ID: 963063860

View in Genome Browser
Species Human (GRCh38)
Location 3:141246948-141246970
Sequence GGACTCTGGTGAGCTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 945
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 903}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963063860_963063867 12 Left 963063860 3:141246948-141246970 CCTGTCTCAGCTCACCAGAGTCC 0: 1
1: 0
2: 1
3: 40
4: 903
Right 963063867 3:141246983-141247005 AGTCCAGTGGCGTTATGTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 49
963063860_963063869 30 Left 963063860 3:141246948-141246970 CCTGTCTCAGCTCACCAGAGTCC 0: 1
1: 0
2: 1
3: 40
4: 903
Right 963063869 3:141247001-141247023 GCTGGCTCCAGCATGCTCCTTGG 0: 1
1: 1
2: 3
3: 27
4: 281
963063860_963063864 -1 Left 963063860 3:141246948-141246970 CCTGTCTCAGCTCACCAGAGTCC 0: 1
1: 0
2: 1
3: 40
4: 903
Right 963063864 3:141246970-141246992 CTCCCAAAAAGGCAGTCCAGTGG 0: 1
1: 0
2: 0
3: 15
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963063860 Original CRISPR GGACTCTGGTGAGCTGAGAC AGG (reversed) Intronic
900118025 1:1036779-1036801 GGACTGTGGGGAGAGGAGACCGG + Intronic
900261978 1:1735957-1735979 GCACTGTGGGGAGCTGAGGCGGG + Intronic
900365381 1:2309871-2309893 GGACCCTGGTGGGCTGAGGGAGG - Exonic
901407173 1:9057043-9057065 GCACTCTGGGGGGCTGAGGCGGG + Intronic
901696414 1:11011426-11011448 GCACTTTGGGGAGCTGAGGCAGG + Intergenic
901842388 1:11962174-11962196 GCACTCTGGGAGGCTGAGACGGG - Intronic
901889303 1:12248589-12248611 GCACTCTGGGAAGCTGAGGCAGG - Intronic
902030758 1:13420453-13420475 GAACTTTGGGAAGCTGAGACGGG - Intronic
902116918 1:14128776-14128798 TGTCTTTGGAGAGCTGAGACTGG + Intergenic
902131203 1:14262165-14262187 GCACTTTGGGAAGCTGAGACAGG + Intergenic
902263133 1:15241986-15242008 GCACTCTGGGAAGCTGAGGCGGG + Intergenic
902689132 1:18098802-18098824 GAGATCTGGTGAGCAGAGACAGG + Intergenic
902891810 1:19449539-19449561 GCACTTTGGGAAGCTGAGACGGG + Intronic
902977567 1:20099964-20099986 GCACTTTGGGGAGCTGAGGCAGG + Intergenic
903379824 1:22888906-22888928 GCACTTTGGGAAGCTGAGACGGG + Intronic
903399455 1:23029884-23029906 GCACTCTGGGGGGCTGAGGCAGG - Intronic
903560992 1:24227285-24227307 GCACTCTGGGAGGCTGAGACAGG + Intergenic
903837628 1:26215832-26215854 GCACTCTGGGAAGCTGAGGCAGG - Intergenic
904175531 1:28625924-28625946 GCACTCTGGTAGGCTGAGGCAGG - Intronic
904185366 1:28699826-28699848 GCACTCTGGGAAGCTGAGGCAGG + Intronic
904967374 1:34386346-34386368 GCACACTGGGGGGCTGAGACAGG + Intergenic
905100153 1:35513366-35513388 GCACTTTGGAAAGCTGAGACAGG + Intronic
905406104 1:37733463-37733485 GCACTTTGGGAAGCTGAGACGGG - Intronic
905738272 1:40346614-40346636 GCACTCTGGGAGGCTGAGACTGG - Intronic
906392617 1:45431997-45432019 GCACTCTGGGAGGCTGAGACAGG + Intronic
906477951 1:46182461-46182483 GCACTCTGGGAAGCTGAGGCGGG + Intronic
906933411 1:50190947-50190969 AGACACAGCTGAGCTGAGACTGG - Intronic
907827182 1:58029957-58029979 GGACTTTGGGAGGCTGAGACGGG + Intronic
907833941 1:58091645-58091667 GGATTATGGGGAGCTGAGTCTGG - Intronic
908315095 1:62924657-62924679 GGATCCTGCTCAGCTGAGACGGG - Intergenic
908550408 1:65203117-65203139 GCACTCTGAGGGGCTGAGACAGG - Intronic
908550640 1:65205478-65205500 GTACTTTGGAGAGCTGAGGCAGG - Intronic
