ID: 963061957

View in Genome Browser
Species Human (GRCh38)
Location 3:141232549-141232571
Sequence CGAGCGCAGGTTAACATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 32}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963061944_963061957 12 Left 963061944 3:141232514-141232536 CCTCCGGGAGTCCCGGGCCTGGC 0: 1
1: 0
2: 1
3: 24
4: 276
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
963061952_963061957 -10 Left 963061952 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 2
3: 17
4: 182
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
963061949_963061957 1 Left 963061949 3:141232525-141232547 CCCGGGCCTGGCCACGGGGCCGC 0: 1
1: 0
2: 5
3: 48
4: 411
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
963061939_963061957 26 Left 963061939 3:141232500-141232522 CCTGCAGCCTGACGCCTCCGGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
963061936_963061957 29 Left 963061936 3:141232497-141232519 CCACCTGCAGCCTGACGCCTCCG 0: 1
1: 0
2: 0
3: 16
4: 231
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
963061950_963061957 0 Left 963061950 3:141232526-141232548 CCGGGCCTGGCCACGGGGCCGCC 0: 1
1: 0
2: 3
3: 31
4: 437
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
963061951_963061957 -5 Left 963061951 3:141232531-141232553 CCTGGCCACGGGGCCGCCCGAGC 0: 1
1: 0
2: 0
3: 19
4: 231
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
963061945_963061957 9 Left 963061945 3:141232517-141232539 CCGGGAGTCCCGGGCCTGGCCAC 0: 1
1: 0
2: 2
3: 26
4: 301
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
963061940_963061957 19 Left 963061940 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 963061957 3:141232549-141232571 CGAGCGCAGGTTAACATTCCTGG 0: 1
1: 0
2: 1
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963061957 Original CRISPR CGAGCGCAGGTTAACATTCC TGG Intronic