ID: 963062519

View in Genome Browser
Species Human (GRCh38)
Location 3:141235904-141235926
Sequence TCCCCAGCCAAAGTCCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963062519_963062524 20 Left 963062519 3:141235904-141235926 CCTTTTTGGACTTTGGCTGGGGA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 963062524 3:141235947-141235969 AGTTCAGTCTGCAGTGATGGCGG 0: 1
1: 0
2: 6
3: 24
4: 190
963062519_963062521 -7 Left 963062519 3:141235904-141235926 CCTTTTTGGACTTTGGCTGGGGA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 963062521 3:141235920-141235942 CTGGGGAAGCCACTGGCTTTTGG 0: 1
1: 0
2: 1
3: 24
4: 244
963062519_963062525 21 Left 963062519 3:141235904-141235926 CCTTTTTGGACTTTGGCTGGGGA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 963062525 3:141235948-141235970 GTTCAGTCTGCAGTGATGGCGGG 0: 1
1: 1
2: 0
3: 13
4: 204
963062519_963062523 17 Left 963062519 3:141235904-141235926 CCTTTTTGGACTTTGGCTGGGGA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 963062523 3:141235944-141235966 AAAAGTTCAGTCTGCAGTGATGG 0: 1
1: 0
2: 0
3: 31
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963062519 Original CRISPR TCCCCAGCCAAAGTCCAAAA AGG (reversed) Intronic
900206007 1:1432165-1432187 TCCCCAGACACAGTCCAGACAGG - Intergenic
900608279 1:3533516-3533538 TCCGCAGCCACAGCCCAACAGGG + Intronic
903924852 1:26824918-26824940 TCCACAGCCAAGGAGCAAAAAGG + Intergenic
905957584 1:42011895-42011917 GCACCAGCGAAAGTGCAAAAGGG - Intronic
908718382 1:67095634-67095656 TCCCCACTCAAAATCCAAAGAGG - Intronic
908801570 1:67885947-67885969 TCCCCATCCCAAATCCAATAGGG + Intergenic
909867413 1:80690910-80690932 TCCCCAGCAAAAGACTCAAAAGG + Intergenic
911086574 1:93983178-93983200 TTCCCAGACGAAGTCCAGAATGG + Intergenic
921282928 1:213585253-213585275 TCCACAGCCACAGACCAACATGG - Intergenic
921375781 1:214472020-214472042 TCCCCAGTCAGAGTCCTGAAGGG + Intronic
921546804 1:216483172-216483194 TCCCTATCCAAAATCCAAATGGG + Intergenic
924463849 1:244283271-244283293 TACCCAGACTAAGCCCAAAATGG + Intergenic
1063500667 10:6550819-6550841 TTCCCAGCAAAAGTGCAAAAAGG + Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1069113327 10:64473495-64473517 GCCCAAGCCAATGTGCAAAAGGG - Intergenic
1069893417 10:71666047-71666069 TGTCCAGCCCAAGTCCACAATGG + Intronic
1070401437 10:76056575-76056597 TCAGCACCCAAAGTCCAGAAGGG + Intronic
1070601382 10:77868772-77868794 TCCCCAAGGAAACTCCAAAAGGG + Intronic
1077836044 11:5929068-5929090 TCCCCAGGGGAAGTCCAAATCGG + Intronic
1079661175 11:23038457-23038479 TCCACAGCCAATGCCCAGAATGG - Intergenic
1081650750 11:44822631-44822653 TTCCCAGCCACAGCCCTAAAGGG + Intronic
1082053532 11:47793429-47793451 TTCCCAGCAACAGTACAAAAGGG - Intronic
1084067803 11:66715380-66715402 TCCACAGCCAAAGCCTACAAAGG - Exonic
1086249265 11:84794811-84794833 TCAGCAGCCAAAGTCCAGAGGGG - Intronic
1086748176 11:90456193-90456215 CCCAAAGCCAAAGTCCAGAATGG - Intergenic
1087800149 11:102495109-102495131 TCCCCAGTTAAAGTTCCAAAAGG + Intronic
1088029956 11:105236418-105236440 ACCACAGCCAATGTCCAAAATGG - Intergenic
1089228440 11:116947495-116947517 TCCCTAGCTAAAGTAAAAAATGG - Intronic
1090021700 11:123134309-123134331 GCCCCAGCAAAGGACCAAAAAGG + Intronic
1090428051 11:126623870-126623892 TCCCCAACCCCAGTCCAGAAGGG + Intronic
1091069390 11:132548997-132549019 TACCCAGCCCATGTCCAAGATGG - Intronic
1091919807 12:4295085-4295107 TGCCCTTCCCAAGTCCAAAAAGG + Intronic
1092302808 12:7268299-7268321 TCCCCAGCCAGAATGGAAAACGG + Intergenic
1097934041 12:65225340-65225362 TCCCCACACAAAGTCTACAAAGG - Intronic
1099757614 12:86874216-86874238 TCCCCAGCAACAGTGTAAAAGGG + Intergenic
1099847926 12:88052946-88052968 TCCCCAGCAGAAGTCCAACAAGG - Intronic
1103825382 12:123733665-123733687 TTCCCAGGTAAAGTCCAACAAGG - Intronic
1107641769 13:42451375-42451397 TCCAAAGCCAATGTCCAGAATGG - Intergenic
1109052493 13:57502190-57502212 TCACCAGCCAAATTCCTAATAGG + Intergenic
1111164609 13:84442764-84442786 GCCTCGGCCAATGTCCAAAAGGG + Intergenic
1112714337 13:102166452-102166474 TTCCCAGCTGAAGTCCAACATGG + Intronic
1113895807 13:113764056-113764078 TCCCCATCCAAAGACAAGAAAGG + Intronic
1115759288 14:36561884-36561906 TACTCAGCCAAAGTCTCAAAGGG - Intergenic
1115765179 14:36615849-36615871 TCCCCACCCAAAGTGTACAAGGG - Intergenic
1117486971 14:56207710-56207732 GCACCAGCTAAAGGCCAAAAGGG + Intronic
1117687033 14:58263977-58263999 TCCCCAGCCACAGGCCACATGGG - Intronic
1117846085 14:59913212-59913234 TCCACAGCTAAAGACCTAAAGGG - Intergenic
1118329382 14:64803765-64803787 CCCCCAGCCAAAGCCCACCAAGG - Exonic
1121142307 14:91554498-91554520 TACCCAGCCAAGGACCAAGATGG + Intergenic
1122517883 14:102321160-102321182 ACCCAGACCAAAGTCCAAAAAGG - Intronic
1124835741 15:33194694-33194716 TCCAGAGCCAAAGCCCAAAGGGG + Exonic
1127684785 15:61332624-61332646 CCCCCAACAAAAGACCAAAAAGG - Intergenic
1127979682 15:64025387-64025409 ACCCCAGCCACACTCCAAAGAGG + Intronic
1128307627 15:66610400-66610422 TCCCATCCCAAACTCCAAAAAGG + Intronic
1129084876 15:73078480-73078502 TTCCCAGCCCCAGTCCACAAAGG + Intronic
1130845415 15:87739579-87739601 GCCCTAGCCCCAGTCCAAAAAGG + Intergenic
1135120701 16:19764028-19764050 TGACCAGCCAAAATCCAAAGAGG + Exonic
1137591915 16:49698974-49698996 TCCCCAGACAGAGTCCCCAAAGG + Intronic
1139547728 16:67657477-67657499 TCCCCAGCCACAGACCAAAGAGG + Exonic
