ID: 963063464

View in Genome Browser
Species Human (GRCh38)
Location 3:141243231-141243253
Sequence ACAAGGACCCAGGAGGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963063456_963063464 3 Left 963063456 3:141243205-141243227 CCCACCAGTTGTATGATGATACA 0: 1
1: 0
2: 0
3: 6
4: 76
Right 963063464 3:141243231-141243253 ACAAGGACCCAGGAGGTTGGAGG 0: 1
1: 0
2: 2
3: 38
4: 306
963063457_963063464 2 Left 963063457 3:141243206-141243228 CCACCAGTTGTATGATGATACAG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 963063464 3:141243231-141243253 ACAAGGACCCAGGAGGTTGGAGG 0: 1
1: 0
2: 2
3: 38
4: 306
963063458_963063464 -1 Left 963063458 3:141243209-141243231 CCAGTTGTATGATGATACAGCCA 0: 1
1: 0
2: 1
3: 7
4: 63
Right 963063464 3:141243231-141243253 ACAAGGACCCAGGAGGTTGGAGG 0: 1
1: 0
2: 2
3: 38
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963063464 Original CRISPR ACAAGGACCCAGGAGGTTGG AGG Intronic
900347438 1:2216422-2216444 ACAAGGACCTTGGAGGCTGAGGG - Intergenic
901139129 1:7016750-7016772 ACTTGAACCCAGGAGGTTGGAGG + Intronic
901284043 1:8062354-8062376 ACTTGAACCCAGGAGGTGGGAGG - Intergenic
901665320 1:10822982-10823004 ACTAGGACCGATGGGGTTGGGGG - Intergenic
903522524 1:23961785-23961807 ACAGGGACCCAGTGGCTTGGTGG - Exonic
904080615 1:27870171-27870193 AGCCTGACCCAGGAGGTTGGGGG + Intergenic
905029375 1:34871342-34871364 ACAAGGAGCCAGGAGGAGGAAGG - Intronic
907374234 1:54022424-54022446 CCAAGGGCCCAGCAGGGTGGAGG - Intergenic
908159008 1:61387607-61387629 ACAAGGCCAGATGAGGTTGGTGG - Intronic
908553429 1:65232943-65232965 ACATGAACCCAGGAGGTTGAGGG - Intergenic
910254690 1:85236135-85236157 TCAAGGACCCAGGTGAATGGGGG + Intergenic
911405032 1:97426460-97426482 GCAAGGACCCATGAGGCTGAAGG + Intronic
913342935 1:117778157-117778179 ACAGGGACCCAGTGGCTTGGTGG + Intergenic
914456783 1:147843864-147843886 AGAAGGACCCAGGAGGAAGTTGG + Intergenic
915105017 1:153528401-153528423 ACTTGAACCCAGGAGGTTGGAGG + Intergenic
915594474 1:156888292-156888314 ACTAAGACCCAGGAGGGTGAGGG + Intergenic
916963007 1:169907993-169908015 ACAAGAAGCCAGGTGATTGGTGG + Intergenic
917825418 1:178815161-178815183 ACATGAACCCAGGAGGTGGAGGG - Intronic
918748327 1:188236474-188236496 AGAAAGACCCAGGAATTTGGTGG + Intergenic
918778164 1:188665286-188665308 GCAAGGACACTGGAGGATGGTGG - Intergenic
919392349 1:197003077-197003099 CCATGGACTGAGGAGGTTGGGGG + Intronic
919728274 1:200897567-200897589 CCAAGAACCCAGGAGGTGTGAGG - Intronic
922757652 1:228105483-228105505 AGCTGGACCCAGGAGGGTGGCGG + Intergenic
923563168 1:235057122-235057144 GCAGGGACCCAGGTGGTTGGAGG - Intergenic
924440541 1:244082105-244082127 TCAAGGACCCCAGAGGGTGGAGG + Intergenic
924751568 1:246897228-246897250 ACCTGAACCCAGGAGGTTGGAGG + Intronic
1063060625 10:2547741-2547763 ACAGGAAGCCAGGAGGGTGGAGG - Intergenic
1063444963 10:6107258-6107280 GCTAGAACCCAGGAGGTTGCAGG - Intronic
1063888803 10:10607871-10607893 ACTTGAACCCAGGAGGTGGGAGG + Intergenic
1065184380 10:23157757-23157779 ATAAGCACCCAGGAGCTTTGGGG + Intergenic
1066006559 10:31151290-31151312 ACAAGGACAGAGAAAGTTGGAGG - Intergenic
1067795529 10:49318741-49318763 GCAAGGTTCCAGGAGGTTAGGGG - Intronic
