ID: 963061958

View in Genome Browser
Species Human (GRCh38)
Location 3:141232558-141232580
Sequence GTTAACATTCCTGGATGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963061954_963061958 -9 Left 963061954 3:141232544-141232566 CCGCCCGAGCGCAGGTTAACATT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 963061958 3:141232558-141232580 GTTAACATTCCTGGATGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
963061949_963061958 10 Left 963061949 3:141232525-141232547 CCCGGGCCTGGCCACGGGGCCGC 0: 1
1: 0
2: 5
3: 48
4: 411
Right 963061958 3:141232558-141232580 GTTAACATTCCTGGATGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
963061951_963061958 4 Left 963061951 3:141232531-141232553 CCTGGCCACGGGGCCGCCCGAGC 0: 1
1: 0
2: 0
3: 19
4: 231
Right 963061958 3:141232558-141232580 GTTAACATTCCTGGATGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
963061950_963061958 9 Left 963061950 3:141232526-141232548 CCGGGCCTGGCCACGGGGCCGCC 0: 1
1: 0
2: 3
3: 31
4: 437
Right 963061958 3:141232558-141232580 GTTAACATTCCTGGATGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
963061945_963061958 18 Left 963061945 3:141232517-141232539 CCGGGAGTCCCGGGCCTGGCCAC 0: 1
1: 0
2: 2
3: 26
4: 301
Right 963061958 3:141232558-141232580 GTTAACATTCCTGGATGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
963061952_963061958 -1 Left 963061952 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG 0: 1
1: 0
2: 2
3: 17
4: 182
Right 963061958 3:141232558-141232580 GTTAACATTCCTGGATGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
963061940_963061958 28 Left 963061940 3:141232507-141232529 CCTGACGCCTCCGGGAGTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 963061958 3:141232558-141232580 GTTAACATTCCTGGATGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
963061944_963061958 21 Left 963061944 3:141232514-141232536 CCTCCGGGAGTCCCGGGCCTGGC 0: 1
1: 0
2: 1
3: 24
4: 276
Right 963061958 3:141232558-141232580 GTTAACATTCCTGGATGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963061958 Original CRISPR GTTAACATTCCTGGATGCGC AGG Intronic