ID: 963059044

View in Genome Browser
Species Human (GRCh38)
Location 3:141210015-141210037
Sequence ATCTGTAATATGGAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963059044_963059047 -3 Left 963059044 3:141210015-141210037 CCTTCCAGCTCCATATTACAGAT No data
Right 963059047 3:141210035-141210057 GATAAGCCCTCTATCAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963059044 Original CRISPR ATCTGTAATATGGAGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr