ID: 963061945

View in Genome Browser
Species Human (GRCh38)
Location 3:141232517-141232539
Sequence GTGGCCAGGCCCGGGACTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 301}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963061945_963061959 23 Left 963061945 3:141232517-141232539 CCGGGAGTCCCGGGCCTGGCCAC 0: 1
1: 0
2: 2
3: 26
4: 301
Right 963061959 3:141232563-141232585 CATTCCTGGATGCGCAGGTTAGG 0: 1
1: 0
2: 0
3: 6
4: 95
963061945_963061953 -4 Left 963061945 3:141232517-141232539 CCGGGAGTCCCGGGCCTGGCCAC 0: 1
1: 0
2: 2
3: 26
4: 301
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061945_963061958 18 Left 963061945 3:141232517-141232539 CCGGGAGTCCCGGGCCTGGCCAC 0: 1
1: 0
2: 2
3: 26
4: 301
Right 963061958 3:141232558-141232580 GTTAACATTCCTGGATGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
963061945_963061957 9 Left 963061945 3:141232517-141232539 CCGGGAGTCCCGGGCCTGGCCAC 0: 1
1: 0
2: 2
3: 26
4: 301
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963061945 Original CRISPR GTGGCCAGGCCCGGGACTCC CGG (reversed) Intronic