ID: 963059405

View in Genome Browser
Species Human (GRCh38)
Location 3:141212725-141212747
Sequence ATGTGCAGGTAGCAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963059403_963059405 -9 Left 963059403 3:141212711-141212733 CCTGCATTGAAGGAATGTGCAGG No data
Right 963059405 3:141212725-141212747 ATGTGCAGGTAGCAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963059405 Original CRISPR ATGTGCAGGTAGCAGTGTCC TGG Intergenic
No off target data available for this crispr