1068519756 10:58065168-58065190 AGAATCACCCAGGAGGTTGGGGG - Intergenic
1068808070 10:61223128-61223150 AAAAAGACCCAGGAGATTGAAGG + Intergenic
1070128592 10:73641223-73641245 AGAGGGGCCCAGGAGGTTGGGGG - Intronic
1070277284 10:75018905-75018927 AAACGTACCCAGGAGGCTGGGGG - Intronic
1070288285 10:75099292-75099314 ACAGGCACCCAGGAGGCTGCCGG + Intronic
1070747565 10:78943765-78943787 CCAAGGATGGAGGAGGTTGGTGG + Intergenic
1073286052 10:102389135-102389157 GCAAGGACCTAGGAGGAAGGAGG - Intergenic
1073467749 10:103704238-103704260 AGAAGGAGCCAGGAAGGTGGGGG + Intronic
1074561500 10:114539273-114539295 ACTTGAACCCAGGAGGTGGGGGG + Intronic
1074587289 10:114780572-114780594 CCAAGGAATCAGGGGGTTGGGGG - Intergenic
1074625401 10:115178494-115178516 AAAAGGACACAGGAGCTTAGAGG - Intronic
1076224903 10:128766171-128766193 ACAAGGACCCAGCAGTGTGCTGG + Intergenic
1077237865 11:1490820-1490842 ACTTGAGCCCAGGAGGTTGGTGG + Intronic
1077261796 11:1625868-1625890 CCACGGACCCAGGGGGTGGGTGG - Intergenic
1077333799 11:1994581-1994603 ACAAGGAGCCAGGGGGTTGTGGG - Intergenic
1077499781 11:2903913-2903935 ACAAGGACCCAAGAAGATGGAGG - Intronic
1078279203 11:9882722-9882744 ACTTGTACCCAGGAGGGTGGAGG + Intronic
1078922191 11:15841201-15841223 ACAAGGACCCACAAGGACGGAGG - Intergenic
1079161165 11:17995422-17995444 ACAAGTACCCCGGTGCTTGGTGG + Intronic
1079434054 11:20427640-20427662 GCTTGAACCCAGGAGGTTGGAGG + Intronic
1081030018 11:38068129-38068151 AAAAGGATCAAGGAGATTGGTGG - Intergenic
1081906466 11:46673515-46673537 ACAAGTACCCAGGCAGTTGGGGG - Intronic
1083633108 11:64105783-64105805 CCAAGGCCCCAGGAGGTGGGCGG + Intronic
1084117468 11:67050466-67050488 ACAAGGGCCCAGGGGACTGGAGG + Exonic
1084209001 11:67612307-67612329 TCAAGGGCCCAGGGTGTTGGGGG + Intronic
1084666045 11:70576894-70576916 ACAAGGACACAGCAGGCAGGTGG + Intronic
1084973290 11:72782733-72782755 ACTAGGACCCAGGGGGCAGGGGG - Intronic
1086573796 11:88314953-88314975 ACAAAGACCCAGGACATTGTTGG + Intronic
1088880613 11:113970734-113970756 CCAAGGACCCAGGGCCTTGGTGG + Intergenic
1089389544 11:118091227-118091249 ATAAGGAGAGAGGAGGTTGGTGG - Intronic
1202816780 11_KI270721v1_random:49763-49785 ACAAGGAGCCAGGGGGTTGGGGG - Intergenic
1094011202 12:25811737-25811759 AGAAGCAACCAGGAAGTTGGAGG - Intergenic
1094813332 12:34162701-34162723 ACAAGGGCCCAGGAGGGAGCAGG - Intergenic
1095766564 12:45901742-45901764 ACTTGAGCCCAGGAGGTTGGAGG - Intronic
1096809593 12:54161056-54161078 ACAAGGACAGTGGAGGCTGGTGG - Intergenic
1097760254 12:63456708-63456730 ACAAGGACCCAGAAGGAGAGGGG + Intergenic
1097876832 12:64651440-64651462 ACTTGAACCCGGGAGGTTGGAGG - Intronic
1098928059 12:76375334-76375356 ACAATGACACTGGAGCTTGGTGG - Exonic
1099347634 12:81522950-81522972 TCAAGGACCCAGGCTGATGGAGG + Intronic
1102865446 12:116370530-116370552 ACTTGAACCCAGGAGGGTGGAGG - Intergenic
1103059504 12:117847442-117847464 GCAAGCTCCCAGGAGGTTGCAGG + Intronic
1103178449 12:118886080-118886102 ACCAGGAACCAAGAGGGTGGTGG + Intergenic
1103210534 12:119162885-119162907 ACAGGGTCCCAGGATGCTGGAGG - Exonic
1105288882 13:19033222-19033244 AACAGCACCCAGGAGGTGGGAGG + Intergenic
