ID: 963061940

View in Genome Browser
Species Human (GRCh38)
Location 3:141232507-141232529
Sequence CCGGGACTCCCGGAGGCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963061940_963061947 -10 Left 963061940 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 963061947 3:141232520-141232542 GGAGTCCCGGGCCTGGCCACGGG 0: 1
1: 0
2: 1
3: 22
4: 247
963061940_963061958 28 Left 963061940 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 963061958 3:141232558-141232580 GTTAACATTCCTGGATGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
963061940_963061957 19 Left 963061940 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
963061940_963061953 6 Left 963061940 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061940_963061948 -9 Left 963061940 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 963061948 3:141232521-141232543 GAGTCCCGGGCCTGGCCACGGGG 0: 1
1: 0
2: 1
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963061940 Original CRISPR CCGGGACTCCCGGAGGCGTC AGG (reversed) Intronic