ID: 963061944

View in Genome Browser
Species Human (GRCh38)
Location 3:141232514-141232536
Sequence GCCAGGCCCGGGACTCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 276}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963061944_963061958 21 Left 963061944 3:141232514-141232536 CCTCCGGGAGTCCCGGGCCTGGC 0: 1
1: 0
2: 1
3: 24
4: 276
Right 963061958 3:141232558-141232580 GTTAACATTCCTGGATGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
963061944_963061953 -1 Left 963061944 3:141232514-141232536 CCTCCGGGAGTCCCGGGCCTGGC 0: 1
1: 0
2: 1
3: 24
4: 276
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061944_963061957 12 Left 963061944 3:141232514-141232536 CCTCCGGGAGTCCCGGGCCTGGC 0: 1
1: 0
2: 1
3: 24
4: 276
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
963061944_963061959 26 Left 963061944 3:141232514-141232536 CCTCCGGGAGTCCCGGGCCTGGC 0: 1
1: 0
2: 1
3: 24
4: 276
Right 963061959 3:141232563-141232585 CATTCCTGGATGCGCAGGTTAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963061944 Original CRISPR GCCAGGCCCGGGACTCCCGG AGG (reversed) Intronic