908762217 1:67522776-67522798 GCACTTTGGGAAGCTGAGACGGG - Intergenic
909287331 1:73836632-73836654 GCACTTTGGGGGGCTGAGACAGG + Intergenic
910222075 1:84897946-84897968 GGACTCTGGGAGGCTGAGGCGGG + Intergenic
910423915 1:87100342-87100364 GGACTCCTTTGAGCTGAGGCTGG + Intronic
910580219 1:88816491-88816513 GCACTCTGGGAAGCTGAGGCAGG - Intronic
911157021 1:94646886-94646908 GCACTCTGGGTAGCTGAGACAGG + Intergenic
911746196 1:101444404-101444426 GCACTTTGGAGAGCTGAGGCAGG - Intergenic
911855604 1:102871684-102871706 GCACTCTGGGAGGCTGAGACGGG + Intergenic
912039421 1:105368879-105368901 GGACTGAGGTGAATTGAGACTGG - Intergenic
912164398 1:107025061-107025083 GCACTTTGGGGAGCTGAGGCAGG + Intergenic
913492579 1:119395166-119395188 GTACTCTGGGAAGCTGAGGCAGG + Intergenic
914243095 1:145865681-145865703 GCACTTTGGGGAGCTGGGACAGG + Intergenic
914805782 1:150990598-150990620 GGACTTTGGTAGGCTGAGGCGGG + Intronic
914811426 1:151031431-151031453 GAACTCTGGGAAGCTGAGGCTGG - Intronic
915097570 1:153474243-153474265 GGGCTCTGGTGGGCTGATCCTGG - Intergenic
915288872 1:154869691-154869713 GGAGTTGGGCGAGCTGAGACAGG + Exonic
915381949 1:155449763-155449785 GCACTTTGGGAAGCTGAGACGGG - Intronic
915383961 1:155472042-155472064 GTACTCTGGAAGGCTGAGACAGG + Intronic
915983600 1:160440543-160440565 GTACTTTGGGAAGCTGAGACAGG - Intergenic
917112791 1:171567938-171567960 GCACTTTGGTGGGCTGAGGCAGG + Intronic
917385592 1:174470518-174470540 GCACTTTGGAAAGCTGAGACAGG + Intronic
917822058 1:178773046-178773068 GCACTTTGGAAAGCTGAGACAGG - Intronic
918049666 1:180963246-180963268 GCACTCTGGGGGGCTGAGATGGG + Intergenic
918251769 1:182709258-182709280 GGACTTTGGTGAGCAAAGACAGG - Intergenic
918702362 1:187620983-187621005 GGACTTTGGGAAGCTGAGGCGGG - Intergenic
919641446 1:200048535-200048557 GGACTCGGGTGAGCTGGTATAGG - Exonic
919680726 1:200432007-200432029 GCACTTTGGGAAGCTGAGACAGG + Intergenic
919901929 1:202050303-202050325 ACACTCTGGGAAGCTGAGACAGG + Intergenic
920460131 1:206133267-206133289 GGACTCTGGTAAGCTGGGGTGGG - Intergenic
921026011 1:211282743-211282765 GCACTCTGGGAAGCTGAGGCAGG - Intronic
921637203 1:217510844-217510866 GCACTCTGGGAAGCTGAGGCGGG + Intronic
921917331 1:220627264-220627286 TGACTCTGATGAGGTGAGAGAGG + Intronic
922156062 1:223040516-223040538 GGCCTCTCCTGAGCTGAGAGTGG + Intergenic
922500844 1:226095893-226095915 GCACTTTGGGGAGCTGAGGCAGG - Intergenic
922501291 1:226098730-226098752 GGATTCTAGTGAGCAGAGAGGGG - Intergenic
923018839 1:230147458-230147480 GGACTGCTGTGGGCTGAGACTGG + Intronic
923087553 1:230713009-230713031 GGACTATGGTGAGGTCAGAGGGG - Intronic
923163951 1:231341738-231341760 GCACTTTGGGAAGCTGAGACAGG + Intronic
923629993 1:235643323-235643345 TGGCCCTGGTGAGCTGAGGCAGG - Intronic
924017845 1:239747000-239747022 GCACTCTGGGAAGCTGAGGCGGG - Intronic
924234750 1:241991209-241991231 GCACTCTGGGAGGCTGAGACGGG + Intergenic
1063255433 10:4321895-4321917 GCACTCTGGGAAGCTGAGACGGG - Intergenic
1063378148 10:5566413-5566435 GGACTCTGGTGAGTTGGGGGTGG - Intergenic
1063420378 10:5907718-5907740 GCACTTTGGGCAGCTGAGACAGG - Intronic
1063761315 10:9081452-9081474 GCACTTTGGGAAGCTGAGACGGG + Intergenic
1063919588 10:10919022-10919044 GCACTTTGGTAAGCTGAGGCAGG + Intergenic
