ID: 963061939

View in Genome Browser
Species Human (GRCh38)
Location 3:141232500-141232522
Sequence TCCCGGAGGCGTCAGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963061939_963061943 -10 Left 963061939 3:141232500-141232522 CCTGCAGCCTGACGCCTCCGGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 963061943 3:141232513-141232535 GCCTCCGGGAGTCCCGGGCCTGG 0: 1
1: 1
2: 1
3: 22
4: 286
963061939_963061947 -3 Left 963061939 3:141232500-141232522 CCTGCAGCCTGACGCCTCCGGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 963061947 3:141232520-141232542 GGAGTCCCGGGCCTGGCCACGGG 0: 1
1: 0
2: 1
3: 22
4: 247
963061939_963061946 -4 Left 963061939 3:141232500-141232522 CCTGCAGCCTGACGCCTCCGGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 963061946 3:141232519-141232541 GGGAGTCCCGGGCCTGGCCACGG 0: 1
1: 0
2: 3
3: 35
4: 442
963061939_963061957 26 Left 963061939 3:141232500-141232522 CCTGCAGCCTGACGCCTCCGGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
963061939_963061948 -2 Left 963061939 3:141232500-141232522 CCTGCAGCCTGACGCCTCCGGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 963061948 3:141232521-141232543 GAGTCCCGGGCCTGGCCACGGGG 0: 1
1: 0
2: 1
3: 14
4: 206
963061939_963061953 13 Left 963061939 3:141232500-141232522 CCTGCAGCCTGACGCCTCCGGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963061939 Original CRISPR TCCCGGAGGCGTCAGGCTGC AGG (reversed) Intronic