ID: 963061953

View in Genome Browser
Species Human (GRCh38)
Location 3:141232536-141232558
Sequence CCACGGGGCCGCCCGAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963061935_963061953 27 Left 963061935 3:141232486-141232508 CCTCTTGGCAGCCACCTGCAGCC 0: 1
1: 0
2: 3
3: 52
4: 370
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061939_963061953 13 Left 963061939 3:141232500-141232522 CCTGCAGCCTGACGCCTCCGGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061945_963061953 -4 Left 963061945 3:141232517-141232539 CCGGGAGTCCCGGGCCTGGCCAC 0: 1
1: 0
2: 2
3: 26
4: 301
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061940_963061953 6 Left 963061940 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061936_963061953 16 Left 963061936 3:141232497-141232519 CCACCTGCAGCCTGACGCCTCCG 0: 1
1: 0
2: 0
3: 16
4: 231
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132
963061944_963061953 -1 Left 963061944 3:141232514-141232536 CCTCCGGGAGTCCCGGGCCTGGC 0: 1
1: 0
2: 1
3: 24
4: 276
Right 963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963061953 Original CRISPR CCACGGGGCCGCCCGAGCGC AGG Intronic
901512674 1:9725220-9725242 CTAGGGGGCCGCGTGAGCGCTGG + Intronic
903555057 1:24187228-24187250 CCATGGCGGGGCCCGAGCGCTGG - Exonic
905075672 1:35268840-35268862 CCACGGGTCCGCGCGTGGGCGGG - Intergenic
905517177 1:38570279-38570301 CCGCGGGGCAGGCCGGGCGCAGG + Intergenic
906640554 1:47438380-47438402 CCCCCGGGACGCCAGAGCGCGGG - Exonic
908501021 1:64744632-64744654 CCCCCGGGCCGCCCCAGCGCGGG + Intergenic
908738968 1:67307849-67307871 CACCGGGAACGCCCGAGCGCCGG + Exonic
908780520 1:67685871-67685893 TGACGGGGCCGCGGGAGCGCCGG + Intronic
915530759 1:156500901-156500923 CCTCGGGACCGCCCCAGCCCCGG - Intergenic
916890159 1:169106249-169106271 CCACCGGGCCGCTAGAGGGCGGG + Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
919101861 1:193105539-193105561 TCCCAGGGCTGCCCGAGCGCTGG + Exonic
922748197 1:228058943-228058965 CCAGGGGGCCGCCCTGACGCTGG + Intronic
923299711 1:232630044-232630066 CCCGCCGGCCGCCCGAGCGCAGG - Intergenic
923490378 1:234478773-234478795 CCAGGCGGACGCACGAGCGCAGG + Exonic
923630946 1:235649429-235649451 CCCCGGGGAAGCCCGCGCGCGGG - Intronic
1062910812 10:1210837-1210859 CCACGGGGAGGCCCCAGCGCGGG - Intronic
1064152496 10:12876501-12876523 CCACGGGGCACCCAGAGAGCTGG - Intergenic
1065589596 10:27251613-27251635 CCCGGGGGCCGCCTGAGCCCTGG - Intergenic
1070198008 10:74176720-74176742 GCCAGGGGCCGCCCGCGCGCGGG + Intronic
1073100994 10:101006643-101006665 ACAGGAGGCCGCCCGAGCTCGGG + Exonic
1074829992 10:117241333-117241355 CCCCGGGGCAGCCGGGGCGCAGG + Intronic
1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG + Intronic