1064205015 10:13315956-13315978 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1064340340 10:14479907-14479929 GGACTCTGGTCAGATGGGATGGG - Intergenic
1064413290 10:15126767-15126789 GGACTCAGCTAAGCTGTGACTGG + Intronic
1064459225 10:15517568-15517590 GCACTTTGGGAAGCTGAGACAGG - Intronic
1064638498 10:17392413-17392435 GCACTTTGGGGAGCTGAGGCAGG + Intronic
1065053135 10:21816119-21816141 GCACTTTGGTGGGCTGAGGCGGG + Intronic
1065218463 10:23473044-23473066 GCACTCTGGGAGGCTGAGACAGG - Intergenic
1065395768 10:25235940-25235962 GGACTTTGGGGGGCTGAGGCGGG - Intronic
1065629208 10:27660190-27660212 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1065746350 10:28845902-28845924 GCACTTTGGGGGGCTGAGACGGG + Intergenic
1065969573 10:30795813-30795835 GGAGTCTGGTGGGATGTGACTGG - Intergenic
1066330746 10:34419269-34419291 GCACTTTGGTAAGCTGAGGCAGG + Intronic
1066688643 10:38005011-38005033 GCACTTTGGGAAGCTGAGACGGG + Intergenic
1067141651 10:43662922-43662944 GCACTCTGGGAGGCTGAGACAGG - Intergenic
1068512719 10:57986408-57986430 GCACTCTGGGAAGCTGAGGCAGG + Intergenic
1068588810 10:58832412-58832434 GCACTCTGGTAGGCTGAGGCAGG + Intergenic
1068731188 10:60359688-60359710 GGACTTTGGGAAGCTGAGGCAGG + Intronic
1069119268 10:64548492-64548514 GGACTTTGGGAAGCAGAGACAGG + Intergenic
1069451464 10:68521290-68521312 GCACTTTGGTGGGCTGAGGCAGG + Intronic
1069675215 10:70241479-70241501 GCACTCTGGGAAGCTGAGGCGGG + Intergenic
1069996280 10:72343999-72344021 GCACTTTGGGGGGCTGAGACAGG - Intronic
1070180712 10:74010921-74010943 GCACTCTGGGGTGCTGAGGCAGG + Intronic
1070293871 10:75142192-75142214 GCACTTTGGGAAGCTGAGACAGG - Intronic
1070404015 10:76078587-76078609 GCACTTTGGGAAGCTGAGACGGG + Intronic
1070897122 10:79994394-79994416 GCACTTTGGGAAGCTGAGACTGG - Intergenic
1072140250 10:92583290-92583312 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1072354275 10:94591078-94591100 GCACTCTGGGAAGCTGAGGCAGG - Intronic
1072657648 10:97341510-97341532 GCACTTTGGGGAGCTGAGATGGG - Intergenic
1072723016 10:97792332-97792354 GGGCTCTAGAGAGCTGAGACTGG - Intergenic
1072870478 10:99114666-99114688 GCACTTTGGGGGGCTGAGACGGG + Intronic
1072952848 10:99863054-99863076 GCACTCTGGGAAGCTGAGGCAGG - Intergenic
1072977189 10:100068783-100068805 GCACTTTGGGAAGCTGAGACGGG - Intronic
1073213354 10:101822380-101822402 GCACTTTGGGAAGCTGAGACTGG + Intergenic
1073254717 10:102143352-102143374 GCACTCTGGGAAGCTGAGGCGGG + Intronic
1073256665 10:102156356-102156378 GCACTTTGGGAAGCTGAGACAGG - Intronic
1073589304 10:104741215-104741237 GTACTCTGGGAAGCTGAGGCAGG - Intronic
1074060843 10:109964287-109964309 GGACTTTGGGAAGCTGAGGCAGG + Intergenic
1074830371 10:117243830-117243852 GGACTTTGGGAAGCTGAGGCAGG - Intronic
1075124623 10:119689825-119689847 GCACTCTGGGAAGCTGAGATGGG - Intergenic
1075640228 10:124059497-124059519 GGACTCTGGGGACCTGAGAGTGG - Intronic
1075669925 10:124257212-124257234 GGAATCAGGTGAGCAGAGAAAGG + Intergenic
1075731272 10:124638121-124638143 GGACTTTGGGAAGCTGAGGCAGG + Intronic
1075945353 10:126428263-126428285 GGTGTCTGGGGAGCTGGGACTGG + Intronic
1076160841 10:128243069-128243091 TGTCTGTGGTGAGCTGACACCGG + Intergenic
1076711006 10:132334485-132334507 GCACTTTGGGAAGCTGAGACAGG - Intronic
1077102040 11:826771-826793 GCACTTTGGGGGGCTGAGACAGG - Intronic
