ID: 963061935

View in Genome Browser
Species Human (GRCh38)
Location 3:141232486-141232508
Sequence GGCTGCAGGTGGCTGCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 370}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963061935_963061953 27 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061935_963061938 -10 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061938 3:141232499-141232521 ACCTGCAGCCTGACGCCTCCGGG 0: 1
1: 0
2: 2
3: 15
4: 180
963061935_963061946 10 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061946 3:141232519-141232541 GGGAGTCCCGGGCCTGGCCACGG 0: 1
1: 0
2: 3
3: 35
4: 442
963061935_963061942 -1 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061942 3:141232508-141232530 CTGACGCCTCCGGGAGTCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 114
963061935_963061947 11 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061947 3:141232520-141232542 GGAGTCCCGGGCCTGGCCACGGG 0: 1
1: 0
2: 1
3: 22
4: 247
963061935_963061948 12 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061948 3:141232521-141232543 GAGTCCCGGGCCTGGCCACGGGG 0: 1
1: 0
2: 1
3: 14
4: 206
963061935_963061941 -2 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061941 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 1
3: 8
4: 103
963061935_963061943 4 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061943 3:141232513-141232535 GCCTCCGGGAGTCCCGGGCCTGG 0: 1
1: 1
2: 1
3: 22
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963061935 Original CRISPR GGCTGCAGGTGGCTGCCAAG AGG (reversed) Intronic