1106370322 13:29126534-29126556 GCATGGAGCCAGGAGGTTGCAGG - Intronic
1107113041 13:36718326-36718348 AAAAGGCCACAGGAGGCTGGTGG + Intergenic
1107282976 13:38757556-38757578 ACAAAGACCCAGGACGTAGAGGG - Intronic
1111018527 13:82414545-82414567 CAAAGAACCTAGGAGGTTGGAGG - Intergenic
1111191051 13:84806598-84806620 AGTAGGGCCCAGGAGGTTGAGGG + Intergenic
1113178330 13:107594460-107594482 ACAGGGACACAGGGGATTGGGGG - Intronic
1113275377 13:108722782-108722804 ACAAGGACACAGAAGGTGAGTGG - Intronic
1113335538 13:109372839-109372861 AGCAGGAGCCAGGAGGCTGGAGG - Intergenic
1113481976 13:110627919-110627941 ACAACGGCCCAGGAGGCTGAGGG - Intronic
1117961046 14:61161886-61161908 ACAAAAACCCAGGAGGTTTCTGG - Intergenic
1118537039 14:66778816-66778838 ACTTGAACCCAGGAGGTTGGAGG - Intronic
1119228199 14:72960230-72960252 ACTAGAACCCAGGAGGTGGAGGG - Intergenic
1119620822 14:76130813-76130835 TGAAGGACCCAGAAGGTGGGTGG - Intergenic
1119656147 14:76418696-76418718 ACTTGAACCCAGGAGGTGGGAGG - Intronic
1120989578 14:90363247-90363269 AGAAGCACACAGGAGGTGGGAGG + Intergenic
1121529307 14:94641302-94641324 CCAAGGACCCCAGAGGATGGAGG + Intergenic
1121899602 14:97681829-97681851 ACAAGAACCCTGTAGGATGGAGG + Intergenic
1123854186 15:24390438-24390460 AAAAGGAACCAGGAATTTGGGGG - Intergenic
1123890025 15:24768359-24768381 AAATGGACCCAGGAGGTGGGAGG + Intergenic
1124856979 15:33398729-33398751 GGAAGGGACCAGGAGGTTGGGGG + Intronic
1125547027 15:40513351-40513373 AGGAGGACCCAGGAGGATGCAGG - Intergenic
1126099431 15:45110866-45110888 ACAAGGAACCAGGGGATTTGAGG + Intronic
1126104098 15:45136171-45136193 ACAAGGAACCAGGGGATTTGAGG - Intronic
1126681566 15:51207147-51207169 ACAGAGTCCCAGGAGGTTTGGGG - Intergenic
1126872230 15:53002110-53002132 GGTAGGACCTAGGAGGTTGGAGG + Intergenic
1127269725 15:57389896-57389918 GCTTGGACCCAGGAGGTGGGAGG - Intronic
1128383947 15:67133951-67133973 ACAAGCACCCAGGAGAGAGGGGG - Intronic
1129624811 15:77185702-77185724 AGAAGGAGCTAGGAGGATGGGGG + Intronic
1130879561 15:88043451-88043473 AAAAGTCCCCAGGAAGTTGGGGG - Intronic
1132232091 15:100191886-100191908 CCAAGGCACCAGGAGGTTTGTGG + Intronic
1132393444 15:101455412-101455434 ACAAGGACACAGGAAGGAGGTGG + Intronic
1132932158 16:2464312-2464334 CCCAGGACCCAGGAGGATGGGGG + Intronic
1133264405 16:4574832-4574854 CCCAGGACCCGGGAGGTTGGGGG - Intronic
1133300715 16:4780893-4780915 ACCTGAACCCAGGAGGTTGGAGG + Intronic
1134307132 16:13043107-13043129 TCAAGGACCCAGGATGATGGAGG + Intronic
1134395796 16:13861932-13861954 ACAAAGACTCAGCAGGGTGGGGG + Intergenic
1135231441 16:20711856-20711878 ACTAGGAAGCAGGAGGATGGAGG - Intronic
1136103774 16:28014137-28014159 ACAGGGACCTAGGAGTTTGGAGG + Intronic
1136136160 16:28258243-28258265 AGGAGGACCCAGGAAGTTGAGGG + Intergenic
1136187721 16:28597842-28597864 ACAAAGAACGAGGAGGGTGGGGG - Intergenic
1136316669 16:29458453-29458475 ACAAAGACCAAGGAGGATGGGGG + Intergenic
1136431245 16:30197795-30197817 ACAAAGACCAAGGAGGATGGGGG + Intronic
1137251503 16:46744422-46744444 GCTTGAACCCAGGAGGTTGGAGG - Intronic
1138445252 16:57059342-57059364 ACAAGGACAAGGGAGGATGGAGG - Intronic
1141469570 16:84229213-84229235 ACTTGAACCCAGGAGGTTGGAGG + Intronic