1077257066 11:1590447-1590469 AGACTCGGGAGAGGTGAGACAGG - Intergenic
1077340135 11:2022608-2022630 GGACGGTGCGGAGCTGAGACGGG + Intergenic
1078083431 11:8219772-8219794 GGACTCTGCTGCGGTGAGCCAGG + Intergenic
1078226447 11:9395967-9395989 GCACTCTGGGAGGCTGAGACGGG - Intronic
1078673219 11:13383600-13383622 GCACTCTGGGAAGCTGAGGCAGG + Intronic
1079046295 11:17106686-17106708 GCACTCTGGGAAGCTGAGACAGG - Intronic
1079216122 11:18513544-18513566 GGACTTTGGAAAGCTGAGGCAGG - Intronic
1080025300 11:27607290-27607312 AGACTCTGATGAGCTTAGAAGGG - Intergenic
1080499778 11:32859587-32859609 GGACTCTGCTAAGCTGTGCCTGG - Intergenic
1080553258 11:33392810-33392832 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1081200344 11:40207349-40207371 GCACTTTGGGGAGCTGAGACAGG + Intronic
1081445467 11:43127404-43127426 GCACTCTGGGAGGCTGAGACAGG + Intergenic
1082004110 11:47410264-47410286 GGGCTCTGCTGAGCGGAGAGCGG + Exonic
1082106475 11:48226965-48226987 GCACTTTGGGGAGCTGAGGCGGG + Intergenic
1082124991 11:48421978-48422000 GGATACTGGTGGGCTGAGGCTGG + Intergenic
1082856749 11:57815172-57815194 GCACTTTGGGAAGCTGAGACGGG - Intronic
1083138532 11:60702643-60702665 GCACTTTGGGAAGCTGAGACGGG - Intronic
1083181019 11:60985429-60985451 GCACTCTGGGAGGCTGAGACGGG - Intronic
1083293893 11:61705016-61705038 GGACTGGGCTGAGCTGAGACTGG + Intronic
1083540358 11:63507983-63508005 GCACTCTGGGAAGCTGAGGCGGG - Intronic
1084108177 11:66994635-66994657 GCACTCTGGGAGGCTGAGACAGG - Intergenic
1084281814 11:68101192-68101214 GCACTTTGGGGGGCTGAGACAGG - Intronic
1084438708 11:69158423-69158445 TGAGGGTGGTGAGCTGAGACAGG - Intergenic
1084503581 11:69551697-69551719 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1084529393 11:69718072-69718094 GGGCTCTGCTGAGCTGAGCTGGG + Intergenic
1085333289 11:75670006-75670028 GCACTTTGGTAAGCTGAGGCCGG + Intergenic
1085357146 11:75848930-75848952 GCACTTTGGGGAGCTGAGGCAGG + Intronic
1085560866 11:77472482-77472504 GGACTCTTGAAAGCTGAGTCCGG + Intronic
1085881056 11:80466294-80466316 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1086272097 11:85079874-85079896 GCACTTTGGGAAGCTGAGACAGG - Intronic
1086365106 11:86101054-86101076 GCACTTTGGGGAGCTGAGGCTGG - Intergenic
1086473742 11:87147073-87147095 GCACTCTGGGAAGCCGAGACAGG + Intronic
1086500538 11:87448668-87448690 GGAGTGTGGTGAGATGAGATGGG + Intergenic
1087843336 11:102942661-102942683 GGACTTTGGGAAGCTGAGGCAGG + Intergenic
1088227626 11:107638898-107638920 GCACTCTGGGAAGCTGAGGCAGG + Intronic
1088230159 11:107665714-107665736 GCACTTTGGGGAGCTGAGGCGGG + Exonic
1088376640 11:109148356-109148378 AGACTCTGGAGAGCAGAAACTGG + Intergenic
1089142630 11:116299349-116299371 GTACTCTAGTGATCTGGGACAGG + Intergenic
1089288464 11:117422709-117422731 AGACGCTGGTGAGCTTAGAGAGG - Intergenic
1089495823 11:118908303-118908325 GGACTCTGGAGAGCAGCGAGAGG - Exonic
1089619674 11:119714945-119714967 AGACTCAGGAGAGGTGAGACGGG + Intronic
1089720710 11:120417740-120417762 GCACTTTGGTAGGCTGAGACAGG - Intronic
1089745157 11:120611649-120611671 GGAGTGTGCTGAACTGAGACTGG - Intronic
1091229188 11:133976913-133976935 GGACTCAGGTGTGCAGGGACTGG - Intergenic
1202823120 11_KI270721v1_random:77797-77819 GGACGGTGCGGAGCTGAGACGGG + Intergenic
1091422425 12:353674-353696 GCACTCTGGGAAGCCGAGACAGG + Intronic