1075766767 10:124899406-124899428 CCACGGGGCTGCCTGGCCGCAGG - Intergenic
1077133065 11:984243-984265 CCACAGGGCCCCCCGACCACAGG - Intronic
1077269141 11:1666856-1666878 CCCCGGGGCCTCCCGGGCGGTGG - Intergenic
1077271406 11:1683858-1683880 CCCCGGGGCCTCCCGGGCGGTGG + Intergenic
1077544885 11:3165010-3165032 CCGCGGGGCCGGTCGCGCGCTGG - Intronic
1078421278 11:11215207-11215229 CCACAGGGCTCCCCGAGAGCAGG - Intergenic
1078800986 11:14643973-14643995 CCAGGGGGCGCCCCGAACGCGGG + Exonic
1084166869 11:67379202-67379224 CCACTGGGGCCCCCGAGGGCAGG + Intronic
1088462087 11:110093018-110093040 GCTCGGGCGCGCCCGAGCGCTGG - Intergenic
1091300253 11:134502990-134503012 CCACGGGCCTGCCCGGGCCCGGG - Intergenic
1091364661 11:135007626-135007648 CCACAGTGCAGCCCGAGCCCAGG + Intergenic
1096779025 12:53981750-53981772 CCACAGGGCAGCCCAAGGGCTGG - Intergenic
1102933871 12:116881329-116881351 GCGAGGGGCGGCCCGAGCGCGGG - Exonic
1108676032 13:52738959-52738981 CCTAGGGGGAGCCCGAGCGCGGG - Intronic
1113431989 13:110259034-110259056 ACACGGGGCCGCCCGGTCCCTGG + Intronic
1113480352 13:110615823-110615845 CCGAGGGGCAGCCCGCGCGCGGG + Intronic
1116900946 14:50362009-50362031 CCAGGGGGCCGCTAGAGTGCCGG - Intronic
1121422502 14:93825206-93825228 CCAGGGGGCCTCCCGACCCCAGG + Intergenic
1122470734 14:101964439-101964461 TCACGGCGCCGCGCGTGCGCGGG - Intergenic
1123036668 14:105474563-105474585 CCGCGGCGCCGCCCGCGCCCCGG - Intronic
1124999287 15:34754381-34754403 CGACGGGGCCCCCTGACCGCCGG + Intronic
1128454131 15:67823245-67823267 CCCCGGGTCCGCCCGCCCGCGGG - Intronic
1129051281 15:72783800-72783822 CCACGGGGCCCCCCAAGGGGCGG + Intronic
1129189128 15:73927398-73927420 CCACGCCGCCGCCCGCGGGCCGG - Exonic
1129933691 15:79432179-79432201 TCCCGGGGCCGCTGGAGCGCGGG + Intergenic
1131174403 15:90201164-90201186 CCCGGCGGCCGCCGGAGCGCTGG - Intronic
1131367776 15:91854131-91854153 CCAGGCGGCCGCTCGAGAGCCGG - Intronic
1132110796 15:99100564-99100586 CCACGGCGCCGCTCAAGCGAAGG + Intronic
1132556215 16:573858-573880 CCAAGGGGCAGCCAGAGTGCTGG - Intronic
1132787018 16:1662694-1662716 CCACGGGGACGCTCGCACGCGGG - Intronic
1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG + Exonic
1135607364 16:23836117-23836139 CCCCGGGGCCGCGGGACCGCGGG - Exonic
1137555042 16:49465120-49465142 CCCCGGGGCAGCCTGAGCGCGGG + Intergenic
1141418922 16:83899200-83899222 CCCCGCGGCCGCCCGGGCCCCGG + Exonic
1141720069 16:85751072-85751094 GCGCGCGGCTGCCCGAGCGCCGG - Exonic
1141906932 16:87033105-87033127 CCCCGGGGCCGCCCTGGCGTGGG - Intergenic
1142130003 16:88428090-88428112 CCCCGGGGCCCCCCCAGAGCAGG + Exonic
1143750424 17:9023006-9023028 CGATGAGGCCGCCCGAGAGCGGG - Exonic
1144724636 17:17495823-17495845 CCAGGGCGCCCCGCGAGCGCCGG - Intronic