1141884146 16:86880288-86880310 ACAAGGCCCCAGGAAGGTGCAGG - Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1143916460 17:10296969-10296991 ACCTGGCCCCAGGAGGTAGGTGG - Intergenic
1144304604 17:13956616-13956638 ACCAGAACCCAGGAGGTGGAAGG + Intergenic
1145717748 17:27038751-27038773 AACAGCACCCAGGAGGTGGGAGG + Intergenic
1145880981 17:28352619-28352641 ACTTGAACCCAGGAGGGTGGAGG - Intronic
1146265576 17:31450605-31450627 AAAGGGACCCAGGAGGAGGGCGG - Intronic
1146277076 17:31522869-31522891 GCAAGGGCCCAGGAGCTAGGTGG + Intronic
1147636874 17:41969344-41969366 ACATGGACCCAGGAGGGATGTGG + Intronic
1148244560 17:46021932-46021954 AAAGGAACCCAGGAGGCTGGTGG - Intronic
1148546010 17:48519532-48519554 ACTTGAATCCAGGAGGTTGGAGG + Intergenic
1150905789 17:69335564-69335586 ACAAGGAGCTTGGAGGGTGGAGG - Intergenic
1151659047 17:75509112-75509134 ACAAGGACTCTGCAGGTTGGTGG + Intronic
1151681097 17:75623239-75623261 GCTAGAACCCAGGAGGGTGGAGG + Intergenic
1151694788 17:75708881-75708903 ATAAGTACACAGGTGGTTGGGGG + Intergenic
1151733120 17:75922636-75922658 ACAAGGGGCCAGCAGGCTGGGGG - Intronic
1151918358 17:77135617-77135639 ACTTGAACCCAGGAGGTTGAGGG - Intronic
1152590398 17:81208812-81208834 CCCGGGACCCAGGAGGCTGGAGG + Intronic
1153024508 18:660358-660380 AGAAACACCAAGGAGGTTGGGGG - Intronic
1155529864 18:26756197-26756219 AAGAGGAGCCAGGAAGTTGGGGG - Intergenic
1157625277 18:49045695-49045717 ACAAGGAGCCAGAAGGGAGGAGG + Intronic
1158768799 18:60489560-60489582 ACATGGTGACAGGAGGTTGGGGG + Intergenic
1160769561 19:824293-824315 ACTTGAACCCAGGAGGTGGGAGG - Intergenic
1161291246 19:3494422-3494444 CCAAGAACCCAGGAGGTCGGGGG + Intronic
1161378988 19:3954647-3954669 ACTTGAACCCGGGAGGTTGGAGG - Intergenic
1161607057 19:5220968-5220990 ACAAGGAACCCGGAGCATGGGGG + Intronic
1162411859 19:10510988-10511010 ACTTGAACCCAGGAGGCTGGAGG - Intergenic
1162525343 19:11203377-11203399 ACCAGGACCCTGGGGGTTGAGGG - Intronic
1163147706 19:15392411-15392433 ACCTGAGCCCAGGAGGTTGGAGG + Intronic
1164966293 19:32487573-32487595 ACAAGGACCCAGGTGCCAGGAGG + Intergenic
1165037341 19:33043158-33043180 TGAAGAGCCCAGGAGGTTGGGGG + Intronic
1167089277 19:47332263-47332285 GCCAGGACCCAGGAGGTCTGGGG - Exonic
1167552330 19:50169740-50169762 ACAGAGACCCAGAGGGTTGGGGG - Intergenic
1167739079 19:51312906-51312928 GCAAGGAGGCAGGAGGCTGGAGG + Intronic
1168435818 19:56315946-56315968 ACAAAGACCCTGGAGGAAGGTGG - Intronic
924983547 2:246474-246496 ACAAGGAGCCAGAGGGTTGTGGG + Intronic
925333132 2:3074269-3074291 CCCAGGACACAGGAGCTTGGAGG + Intergenic
926227629 2:10979437-10979459 AAAGGGACCCAGAAGGTTAGAGG + Intergenic
926267454 2:11337714-11337736 ACCTGAACCCAGGAGGTGGGAGG - Intronic
926602805 2:14864232-14864254 ACTTGCACCCAGGAGGTAGGAGG + Intergenic
926786039 2:16519356-16519378 ACAAGGACCCTGGATGGTTGGGG + Intergenic
927991874 2:27453813-27453835 CCAAGGACCCAGGAGTCTGTGGG - Intronic
929612204 2:43279244-43279266 ACATGAACCCAGGAGGGAGGAGG - Intronic
931703884 2:64931034-64931056 AGAGGGCTCCAGGAGGTTGGAGG + Intergenic
932279896 2:70481507-70481529 ACAAAGACCCAGAGGTTTGGTGG - Intronic
932527123 2:72482483-72482505 ACAGTGAGCCAAGAGGTTGGGGG + Intronic