1149001437 17:51761809-51761831 TCCACAACCAAAATCCAAACAGG + Intronic
1149026034 17:52028547-52028569 TCCACAGCCAAAATCTCAAATGG - Intronic
1157606025 18:48926482-48926504 TCCTCTGCCAAAGTCCAACAGGG + Intronic
1157657489 18:49405316-49405338 CCCACAGCCAATGTCCAGAATGG + Intronic
1161727472 19:5938328-5938350 TCTCCAGTGAAAGACCAAAAAGG + Intronic
1168436017 19:56317528-56317550 TCCCCAGCCAGATTCCACAGAGG + Intronic
927890124 2:26742911-26742933 TCCCCAGCCAGCCTCAAAAAGGG + Intergenic
927909137 2:26884221-26884243 TCCCCAGCTAAAGCCCCAATCGG + Intronic
928141153 2:28730499-28730521 ACCCCAGACAAAGACCCAAAAGG + Intergenic
929406869 2:41652391-41652413 TCTCCAACTAAAGTCCCAAATGG - Intergenic
930940631 2:57009957-57009979 TTCCCAGCTGAAGTCCAAGAAGG - Intergenic
933560321 2:83878678-83878700 TCCCCAGGGGAAGTCCAAATCGG - Intergenic
935720883 2:105978176-105978198 TCCTCAGCAGAAATCCAAAATGG + Intergenic
938420950 2:131146277-131146299 TGCCCAACAAAAGCCCAAAAAGG - Intronic
939424721 2:142020105-142020127 TCCCCATCAAAATTGCAAAAGGG + Intronic
940242240 2:151575784-151575806 TCCACAGCCAAAGTACAGAGAGG - Exonic
943271767 2:185814331-185814353 TTACCAGCCAAAATACAAAAGGG - Intronic
944354503 2:198770134-198770156 TTCCCACCAAAAGTTCAAAATGG - Intergenic
944360921 2:198855419-198855441 ACCAAAGCCAAAGTCCAGAATGG - Intergenic
948909081 2:240994051-240994073 TCCCCAGCCACGGTCCAGCAGGG + Intergenic
1169201578 20:3712786-3712808 TCCCCAGGCAAAGTGAGAAATGG + Intergenic
1169907543 20:10618612-10618634 TGGCCATCCAAAGTCCAGAATGG - Intronic
1171395856 20:24832681-24832703 TCCCAAGCCATAGTCCCATAGGG - Intergenic
1175321951 20:58094488-58094510 TCCCCAGCCACAGCCTAGAAGGG + Intergenic
1177550781 21:22619550-22619572 TCCCCAGCCAATGTGGTAAAAGG - Intergenic
1177873974 21:26609157-26609179 TTCCCATCCTAAGTCCCAAATGG + Intergenic
1177877264 21:26649131-26649153 TTCCCTGCCATAGTCCAGAAAGG - Intergenic
1182925956 22:34125466-34125488 TGCCTAACCAAAGTCCAAGATGG + Intergenic
951223563 3:20095029-20095051 TCCCCACCCAACGTTAAAAATGG - Intronic
951714939 3:25631908-25631930 TCCCCACCAAAATTCCAAAGAGG + Intronic
952190715 3:31020418-31020440 TCACCAGGTAAACTCCAAAAAGG + Intergenic
952586657 3:34901023-34901045 GCCCCTGCCAACTTCCAAAATGG + Intergenic
955045066 3:55351963-55351985 ACCCCAGCCAAGATCCAAAAAGG - Intergenic
957313018 3:78543669-78543691 TCCCTAGCCAAAGACTAAAGAGG + Intergenic
958058344 3:88443609-88443631 TCCAGAGGGAAAGTCCAAAAAGG + Intergenic
958863978 3:99479157-99479179 GCCACAGCTAAAGTGCAAAATGG - Intergenic
960158775 3:114326236-114326258 TTCCCAGCCTTATTCCAAAAAGG + Intergenic
960204069 3:114873767-114873789 TTTCCAGCCAAATTCCCAAAGGG + Intronic
960210421 3:114958227-114958249 TCTCCAGGCAAAATCCAATAAGG + Intronic
961467741 3:127091711-127091733 TCCCAAACCAAGGTCCTAAAAGG - Intergenic
961832624 3:129632035-129632057 TCCCCAGCCACAGACCATAGAGG - Intergenic
963062519 3:141235904-141235926 TCCCCAGCCAAAGTCCAAAAAGG - Intronic
963250139 3:143095554-143095576 TCAACACCCAAAGTCCAGAAGGG - Intergenic
967311686 3:188112047-188112069 TGCCCAGCCAAAATCCAGTATGG - Intergenic
969590090 4:8117066-8117088 TCCACAGCCAAAGTCCCAAGAGG + Intronic
971560136 4:28068815-28068837 TCCCATGGCAAAGTGCAAAAGGG + Intergenic
971921698 4:32948720-32948742 TCCTGAGCCAATGTCTAAAAGGG - Intergenic
975910222 4:79258531-79258553 TCAGCACCCAAAGTCCAGAAGGG - Intronic
976132182 4:81896380-81896402 TCCCCAGCCCAGATCCAAGAAGG + Intronic
978135299 4:105250532-105250554 ACCCCAGTCAAAGTCCCAGAAGG - Intronic
979480532 4:121211392-121211414 TCCCAAGCCAAAGCCTACAAGGG + Intronic
980336138 4:131475968-131475990 TCCTCAGCCAATGTAAAAAATGG + Intergenic
981417924 4:144514915-144514937 TTCTCAGCAAAATTCCAAAATGG - Intergenic
982260409 4:153489222-153489244 TCACCAGCCCAATACCAAAAAGG - Intronic
982339133 4:154276015-154276037 TCCTCTGACAAAGTCCAAATTGG + Intronic
985354426 4:189102630-189102652 TTCACAGCTAACGTCCAAAATGG - Intergenic
986047689 5:4055778-4055800 TCCTAAGCCAAAGTCTAAAAGGG + Intergenic
987354980 5:17055865-17055887 CCCCCAGCTAAACTCCAGAAGGG + Intergenic
987425939 5:17772647-17772669 CCTCCAGCCAAAGACCAAGATGG - Intergenic
989515486 5:42337793-42337815 TCTCCAGCAAAAGTTCAATACGG + Intergenic
992422722 5:76622668-76622690 TCCCCACTTAAAGTCAAAAAAGG + Intronic
993490131 5:88536867-88536889 TCTCAAGCCAAAGTCTAAAGAGG + Intergenic
994282202 5:97919119-97919141 TTCCCAGACAAAGTTGAAAATGG - Intergenic
994998422 5:107094918-107094940 TCCCCAGCAAAGGCCCTAAATGG - Intergenic
995723045 5:115156736-115156758 GCCTAAGCCAAAGTCCACAATGG - Intronic
996517473 5:124388241-124388263 GCCTAAGTCAAAGTCCAAAAGGG + Intergenic
1000126267 5:158246827-158246849 TCACCAGCCAAATTCAAAATGGG - Intergenic
1002412105 5:179089149-179089171 TCCCCAGGCATATTTCAAAATGG + Intergenic
1006875870 6:37295728-37295750 TCCCCAGCCAAAGTTCCACATGG + Intronic
1007100067 6:39239912-39239934 TCCCGAGCCAATGTCCAAGAAGG + Intergenic
1007466078 6:42052208-42052230 TCCCCAACAAAAGTCCTTAAGGG - Intronic
1008974337 6:57407205-57407227 TGCCCCGCCAAAATCCAAAAAGG - Intronic
1009163226 6:60308718-60308740 TGCCCCGCCAAAATCCAAAGAGG - Intergenic
1011169047 6:84484080-84484102 GCCGAAGCCAAAGTCTAAAAGGG - Intergenic
1013108025 6:107042634-107042656 TCCCCAGCCTCAGTACAAACTGG + Intronic
1014488396 6:122030356-122030378 TCTCCAGCCAAATTCTAATAGGG - Intergenic
1015317613 6:131834396-131834418 TCCCCAGGCAAAGCAGAAAAGGG - Intronic
1015863690 6:137706477-137706499 ACCACAGACAAAGTCCAACAAGG - Intergenic
1017394470 6:153980735-153980757 CCCAAGGCCAAAGTCCAAAATGG + Intergenic
1017544676 6:155438285-155438307 TGCCCATCCCAAGTACAAAAAGG + Intronic
1017567554 6:155704221-155704243 CCCAAGGCCAAAGTCCAAAATGG - Intergenic
1021680772 7:23129086-23129108 TCCACAGCCAAGGTCCCAGATGG - Intronic
1022452995 7:30533349-30533371 TCCCAAGCTAAGGTCAAAAAAGG + Intronic
1022806953 7:33831952-33831974 TCCCCAGCCAAAGCAGAAAGAGG + Intergenic
1025458568 7:60573462-60573484 TCCCCTGCCAAATTCACAAAAGG - Intergenic
1025806672 7:64839473-64839495 TCCCCAGGGGAAGTCCAAATCGG - Intergenic
1031299169 7:120042570-120042592 GCTCCAGCCATAGTCGAAAAGGG + Intergenic
1032621866 7:133542417-133542439 TCCCCTGCCCAATTCCAGAAAGG - Intronic
1034734201 7:153413467-153413489 TCCCCAGGGGAAGTCCAAATCGG - Intergenic
1037812671 8:22096247-22096269 TCTCCTGCCAAAGCCCAGAAAGG - Intronic
1038347371 8:26744783-26744805 TCACCAGTCAACCTCCAAAAAGG - Intergenic
1038538720 8:28373593-28373615 TTCCCATCCAGAGTCCACAACGG + Intronic
1039680373 8:39728971-39728993 TTCCCACCAACAGTCCAAAAGGG + Intronic
1041965145 8:63667625-63667647 TCCCCACACAGAGTCCCAAATGG + Intergenic
1043324068 8:79027951-79027973 TCGCCAGCCAAAATCTGAAAGGG + Intergenic
1045043741 8:98254060-98254082 TAGCCAGCAAAACTCCAAAAAGG + Exonic
1045365761 8:101474405-101474427 GCCCCAGGCAAAATGCAAAATGG - Intergenic
1045610643 8:103837333-103837355 TCCCCAGCTAAAAGCCAATAAGG - Intronic
1046140366 8:110083310-110083332 TCAGCATCCAAAGTCCAAAGGGG - Intergenic
1049165784 8:141125043-141125065 TCCCCAACAACAGTCCACAAGGG + Intronic
1049864620 8:144926101-144926123 TCCCCAGTCAAAATCCAAATAGG - Intergenic
1049917846 9:335960-335982 TCTCCACCCAAATCCCAAAAGGG + Intronic
1056927682 9:90848721-90848743 TCCCTTCCCAAAGTCCAGAATGG - Intronic
1057300413 9:93875997-93876019 TGCCCTGCAAAAGTACAAAAAGG + Intergenic
1058216242 9:102237526-102237548 TCCTCAGCCAAAAGACAAAATGG + Intergenic
1059224099 9:112655656-112655678 TCTCCAGCCAAAGTTGAAAATGG - Intronic
1186196308 X:7113158-7113180 TCCCCAGCCAGAGTCAACATTGG - Intronic
1187395737 X:18917589-18917611 TACCCAGCCAAACTCTCAAATGG + Intronic
1187528529 X:20075504-20075526 TCCCCAGAAACAGTCCAACATGG - Intronic
1188241939 X:27803391-27803413 TGCCCAGCCAAAGATCACAAAGG + Intergenic
1188608674 X:32068431-32068453 TCCCAAGCCAATGTCCAGAATGG + Intronic
1189874581 X:45422334-45422356 TCCCAACCCAATGTCCAAAATGG - Intergenic
1193054094 X:77131604-77131626 TACCCAGCCAAAGAAAAAAAAGG + Intergenic
1199722683 X:150553454-150553476 TCCCTAGCAAAAGCACAAAATGG - Intergenic