1147341286 17:39754511-39754533 CCCCGCAGGCGCCCGAGCGCCGG + Intergenic
1148235088 17:45963527-45963549 CCACAGTGCAGCCCGAGGGCAGG + Intronic
1148361681 17:47017350-47017372 CCCTGGGGCCGCCTGAGCCCTGG + Intronic
1150108564 17:62479021-62479043 CCCCGCGGCCGCCCGGGCCCGGG + Exonic
1150405462 17:64897078-64897100 CCCTGGGGCCGCCTGAGCCCTGG - Exonic
1151821980 17:76501458-76501480 CCTCCCGGCCGCCCGCGCGCAGG - Intronic
1157094864 18:44679187-44679209 CCACTGGGCCGCAAGGGCGCCGG + Intergenic
1158499167 18:57984438-57984460 CAAAGGGGCTGCCCGAGCCCGGG - Intergenic
1160577322 18:79864068-79864090 GCGCGGGGCCGACGGAGCGCGGG + Exonic
1160810059 19:1009391-1009413 CCACGGGGGCCCCCCAGCCCGGG + Exonic
1161233177 19:3185802-3185824 CCACAGGGCTCCGCGAGCGCCGG + Exonic
1161628451 19:5339846-5339868 CCACGGGGCCCCCAGCGCGGAGG + Intronic
1162615708 19:11798810-11798832 CGCCGGGGTCGCCCGAGCGGAGG - Intronic
1163830972 19:19547005-19547027 CGACGGGGCTGCCCGAGGCCAGG + Intergenic
1166736694 19:45090142-45090164 CCCCGGGGCAGCCGGAGCACAGG - Exonic
1166807585 19:45496630-45496652 CCCCGTCGCCGCCAGAGCGCGGG + Intronic
1168325351 19:55536168-55536190 CCAGGAGGCTGCCCGCGCGCTGG - Exonic
930700813 2:54456647-54456669 CCACGCGGCTCCCCGGGCGCAGG - Intronic
932313896 2:70767412-70767434 CCCCGGGGCCTCGCGATCGCTGG - Intronic
932827998 2:74958949-74958971 CCTCGGGGCCTCCCGCGGGCGGG + Intronic
935971625 2:108534736-108534758 CCACGCCGCCACCCGAGCGCTGG - Intronic
938460512 2:131493233-131493255 CCGCCGGGCCGCCCGAGTCCTGG - Intergenic
938583683 2:132669762-132669784 CCGCTGGGCAGCCCCAGCGCAGG + Intronic
938767298 2:134468837-134468859 CCACTGGGTCGGCCGAGCCCTGG - Intronic
940646785 2:156400308-156400330 TCGCGGCGCGGCCCGAGCGCTGG + Intergenic
941008365 2:160270320-160270342 CCGCGGGGCCCCCCGGGCGCAGG - Intronic
1171982479 20:31637828-31637850 TCTCGGGGCCGCCCCAGCGTGGG - Intergenic
1173298651 20:41781403-41781425 CCACGGGGCCACCAGAGCCTGGG - Intergenic
1173470045 20:43316465-43316487 CCATGGGGCTGGCCCAGCGCAGG - Intergenic
1175945935 20:62558787-62558809 CCACGGGGCCCCCCGGGGACAGG - Intronic
1175998328 20:62821194-62821216 CCCCGGGGCCGCCCGGGCTGGGG + Exonic
1179714223 21:43279622-43279644 GCACTGGACCGCCCGAGGGCCGG + Intergenic
1180180846 21:46118117-46118139 CGGCGGGGCCGCCCAAGCCCTGG - Intronic
954402861 3:50328110-50328132 CCACGGGGCCCGCCATGCGCCGG - Exonic
962676953 3:137764580-137764602 CCCCGGGGCTGCCTGGGCGCTGG + Exonic
963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG + Intronic
965534712 3:169812476-169812498 CCGGGAGGCCGCCCGTGCGCCGG - Exonic
968457263 4:706068-706090 CGACGGGGACGACGGAGCGCGGG - Intronic
968593736 4:1472213-1472235 CCGCGGGGCAGCCGGAGCCCGGG + Intergenic
