ID: 963061948

View in Genome Browser
Species Human (GRCh38)
Location 3:141232521-141232543
Sequence GAGTCCCGGGCCTGGCCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963061939_963061948 -2 Left 963061939 3:141232500-141232522 CCTGCAGCCTGACGCCTCCGGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 963061948 3:141232521-141232543 GAGTCCCGGGCCTGGCCACGGGG 0: 1
1: 0
2: 1
3: 14
4: 206
963061940_963061948 -9 Left 963061940 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 963061948 3:141232521-141232543 GAGTCCCGGGCCTGGCCACGGGG 0: 1
1: 0
2: 1
3: 14
4: 206
963061935_963061948 12 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061948 3:141232521-141232543 GAGTCCCGGGCCTGGCCACGGGG 0: 1
1: 0
2: 1
3: 14
4: 206
963061936_963061948 1 Left 963061936 3:141232497-141232519 CCACCTGCAGCCTGACGCCTCCG 0: 1
1: 0
2: 0
3: 16
4: 231
Right 963061948 3:141232521-141232543 GAGTCCCGGGCCTGGCCACGGGG 0: 1
1: 0
2: 1
3: 14
4: 206
963061933_963061948 30 Left 963061933 3:141232468-141232490 CCGGAGACGGGGCTGGCTCCTCT 0: 1
1: 0
2: 0
3: 16
4: 179
Right 963061948 3:141232521-141232543 GAGTCCCGGGCCTGGCCACGGGG 0: 1
1: 0
2: 1
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963061948 Original CRISPR GAGTCCCGGGCCTGGCCACG GGG Intronic