933707982 2:85305565-85305587 ACAGGGACCCAGAAGGTCAGAGG - Intronic
935629008 2:105196718-105196740 TTAAGGACACAGGAGGCTGGGGG - Intergenic
935707530 2:105870020-105870042 ACAAGGACCCATGTGGTGGTCGG + Intronic
935820956 2:106892431-106892453 ACTTGAACCCAGGAGGTGGGAGG - Intergenic
936819399 2:116500482-116500504 ACAAGGACACAGCAGGAAGGTGG - Intergenic
937006380 2:118520381-118520403 ACTAGGAGCCAGGAGTCTGGTGG + Intergenic
941227673 2:162868705-162868727 ACAAGGTCACAGGAGGGTAGAGG + Intergenic
942206741 2:173626586-173626608 AAAAGGTCCCTGGAGGTTGGCGG - Intergenic
942944410 2:181657127-181657149 GCAGGGACCCAGGAGGGAGGCGG + Intronic
944321933 2:198356146-198356168 ACATGGAGCCTGGAGGTTGGAGG + Intronic
946477797 2:220025376-220025398 ACTAGAACCCAGGTGTTTGGAGG + Intergenic
948076635 2:235169970-235169992 TCAAGGGCCCAGCAGGTTGGAGG - Intergenic
1169020638 20:2328351-2328373 ACAAGTACCCAGAAGGTAGGAGG + Exonic
1170152844 20:13243278-13243300 TCAGGGACCCAGGATGATGGAGG + Intronic
1171219129 20:23378239-23378261 ACCTGAACCCAGGAGGTTGAGGG + Intronic
1172626439 20:36350153-36350175 ACAGGGACCCAGAAGGCTGGCGG + Intronic
1172712267 20:36934739-36934761 ACTTGAACCCAGGAGGTTGGTGG - Intronic
1172933766 20:38604193-38604215 ACAAGGAACCAGGAGATTAAGGG - Intronic
1174438510 20:50529674-50529696 ACAAAGATCCAGGAGATGGGGGG - Intronic
1175885423 20:62287923-62287945 ACGAGGTCCCAGGAGGGAGGCGG + Intronic
1175929924 20:62489046-62489068 ACAAGCCCCCAGAAGGCTGGGGG + Intergenic
1175996073 20:62812891-62812913 ACGGGGACCCAGGAAGTGGGCGG + Exonic
1176803644 21:13458531-13458553 AACAGCACCCAGGAGGTGGGAGG + Intergenic
1177107202 21:16974611-16974633 ATAAGGATCCAGCAGGTTGGTGG + Intergenic
1178579931 21:33829708-33829730 AAAAGAACCCAGGTGGATGGTGG + Exonic
1178946317 21:36950900-36950922 ACAAGGGCCCAGAAGGTGGAAGG - Intronic
1179058351 21:37956426-37956448 ACATGGACGCATGGGGTTGGGGG + Intronic
1179191942 21:39130660-39130682 TCTAGGAGCCAGGAGGTGGGAGG + Intergenic
1179948342 21:44695552-44695574 ACAAGGGACCAGGAACTTGGAGG - Intronic
1179975865 21:44865792-44865814 AGAAGGTCCCAGCAGGTTTGTGG - Intronic
1180163672 21:46009283-46009305 ACAGGGACCCAGGGGGTCTGAGG + Intergenic
1182081741 22:27534088-27534110 TCATGCACCCAGGAGGTTGGGGG + Intergenic
1182835766 22:33340306-33340328 ACAGGGACCCAGGAGACTGATGG + Intronic
1183345674 22:37306322-37306344 GCAAGGACCCAGGAGGTGCAGGG - Intronic
1183523656 22:38310964-38310986 ACAGGGGCCCAGGAGGGTGCTGG + Intronic
1184225230 22:43125863-43125885 ACAAGGACCCTGGAGGCAGCAGG + Intronic
1184296434 22:43528131-43528153 TCCAGGACCCAGGAAGCTGGGGG + Intergenic
1184413711 22:44340085-44340107 ACACGGAGCCAGGAGGCTTGGGG + Intergenic
1184864325 22:47193955-47193977 CCAAGGACCCGGGAGGGTTGGGG - Intergenic
1184897625 22:47420753-47420775 ACAAGGACCCAGGAGGGTGTTGG - Intergenic
1185093038 22:48786528-48786550 GCAAGGTCCCAGGAGGGAGGAGG + Intronic
1185318061 22:50187228-50187250 ACCAGGTCCTGGGAGGTTGGGGG + Intronic
949255202 3:2037410-2037432 ACTTGAACCCGGGAGGTTGGAGG - Intergenic
950113845 3:10438037-10438059 GCAGGGAGCCAGGAGGTTGCAGG + Intronic
950277771 3:11678135-11678157 ACTTGAACCCAGGAGGTGGGAGG - Intronic
