ID: 963061953

View in Genome Browser
Species Human (GRCh38)
Location 3:141232536-141232558
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963061935_963061953 27 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061945_963061953 -4 Left 963061945 3:141232517-141232539 CCGGGAGTCCCGGGCCTGGCCAC 0: 1
1: 0
2: 2
3: 26
4: 301
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061940_963061953 6 Left 963061940 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061939_963061953 13 Left 963061939 3:141232500-141232522 CCTGCAGCCTGACGCCTCCGGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061936_963061953 16 Left 963061936 3:141232497-141232519 CCACCTGCAGCCTGACGCCTCCG 0: 1
1: 0
2: 0
3: 16
4: 231
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061944_963061953 -1 Left 963061944 3:141232514-141232536 CCTCCGGGAGTCCCGGGCCTGGC 0: 1
1: 0
2: 1
3: 24
4: 276
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type