968631646 4:1655099-1655121 CCACGGCGCCCGCCCAGCGCAGG + Exonic
969114282 4:4861319-4861341 CCGCCGGGCCGCCCGAGGGGCGG - Intronic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
994411339 5:99410504-99410526 CCTCTGGGCTGCCTGAGCGCCGG - Intergenic
994482490 5:100354743-100354765 CCTCTGGGCTGCCTGAGCGCCGG + Intergenic
997232978 5:132257449-132257471 CGTCGGGGCCGTCCGAACGCGGG + Intronic
997950921 5:138241981-138242003 GCACGGGGCTGGCCGAGCGCCGG - Intergenic
998152302 5:139764455-139764477 CCACGGCGCCGCCAGACCCCCGG - Intergenic
1000210921 5:159105323-159105345 GCACGGTGCCTCCCGAGGGCAGG + Intergenic
1001556810 5:172642152-172642174 CCACGGGCACGCGCGGGCGCGGG - Intronic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1006665276 6:35688875-35688897 CCAGCAGGCCGCCCGCGCGCCGG + Intronic
1007731704 6:43951447-43951469 CCTGGGGGCGGCCCGAGCCCTGG + Intergenic
1013170744 6:107634732-107634754 CCCCCGGGCCCCCCGGGCGCGGG + Exonic
1013538758 6:111087574-111087596 CCTCGCGGCCGCCTGCGCGCTGG + Exonic
1018670103 6:166169888-166169910 CCGCGACGCCGTCCGAGCGCAGG - Intergenic
1019681880 7:2355040-2355062 CCCCGCGGCCTCCGGAGCGCCGG - Exonic
1021688066 7:23206376-23206398 CCACGGAGCCGCGCGAGTCCGGG + Intergenic
1034522580 7:151632200-151632222 GCTCGCGGCCGGCCGAGCGCTGG + Intronic
1035450349 7:158973805-158973827 CCACGAGGCTGCCCGACTGCAGG + Intergenic
1037262781 8:17027132-17027154 CCCCGGGGCCGCGCGAGTGTAGG + Intergenic
1037760734 8:21739839-21739861 CCTCTGGGCAGCCCGAGAGCTGG + Intronic
1039921560 8:41897100-41897122 CCGCCGGGTCGCCCGGGCGCGGG - Intergenic
1045516191 8:102863323-102863345 CCACAGCGCCGCCCGCCCGCCGG + Intronic
1053306299 9:36986693-36986715 CCACGGGGCGCCCGGACCGCGGG + Intronic
1054798605 9:69325330-69325352 CCACGGGGCAGCAGGAGCCCGGG - Intronic
1057314270 9:93958715-93958737 CCTCGGCGCCGCCCGGTCGCTGG + Intergenic
1057337405 9:94166535-94166557 CCCCGGGGCCACCCGCCCGCTGG - Intergenic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1059344958 9:113621676-113621698 CCAGGGGGCCGTCCGTGGGCAGG + Intergenic
1061248443 9:129413424-129413446 CCGGGGGGCCGCCCGAGCTCCGG + Intergenic
1061280959 9:129597458-129597480 CTCCGGAGCCGTCCGAGCGCTGG + Intergenic
1062230599 9:135479797-135479819 CCACGGCGCGGCCCGGGCGCGGG + Exonic
1062439146 9:136561845-136561867 CCACGGGGCCTCCCCACCACTGG - Intergenic
1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG + Intronic
1062596714 9:137302848-137302870 CCATGAGGCTGCCCGCGCGCGGG - Intergenic
1185464442 X:346364-346386 GCACGGGGCCGCCAGGGCACAGG + Intronic
1189491133 X:41472604-41472626 CCTCGGGGCAGCCGGAGCACAGG + Intronic
1196842543 X:119871810-119871832 CCCCGCGGCCGCCCGCGAGCGGG - Exonic
1199267468 X:145845073-145845095 CCACGTGCCCGTCAGAGCGCTGG + Intergenic