ID: 963061947

View in Genome Browser
Species Human (GRCh38)
Location 3:141232520-141232542
Sequence GGAGTCCCGGGCCTGGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 247}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963061940_963061947 -10 Left 963061940 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 963061947 3:141232520-141232542 GGAGTCCCGGGCCTGGCCACGGG 0: 1
1: 0
2: 1
3: 22
4: 247
963061933_963061947 29 Left 963061933 3:141232468-141232490 CCGGAGACGGGGCTGGCTCCTCT 0: 1
1: 0
2: 0
3: 16
4: 179
Right 963061947 3:141232520-141232542 GGAGTCCCGGGCCTGGCCACGGG 0: 1
1: 0
2: 1
3: 22
4: 247
963061932_963061947 30 Left 963061932 3:141232467-141232489 CCCGGAGACGGGGCTGGCTCCTC 0: 1
1: 0
2: 1
3: 25
4: 242
Right 963061947 3:141232520-141232542 GGAGTCCCGGGCCTGGCCACGGG 0: 1
1: 0
2: 1
3: 22
4: 247
963061935_963061947 11 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061947 3:141232520-141232542 GGAGTCCCGGGCCTGGCCACGGG 0: 1
1: 0
2: 1
3: 22
4: 247
963061936_963061947 0 Left 963061936 3:141232497-141232519 CCACCTGCAGCCTGACGCCTCCG 0: 1
1: 0
2: 0
3: 16
4: 231
Right 963061947 3:141232520-141232542 GGAGTCCCGGGCCTGGCCACGGG 0: 1
1: 0
2: 1
3: 22
4: 247
963061939_963061947 -3 Left 963061939 3:141232500-141232522 CCTGCAGCCTGACGCCTCCGGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 963061947 3:141232520-141232542 GGAGTCCCGGGCCTGGCCACGGG 0: 1
1: 0
2: 1
3: 22
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963061947 Original CRISPR GGAGTCCCGGGCCTGGCCAC GGG Intronic