950978806 3:17279917-17279939 ACCAGCACCCAGGAGAATGGAGG + Intronic
951313857 3:21164065-21164087 ACAGGGACCCAGGCTGATGGAGG + Intergenic
951464132 3:22983748-22983770 AAAAGAAACCAGAAGGTTGGAGG + Intergenic
951696136 3:25447554-25447576 GCAAGGACCAAGGTGGTTTGGGG - Intronic
951718905 3:25677745-25677767 ACAATGAAGCAGGAGGTTGGAGG + Intergenic
953468263 3:43144193-43144215 ACAAGGATCCTGGAGATTGGTGG + Intergenic
953561464 3:43996232-43996254 GCTAGGACCCTGGAGGTTGTGGG - Intergenic
954701541 3:52453275-52453297 TCAGTGACCCAGGAGGTTGCAGG + Intronic
955694722 3:61624279-61624301 ACAAGGACTCAGAAGGAAGGAGG - Intronic
958079753 3:88731676-88731698 ACAAGGAAACAGCAGTTTGGGGG - Intergenic
959257331 3:104031600-104031622 AGAAAGACCCACCAGGTTGGGGG + Intergenic
962217596 3:133536079-133536101 ACAAGGGCACAGGAAGGTGGTGG - Intergenic
963063464 3:141243231-141243253 ACAAGGACCCAGGAGGTTGGAGG + Intronic
963932603 3:151019666-151019688 TCAAAGACCCAGGCTGTTGGGGG + Intergenic
964389545 3:156183218-156183240 ACAAGGAAACATGAGGTAGGAGG + Intronic
964651439 3:159015821-159015843 AAGAGGAGCCAGGAGCTTGGTGG + Intronic
965762374 3:172093194-172093216 TCAAGGACCCAGGAGTTTAAGGG - Intronic
966211041 3:177453906-177453928 ACTTGAACCCAGGAGGCTGGAGG - Intergenic
966211244 3:177455410-177455432 ACTTGAACCCAGGAGGCTGGAGG + Intergenic
966466851 3:180238656-180238678 ATAAGCACCCAGTAGGTTGAAGG - Intergenic
969668120 4:8573906-8573928 GCCAGGAACCAGGAGGTTGATGG - Intronic
969703733 4:8781198-8781220 ACAAGGTCCCAGGAGGAAGATGG - Intergenic
970370558 4:15401399-15401421 ACCAGGCCCCAGTAGGTTTGTGG - Intronic
970405302 4:15757335-15757357 CAAAGAACCCAGGAGGGTGGAGG + Intergenic
973162603 4:47036777-47036799 ACTTGAACCCAGGAGGCTGGAGG + Intronic
975167973 4:71199731-71199753 ACCTGAACCTAGGAGGTTGGAGG - Intronic
975576758 4:75870998-75871020 GCTGGAACCCAGGAGGTTGGAGG - Intronic
975739696 4:77417776-77417798 AGAGGGACCCAGGAGATTAGTGG - Intronic
976620566 4:87122975-87122997 ACTAGAACCCAGGAGGTGGAGGG - Intronic
978070325 4:104459647-104459669 ACAAGGACGCAGCAGGAGGGAGG - Intergenic
982884727 4:160764545-160764567 ACTTGGACCCGGGAGGTGGGAGG - Intergenic
985000049 4:185473426-185473448 ACCAGGGCGCAGGGGGTTGGGGG + Intergenic
985711433 5:1431808-1431830 ACAGAGACCCAGGAGGCTGCTGG + Intronic
985946702 5:3190914-3190936 ACAAGGAACCAGGGAGATGGGGG - Intergenic
986735503 5:10664815-10664837 AAAAGAACCCAGGTGGATGGTGG - Intergenic
987367988 5:17167080-17167102 ACAGAGAACCTGGAGGTTGGTGG + Intronic
989160971 5:38391479-38391501 ACTTGAACCCAGGAGGTTTGAGG - Intronic
989497603 5:42126880-42126902 TTAAGGACCCAGGATGATGGAGG - Intergenic
990165672 5:52990331-52990353 AAAAGAACTCAGGAGGTGGGCGG - Intronic
992010351 5:72519389-72519411 TCAGGGCCCCAGGAGGTGGGTGG - Intergenic
996197005 5:120621075-120621097 AGAAGGACTCAGGATTTTGGAGG - Intronic
997107627 5:131038765-131038787 ACTTGAACCCAGGAGGTAGGTGG + Intergenic
997264058 5:132484651-132484673 ACAAGGGCCCGGGAGGGAGGAGG + Intronic
998451127 5:142235525-142235547 ACAAGAGCCCAGGAGGGAGGTGG + Intergenic
999756191 5:154666268-154666290 ACAAGGAACAAGGAGGTATGGGG - Intergenic
1000697472 5:164405564-164405586 AAAAGGACACAGAAGTTTGGAGG + Intergenic
1001031337 5:168265561-168265583 AGAAGGACACAGAAGGTGGGTGG + Intergenic
1001043210 5:168351717-168351739 AGAAAGACCAGGGAGGTTGGAGG + Intronic
1001242108 5:170078893-170078915 GCAAGGACCCAGGAAGCTGAAGG - Intronic
1001548149 5:172583355-172583377 ACAAGGACACAGAAGCTAGGAGG - Intergenic
1004037605 6:11938885-11938907 ACAAGGACTCAGGAGATTGTTGG - Intergenic
1004472257 6:15939829-15939851 TCAAGGCCTCAGGAGGGTGGGGG + Intergenic
1004885959 6:20051844-20051866 ACAGAGCACCAGGAGGTTGGGGG + Intergenic
1006303655 6:33207062-33207084 ATAAGAACCCAGGGAGTTGGGGG - Intergenic
1006729117 6:36222375-36222397 CCAAGGGCCCAAGAGTTTGGGGG - Intronic
1008055446 6:46941014-46941036 ACAAGTTCCCAGAATGTTGGGGG - Intronic
1010585241 6:77650562-77650584 ACAGGAACCCAGAAGGTAGGCGG + Intergenic
1011775078 6:90721047-90721069 ACAAGGATCCAGGAAATTTGAGG - Intergenic
1012310539 6:97719057-97719079 ACACCAACCCAGGAGTTTGGTGG - Intergenic
1012461940 6:99473462-99473484 ACTTGAACCCAGGAGGTTGGAGG + Intronic
1012848526 6:104419898-104419920 TCAAGGACCCAGGAGTGTAGAGG + Intergenic
1014400588 6:120985057-120985079 TCATGGACCCAGGAGGTTAATGG - Intergenic
1015128050 6:129776455-129776477 ACTTGGGCCCAGGAGGTTTGAGG - Intergenic
1015500086 6:133922799-133922821 ACTTGAACCCAGGAGGGTGGAGG - Intergenic
1016985275 6:149890273-149890295 ACAGGGATCCAGAAGGTTGAGGG - Intronic
1017987471 6:159456201-159456223 ACCATGACCCAGGAGCTGGGTGG + Intergenic
1019497708 7:1348130-1348152 ACGCGGAGGCAGGAGGTTGGGGG - Intergenic
1019574496 7:1729928-1729950 AGCAGGCCCCAGGAGGTGGGCGG + Intronic
1022854009 7:34297821-34297843 CCAAGGACCCCTGAGGTTGGTGG + Intergenic
1023332324 7:39131426-39131448 ACAAGGGCCGAGGACTTTGGCGG + Intronic
1023499482 7:40832314-40832336 ACAATGACCCTGTAGGATGGAGG - Intronic
1023553052 7:41389343-41389365 ACAAGGTCCCAGGAGCTCAGAGG - Intergenic
1023701236 7:42893432-42893454 GCATGGACTCAGGATGTTGGGGG + Intergenic
1023869842 7:44257269-44257291 ACAGGGGCCATGGAGGTTGGTGG + Intronic
1024537681 7:50451318-50451340 ACAAGAAGACTGGAGGTTGGCGG + Intronic
1025008792 7:55378375-55378397 ACTTGAACCCAGGAGGTAGGAGG + Intronic
1026772817 7:73213004-73213026 GCTTGAACCCAGGAGGTTGGAGG + Intergenic
1027013681 7:74766404-74766426 GCTTGAACCCAGGAGGTTGGAGG + Intergenic
1027074357 7:75179629-75179651 GCTTGAACCCAGGAGGTTGGAGG - Intergenic
1027916761 7:84334634-84334656 ACCAGGAGGCAGCAGGTTGGGGG - Intronic
1029156552 7:98521591-98521613 GCAAGGACCCAGGACTTTGGAGG - Intergenic
1031488226 7:122355496-122355518 ACTTGAACCCGGGAGGTTGGAGG + Intronic
1032524222 7:132567415-132567437 ACTATGACCCAGGATGCTGGAGG + Intronic
1033014836 7:137661518-137661540 AGAAGGACAGAGGAGGTTGCTGG + Intronic
1034958912 7:155352163-155352185 GCGAGGACCCAGGAGGATGCTGG + Intergenic
1035374201 7:158396573-158396595 ACAAGCAGCCAGGATGTTAGAGG + Intronic
1037735467 8:21562388-21562410 AATAGGATCCAGGGGGTTGGGGG - Intergenic
1038491722 8:27976541-27976563 AAGTGGACCCAGGAGGTGGGCGG - Intronic
1039230757 8:35445124-35445146 ACAGGGAGGCAGGAAGTTGGGGG - Intronic
1039910427 8:41822653-41822675 TCAAGGACCCAGGAGACTGCAGG + Intronic
1040386508 8:46918140-46918162 GCAAGGAGCCAGCAGGCTGGCGG + Intergenic
1042556918 8:70041483-70041505 ACTTGGACCCAGGAGGTCGAAGG - Intergenic
1044003773 8:86916951-86916973 ACTAGAACCCAGGAGGTGGAGGG - Intronic
1044368854 8:91384370-91384392 ACAAGGAGACAGGAGGTTCGAGG - Intronic
1044851901 8:96436872-96436894 GCAAATACTCAGGAGGTTGGTGG - Intergenic
1045532697 8:102999559-102999581 ACAAGCACCCAGGTGATTTGGGG + Intergenic
1046987391 8:120403442-120403464 ACATGGACACATGGGGTTGGGGG + Intronic
1047157921 8:122342389-122342411 ACTTGGGCCCAGGAGGTTTGAGG - Intergenic
1049424357 8:142531491-142531513 GGAAGGGCCAAGGAGGTTGGTGG + Intronic
1049512648 8:143037359-143037381 ACAGAGACTCAGGAGGTTCGGGG - Intergenic
1049778645 8:144417601-144417623 CCCAGGACCCAGGAGGAGGGAGG - Intergenic
1052835379 9:33246281-33246303 ACAAGTCCCCAGGAGCTTGAGGG + Intronic
1053174288 9:35910849-35910871 ACAAGGATCCCTGAGGCTGGAGG - Intergenic
1053249755 9:36564610-36564632 GCTTGAACCCAGGAGGTTGGAGG - Intergenic
1055505521 9:76944395-76944417 AGAAGCAACCAGGAGGTGGGAGG - Intergenic
1055505696 9:76946223-76946245 ACTTGAACCCAGAAGGTTGGAGG + Intergenic
1055658415 9:78475434-78475456 ACAAGGACCCAAAAGGAAGGTGG - Intergenic
1056117959 9:83459841-83459863 TCAAGGAGCCAGTAGGATGGGGG + Intronic
1057883757 9:98812506-98812528 ACTTGAACCCAGGAGGCTGGAGG + Intronic
1057928889 9:99176590-99176612 ACAGAGACCCAGCCGGTTGGAGG - Intergenic
1059004624 9:110388165-110388187 ACAGGGACCCAAGAGCTTGTGGG + Intronic
1059616362 9:115955730-115955752 GCTTGAACCCAGGAGGTTGGAGG + Intergenic
1061049116 9:128183649-128183671 ACAAGGAGCCAGGGGGCTGTGGG + Intronic
1061906816 9:133703260-133703282 GCCAGGGCCCAGGAGGCTGGAGG + Intronic
1061924897 9:133801173-133801195 AAGAGGATGCAGGAGGTTGGGGG + Intronic
1061937995 9:133868849-133868871 ACAATGACCCAGGTGGATGCAGG + Intronic
1062067291 9:134535614-134535636 ACATGCACCCAGGAGAATGGGGG + Intergenic
1062474108 9:136719099-136719121 AGAAGGACCAAGGAGGTGGAGGG + Intronic
1062724310 9:138062745-138062767 TCAAGGACCCTGGGGGTTGCTGG + Intronic
1186183595 X:6996748-6996770 ACTTGAACCCAGGAGGTTTGAGG - Intergenic
1188924336 X:36021383-36021405 ACTTGAACCCAGGAGGTTGAGGG - Intergenic
1189309202 X:40008324-40008346 ACAAGCACCCAGGTTGTAGGTGG + Intergenic
1189398985 X:40647528-40647550 ACTTGGAACCAGGAGGTTGCGGG + Exonic
1190800342 X:53782690-53782712 CAAAGGACACAGGAGTTTGGAGG + Intergenic
1191038428 X:56052859-56052881 GCAAGGCCGCAGGAGGCTGGGGG - Intergenic
1192274928 X:69618644-69618666 AAAAGGTCCCAGGAGGTAGTTGG - Intronic
1193170180 X:78327029-78327051 ACAAAGGCACAGGAGGTTTGCGG + Intronic
1195234513 X:102883498-102883520 ACTGGGACCCAGGCAGTTGGTGG - Intergenic
1195387209 X:104324568-104324590 GGAAGTAACCAGGAGGTTGGTGG - Intergenic
1198153199 X:133931489-133931511 AGAAGGACCCAGGAAGGAGGGGG + Intronic
1198833473 X:140776508-140776530 ACGAGGACCCCGGCGGGTGGCGG - Intergenic
1199711514 X:150473067-150473089 TGAAGGGCCCAGGAGGCTGGTGG - Intronic
1200102261 X:153694037-153694059 ACAGGGAGCCAGGAGGGGGGCGG + Intronic
1200781767 Y:7223111-7223133 ACTTGAACCCAGGAGGTTGAGGG - Intergenic
1201023675 Y:9684247-9684269 ACAAGGACTCAGGAATTTGCTGG + Intergenic