGTAAGATGAGGGG - Intergenic
1181337691 22:22153179-22153201 CCTTTCCACTTAAAGGTAAGTGG - Intergenic
1183456303 22:37924984-37925006 CCTTTGCCCTGTAACATGGGAGG + Intronic
1184251254 22:43261598-43261620 CCTCTCCACAGAAAGATGGGTGG + Intronic
1185040207 22:48500049-48500071 CCTTTGCTTGGTAAGATGAGGGG + Intronic
949452174 3:4197922-4197944 CCTGTTCATTGTAAGATCAGAGG - Intronic
956229749 3:66999952-66999974 ACTTCCTACTTTAAGATGAGTGG + Intronic
956546946 3:70415053-70415075 ACTGTCAACTGTAAAATGAGGGG + Intergenic
959738931 3:109693743-109693765 GCTTTCCAGTGTCAGATGTGTGG + Intergenic
960518812 3:118631710-118631732 CCTCTCCACAGCAAGATGACTGG - Intergenic
963046901 3:141109366-141109388 CCTTTCCACTGTAAGATGAGGGG - Intronic
964622037 3:158728297-158728319 GCATTCCTTTGTAAGATGAGAGG - Intronic
966289752 3:178342179-178342201 CCTTTCATCTGTAAAATTAGGGG - Intergenic
967092598 3:186148056-186148078 CCTGTCCAATGCAAGATTAGAGG + Exonic
970037080 4:11748968-11748990 TTTTTCCTCTGTAAGATGGGAGG - Intergenic
973082157 4:46006817-46006839 CTTGTCCTCTGTAATATGAGCGG + Intergenic
973252416 4:48074425-48074447 CATTTCCATTTTAAGAAGAGTGG - Intronic
974613816 4:64254185-64254207 CCATTTCACTGAAAAATGAGGGG - Intergenic
979855676 4:125631023-125631045 TCTTTCCAATGTAAGATGGCTGG + Intergenic
981044686 4:140253985-140254007 TCTTTCATCTGTAAAATGAGAGG - Intergenic
981413521 4:144460491-144460513 ACTTTTCACTTTAAGATGACAGG - Intergenic
982452688 4:155571757-155571779 ACTGGCCTCTGTAAGATGAGTGG - Intergenic
983057076 4:163110662-163110684 CATTTCCACTGAAAGAGGACAGG + Intronic
984676091 4:182549339-182549361 CCTTTCCATTAAAAGTTGAGAGG + Intronic
984678871 4:182583462-182583484 CCTTTCATCTGTAATATTAGGGG - Intronic
984915549 4:184719734-184719756 CCTTTCTTCTGTGAGAGGAGAGG + Intronic
985546582 5:512964-512986 ACTTTTCACTGGAAGATAAGAGG + Intronic
988035249 5:25819768-25819790 CCTTGCCACTTTTATATGAGGGG - Intergenic
990136799 5:52654941-52654963 TCTTTCCTCTATAAAATGAGGGG + Intergenic
993196694 5:84757613-84757635 CCTTTCCCCTCTGACATGAGTGG + Intergenic
994318851 5:98366063-98366085 CCTTGCCACTATGAGATGGGAGG + Intergenic
996691237 5:126342581-126342603 CCTTTCCACAGTAAGCTAAAGGG + Intergenic
998175920 5:139902113-139902135 CCATTCCACTATACCATGAGTGG + Intronic
998992652 5:147835170-147835192 CATTTCAACTGTGACATGAGTGG + Intergenic
999941013 5:156543190-156543212 CCTGTGCACTGTAGGATCAGTGG + Intronic
1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG + Intronic
1000677510 5:164139737-164139759 CCCTCCCACTGTAAGATAGGTGG + Intergenic
1002295393 5:178227951-178227973 CCTTTACAAGGCAAGATGAGCGG + Intronic
1005275526 6:24212501-24212523 ACTTTCCTCTGGAAGATGTGTGG - Intronic
1006114632 6:31768943-31768965 CCTTTCTCCTATAAGAAGAGAGG + Intronic
1008067201 6:47062153-47062175 CCTTCCCACTGTTGGAAGAGTGG - Intergenic
1008657448 6:53630264-53630286 CCTTTCCATTTTAAGACAAGAGG + Intergenic
1008891298 6:56494528-56494550 TCCTTCCTCTGTAAAATGAGAGG + Intronic
1009823752 6:68839944-68839966 GCTTTCCACTGTAAAAGGAAAGG - Intronic
1010783417 6:79971923-79971945 CCTTTGCCCTGTCAGCTGAGAGG + Intergenic
1014399944 6:120975893-120975915 CCCTTCCAAGGTAAGATGGGAGG + Intergenic
1015458454 6:133458572-133458594 CCTCTGCACTGTAAGATGTTTGG + Intronic
1016212340 6:141553342-141553364 CCCTCCCACTGCAACATGAGTGG - Intergenic
1016876650 6:148871974-148871996 TATTTCCTCTGTAAGTTGAGGGG + Intronic
1018101872 6:160447302-160447324 GCTTTCCACTGTAAGGTAACAGG + Intronic
1020454561 7:8356947-8356969 CTTTTCCACTGTAGAAGGAGAGG - Intergenic
1022800157 7:33769271-33769293 CCTTGCTACTGTCAAATGAGAGG - Intergenic
1023393660 7:39733116-39733138 GCTGTCTACTGTAAGAGGAGCGG - Intergenic
1026123347 7:67556955-67556977 CCTTTCTTCTGGGAGATGAGGGG - Intergenic
1026664989 7:72334526-72334548 CCTTTCCTCTGTAAGGGGAGGGG - Intronic
1030294433 7:107907561-107907583 CATTTCCACAGTAATAGGAGAGG - Intronic
1030302302 7:107986668-107986690 CATGTCCACTGTAATATGAGTGG + Intronic
1030392913 7:108949255-108949277 CCTTTCAAGTGTAATATTAGTGG - Intergenic
1035385629 7:158470770-158470792 GCATTTCACTGTAACATGAGCGG - Intronic
1037679546 8:21084526-21084548 CTAGTCCACTGTAAGATGAGTGG + Intergenic
1037938796 8:22933949-22933971 CCTTTCCCTTCTAAAATGAGTGG - Intronic
1038387894 8:27166753-27166775 CCATTCCACTGTCAGATCATGGG + Intergenic
1040722465 8:50342827-50342849 CCTTTCCACTTTAACATGTTAGG - Intronic
1044297682 8:90547297-90547319 CCTTTCCACTGAAAAATTAAAGG - Intergenic
1054922990 9:70560390-70560412 CCTTGCCAATGTAATATTAGTGG + Intronic
1059259931 9:112965989-112966011 CCTCTCCACTGTATCAGGAGAGG - Intergenic
1059290998 9:113223461-113223483 CCTAAGCACTGTAAAATGAGTGG + Intronic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1062059771 9:134488911-134488933 TCATTCCAGTGTGAGATGAGGGG + Intergenic
1203773494 EBV:60886-60908 CCTTCCCCCTCTAAGTTGAGGGG + Intergenic
1192505750 X:71681138-71681160 CCTCGCCACTGCAAGATCAGGGG - Intergenic
1195078267 X:101348083-101348105 CCTCTCCGCTGAAAAATGAGTGG - Intronic
1197204078 X:123774692-123774714 CCTTTTTACTGTATGGTGAGTGG - Intergenic
1198573120 X:137979523-137979545 CATTTCTACTGTAAGATGGAGGG + Intergenic
1200878618 Y:8187548-8187570 CATTTCCATTTTAGGATGAGAGG - Intergenic