1091491892 12:939828-939850 GCACTCTGGGAAGCTGAGGCAGG + Intronic
1091538666 12:1438693-1438715 GCACTTTGGGAAGCTGAGACAGG + Intronic
1092091828 12:5810065-5810087 GGGCTCTGGTTATCTGAGTCAGG - Intronic
1092468653 12:8758365-8758387 GGACTCTGGGAGGCTGAGATGGG - Intronic
1092870651 12:12802816-12802838 GCACTTTGGGAAGCTGAGACGGG + Intronic
1093683877 12:22034337-22034359 GCACTCTGGGAGGCTGAGACGGG - Intergenic
1093727112 12:22526905-22526927 GCACTCTGGGAAGCTGAGGCAGG + Intronic
1094553014 12:31470494-31470516 GCACTCTGGGAAGCTGAGACAGG - Intronic
1094626462 12:32129179-32129201 GCACTTTGGGGAGCTGAGGCAGG - Intronic
1095095252 12:38144114-38144136 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1095458822 12:42419478-42419500 GCACTCTGGGAAGCTGAGGCAGG - Intronic
1096306396 12:50481199-50481221 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1096356426 12:50944638-50944660 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1096388618 12:51212336-51212358 GCACTTTGGGAAGCTGAGACAGG - Intronic
1096647266 12:53045697-53045719 GGACCCAGTTGAGATGAGACGGG + Intergenic
1097062516 12:56296212-56296234 GCACTTTGGGAAGCTGAGACTGG + Intronic
1097666206 12:62480310-62480332 GCACTTTGGGAAGCTGAGACAGG + Intronic
1098149470 12:67531310-67531332 TCTCTCTGGTGAGCTGAGCCAGG + Intergenic
1098313589 12:69171230-69171252 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1098365064 12:69693625-69693647 GGGCTCTTCTCAGCTGAGACAGG - Intronic
1099257100 12:80327711-80327733 GCACTTTGGGAAGCTGAGACGGG + Intronic
1099949916 12:89290518-89290540 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1100482850 12:94995959-94995981 GGACTCTGGAAGGCTGAGGCAGG + Intronic
1101071382 12:101079821-101079843 GGACAGTGGTGGGCTGAGTCTGG - Intronic
1101448694 12:104756791-104756813 GCACTCTGGGAAGCTGAGGCAGG - Intronic
1101979190 12:109390912-109390934 GGACTCTGGGAGGCTGAGGCAGG - Intronic
1101979793 12:109396167-109396189 GCACTCTGGGAAGCTGAGGCGGG - Intronic
1102105541 12:110318718-110318740 GAACTTTGGGAAGCTGAGACAGG - Intronic
1102245890 12:111355567-111355589 AGACTCAGGGGAGCTGAGAGAGG + Intergenic
1103127279 12:118434811-118434833 GGACTTTGGGAGGCTGAGACGGG - Intergenic
1103426633 12:120841077-120841099 GCACTTTGGGAAGCTGAGACAGG + Intronic
1103500127 12:121395209-121395231 GGACTCTGGGAGGCTGAGACTGG + Intronic
1103525656 12:121566373-121566395 GCACTCTGGGAAGCTGAGGCAGG + Intronic
1103707879 12:122888986-122889008 GGGCTCTGGTGAGCGGGGAGGGG - Intronic
1103808545 12:123594051-123594073 GGACTTTGGGAGGCTGAGACAGG - Intronic
1103962212 12:124616188-124616210 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1104193277 12:126504632-126504654 GGACTGTGGTGAACTGAGTGAGG + Intergenic
1105033592 12:132902341-132902363 GCACTCTGGGAAGCTGAGGCAGG - Intronic
1105336499 13:19475470-19475492 GCACTCTGGGGGGCTGAGGCGGG - Intronic
1105492161 13:20899382-20899404 GGAGTCTGGTGATCTCAGCCTGG + Intronic
1105524632 13:21165686-21165708 GCACTCTGGGAGGCTGAGACAGG + Intronic
1105926717 13:25015452-25015474 GGACTTTGGGAAGCTGAGGCAGG - Intergenic
1106014244 13:25853140-25853162 GCACTTTGGGGGGCTGAGACAGG + Intronic
1106022249 13:25926484-25926506 GGACTCTGGGGAGCAGGAACTGG + Intronic
1106237019 13:27871250-27871272 GGACTTTGGGAAGCTGAGGCAGG - Intergenic
1106332261 13:28750058-28750080 GGACTCTGATGGGCTGACAGAGG - Intergenic
1106366645 13:29087810-29087832 GCACTCTGGTAGGCTGAGGCAGG + Intronic
1108260533 13:48651384-48651406 GCACTTTGGTGGGCTGAGGCGGG - Intergenic
1108282742 13:48875969-48875991 GCACTCTGGTGAAATGAAACAGG - Intergenic
1108626501 13:52234014-52234036 AGGTTGTGGTGAGCTGAGACCGG - Intergenic
1108631435 13:52287117-52287139 GTACTTTGGGGAGCTGAGGCGGG - Intergenic
1108655257 13:52525481-52525503 GTACTTTGGGGAGCTGAGGCGGG + Intergenic
1108659566 13:52572474-52572496 AGGTTGTGGTGAGCTGAGACCGG + Intergenic
1109203937 13:59461057-59461079 GCACTCTGGGAAGCTGAGGCAGG + Intergenic
1109366618 13:61364618-61364640 GGGCTCTGGTGAGCTGCGGTGGG - Intergenic
1110103287 13:71636028-71636050 GCACTTTGGGAAGCTGAGACGGG - Intronic
1110274311 13:73626602-73626624 GCACTTTGGGGGGCTGAGACGGG + Intergenic
1110324355 13:74196793-74196815 GGACTCTGGTGCCCTGAGAATGG + Intergenic
1110856192 13:80299269-80299291 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1111434345 13:88187139-88187161 GCACTTTGGTAGGCTGAGACAGG + Intergenic
1112174437 13:97007964-97007986 GCACTCTGGGAAGCTGAGGCAGG - Intergenic
1112274692 13:98005472-98005494 GGACTCTGGGAGGCTGAGGCAGG - Intronic
1112444036 13:99447380-99447402 GCACTCTGGGGAGCTGAGACAGG - Intergenic
1112735845 13:102415703-102415725 GCACTTTGGTAGGCTGAGACGGG - Intergenic
1113239305 13:108318556-108318578 GCACTCTGGGAGGCTGAGACGGG - Intergenic
1113270326 13:108666567-108666589 GCACTCTGGGAGGCTGAGACTGG - Intronic
1113829278 13:113282148-113282170 GCACTTTGGGGGGCTGAGACAGG + Intergenic
1113923038 13:113925112-113925134 GGACTCTGGGGAGAAGAGGCAGG - Intergenic
1114293110 14:21305046-21305068 GCACTTTGGGAAGCTGAGACAGG - Intronic
1114531355 14:23398582-23398604 GGACTGTGGTGAGGTGAGCCAGG + Intronic
1114947760 14:27707467-27707489 GCACTCTGGGAAGCTGAGGCGGG - Intergenic
1115920617 14:38368218-38368240 GGACTCTGCTGAGGTGGGGCAGG + Intergenic
1115982276 14:39066616-39066638 GCACTTTGGAAAGCTGAGACAGG + Intronic
1116893859 14:50296123-50296145 GCACTCTGGGAAGCTGAGGCTGG + Intronic
1117311273 14:54525848-54525870 GTACTCTGGGAGGCTGAGACGGG + Intronic
1117732200 14:58734555-58734577 GCACTTTGGTAGGCTGAGACAGG + Intergenic
1117760931 14:59027622-59027644 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1117857988 14:60055644-60055666 GCACTCTGGGAAGCTGAGGCAGG + Intronic
1118179987 14:63483056-63483078 GGACTTTGGGAAGCTGAGGCAGG + Intronic
1118187229 14:63548610-63548632 GCACTCTGGGAGGCTGAGACGGG - Intergenic
1118205580 14:63720179-63720201 GCACTTTGGTAAGCTGAGGCAGG + Intronic
1118594352 14:67424369-67424391 GCACTCTGGGAAGCTGAGGCAGG + Intergenic
1118798781 14:69169815-69169837 GCACTTTGGTAAGCTGAGACAGG - Intergenic
1119363938 14:74075408-74075430 GCACTTTGGGAAGCTGAGACGGG + Intronic
1119394171 14:74313732-74313754 GCACTTTGGTAAGCTGAGACAGG + Intronic
1119515274 14:75243145-75243167 GCACTTTGGGAAGCTGAGACGGG + Intronic
1119792351 14:77363548-77363570 GTACTTTGGGAAGCTGAGACAGG + Intronic
1119826965 14:77664971-77664993 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1120216860 14:81689785-81689807 GCACTCAGGTGAGCTGTGCCTGG + Intergenic
1120784591 14:88521088-88521110 GCACTTTGGGAAGCTGAGACGGG - Intronic
1120795996 14:88633360-88633382 GCACTCTGGGAGGCTGAGACAGG - Intronic
1120798675 14:88665578-88665600 GCACTCTGGGGAGCTGAGGCAGG + Intronic
1121048688 14:90805796-90805818 TGACTCTGATGAGCTGAGGCAGG - Intronic
1121090632 14:91179503-91179525 GCACTCTGGGAGGCTGAGACAGG + Intronic
1121659978 14:95627535-95627557 GCACTTTGGGGAGCTGAGGCAGG + Intergenic
1121904513 14:97727431-97727453 GCACTCTGGAAGGCTGAGACGGG - Intergenic
1121915698 14:97835401-97835423 GCACTTTGGGGAGCTGAGGCAGG - Intergenic
1122052235 14:99067804-99067826 GGGCTGGGGTGAGCTGGGACTGG - Intergenic
1122564185 14:102640089-102640111 GCACTCTGGGAAGCTGAGGCAGG - Intronic
1122601763 14:102925191-102925213 GGTCACTGGTGAGCTGGGTCGGG + Intronic
1123414654 15:20086444-20086466 CTACTCTGGGGAGCTGAGGCAGG + Intergenic
1123414712 15:20086859-20086881 GCACTCTGGGGGGCTGAGGCGGG + Intergenic
1123523996 15:21093557-21093579 CTACTCTGGGGAGCTGAGGCAGG + Intergenic
1123524054 15:21093973-21093995 GCACTCTGGGGGGCTGAGGCGGG + Intergenic
1123688398 15:22816935-22816957 GCACTCTGGGAGGCTGAGACGGG + Intronic
1124221142 15:27850868-27850890 GACCTCTGGTGAGCAGACACAGG - Intronic
1124257770 15:28159720-28159742 TGACTTTGATGAGCTGAGAGAGG - Intronic
1124592007 15:31061932-31061954 GCACTTTGGGGGGCTGAGACAGG - Intronic
1124946904 15:34277186-34277208 GTATTTTGGTGAGCTGAGGCGGG + Intronic
1125012763 15:34898500-34898522 GGATTCTAGTGAGGTGAGACAGG + Intronic
1125565247 15:40672654-40672676 GCACTTTGGGGAGCTGAGGCGGG + Intergenic
1125639482 15:41218096-41218118 GCACTCTGGGAAGCTGAGGCAGG + Intronic
1125725202 15:41864725-41864747 GGACTCGTCTGAGCTGAGGCTGG + Intronic
1126625807 15:50685214-50685236 GGACTTTGGGGGGCTGAGGCGGG + Intronic
1126828664 15:52576935-52576957 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1127689162 15:61377587-61377609 GGACTTTGGGAAGCTGAGGCTGG + Intergenic
1127956828 15:63861144-63861166 GCACTCTGGGAGGCTGAGACAGG + Intergenic
1128512614 15:68322618-68322640 GCACTCTGGGAGGCTGAGACAGG + Intronic
1128573124 15:68750263-68750285 GGACTTTGGGAGGCTGAGACGGG + Intergenic
1128878345 15:71220786-71220808 GGACTCTGGGAAGCATAGACTGG + Intronic
1128971026 15:72106229-72106251 GCACTCTGGGAGGCTGAGACAGG + Intronic
1129028117 15:72598201-72598223 GGACTTTGGGGTGCTGAGGCAGG - Exonic
1129497880 15:76004352-76004374 GCACTTTGGGGAGCTGAGGCAGG + Intronic
1129602316 15:77007359-77007381 GCACTCTGGAAAGCTGAGGCAGG + Intronic
1130302425 15:82689854-82689876 GCACTTTGGGAAGCTGAGACGGG + Intronic
1130514406 15:84615198-84615220 GGACTTTGGGGGGCTGAGGCAGG - Intronic
1130533792 15:84768482-84768504 GCACTTTGGGAAGCTGAGACAGG - Intronic
1130612235 15:85371971-85371993 GGACTCTGGGAAGCCGAGGCGGG - Intergenic
1131044908 15:89306443-89306465 GCACTTTGGTAGGCTGAGACGGG + Intronic
1131841204 15:96439812-96439834 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1131890889 15:96970378-96970400 GGACTCTGGGGAGCAGTGATGGG + Intergenic
1131971224 15:97894858-97894880 GCACTCTGGTAGGCTGAGGCAGG + Intergenic
1132060337 15:98687441-98687463 GGAATATCGGGAGCTGAGACTGG + Intronic
1133261866 16:4556143-4556165 GCCCTCTGGTGATGTGAGACTGG - Intergenic
1133621882 16:7534337-7534359 GCACTTTGGTAGGCTGAGACGGG - Intronic
1134204702 16:12227651-12227673 GCACTTTGGCGGGCTGAGACAGG + Intronic
1134527852 16:14958094-14958116 GCACTTTGGTAAGCTGAGGCGGG + Intergenic
1134611123 16:15608990-15609012 GCACTCTGGGAGGCTGAGACAGG + Intronic
1134642507 16:15840483-15840505 GCACTGTGGGAAGCTGAGACAGG + Intronic
1134673444 16:16072793-16072815 GCACTTTGGGGAGCTGAGGCAGG + Intronic
1135952034 16:26923625-26923647 GCACTTTGGGGAGCTGAGGCAGG - Intergenic
1136162412 16:28429056-28429078 GCACTCTGGGAGGCTGAGACGGG + Intergenic
1136200554 16:28685933-28685955 GCACTCTGGGAGGCTGAGACGGG - Intergenic
1136216899 16:28800126-28800148 GCACTCTGGGAGGCTGAGACGGG - Intergenic
1136221699 16:28833501-28833523 TGTCTGTGGTGAGCTGGGACAGG + Exonic
1136658936 16:31736764-31736786 GCACTTTGGGAAGCTGAGACGGG - Intronic
1136851539 16:33616296-33616318 GGACTTTGGGAGGCTGAGACGGG + Intergenic
1138418853 16:56886536-56886558 GCACTCTGGGGAGCCAAGACAGG + Intronic
1138419064 16:56887451-56887473 GCACTCTGGGGGGCTGAGATAGG - Intronic
1138908623 16:61368765-61368787 GCACTCTGGGAGGCTGAGACAGG - Intergenic
1139561755 16:67747565-67747587 AGATTGTGGTGAGCTGAGATTGG - Intronic
1139791470 16:69440119-69440141 GGACTTTGGGAAGCTGAGGCAGG - Intronic
1140104084 16:71943288-71943310 GCACTTTGGGAAGCTGAGACGGG + Intronic
1140213995 16:72992888-72992910 GCACTCTGGGAGGCTGAGACGGG + Intronic
1140230954 16:73116701-73116723 GGACTCTGGTTGGCTAAGAGAGG + Intergenic
1140402787 16:74685108-74685130 GCACTTTGGTAAGCCGAGACAGG - Intronic
1141087418 16:81106445-81106467 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1141112731 16:81283341-81283363 GCACTTTGGGAAGCTGAGACAGG + Intronic
1141112820 16:81283937-81283959 GCACTTTGGGAAGCTGAGACGGG + Intronic
1141199400 16:81885408-81885430 GCAATTTGGGGAGCTGAGACAGG - Intronic
1141481904 16:84312320-84312342 GGAATCTGGTGGGCAGTGACTGG - Intronic
1141879361 16:86847599-86847621 GGACGCTGTGGAGCTGAGAATGG + Intergenic
1142333106 16:89468456-89468478 GGACTTTGGGAGGCTGAGACAGG + Intronic
1142539217 17:644828-644850 GCACTTTGGTAGGCTGAGACAGG - Intronic
1142887416 17:2921447-2921469 GGACTTTGGGGGGCTGAGGCGGG - Intronic
1143373874 17:6456085-6456107 AGACTGCGGTGAGCTGAGACTGG - Intronic
1143557087 17:7668581-7668603 GCACTCTGGGAGGCTGAGACAGG + Exonic
1143580153 17:7820791-7820813 GCACTTTGGAAAGCTGAGACGGG + Intronic
1143852123 17:9820907-9820929 GCACTTTGGGAAGCTGAGACAGG - Intronic
1144352060 17:14406036-14406058 GCACTCTGGGAAGCCGAGACGGG - Intergenic
1144690198 17:17256835-17256857 GCACTTTGGGGAGCTGAGGCAGG - Intronic
1144934344 17:18885967-18885989 GGACTTTGGGAAGCTGAGGCAGG - Intronic
1145102767 17:20090398-20090420 GAACTGAGGTGAGCTGAGAAAGG - Intronic
1145949774 17:28807260-28807282 GGACTTTGGGAAGCTGAGGCAGG - Intronic
1145987477 17:29056735-29056757 GCACTTTGGGGGGCTGAGACAGG + Exonic
1146841134 17:36155112-36155134 GCACTTTGGGGGGCTGAGACAGG + Intergenic
1147143307 17:38471197-38471219 GCACTTTGGGAAGCTGAGACAGG - Intronic
1147410736 17:40250076-40250098 GCACTCTGGGGGGCTGAGGCGGG - Intronic
1147764060 17:42821299-42821321 GCACTTTGGGTAGCTGAGACGGG - Intronic
1147914748 17:43879611-43879633 GGACTCTGGAAGGCTGAGAAAGG + Intronic
1148035851 17:44658546-44658568 GCACTCTGGGGGGCTGAGGCGGG + Intronic
1148066093 17:44871269-44871291 GGACTTTGGGAAGCTGAGGCAGG - Intronic
1148455179 17:47807647-47807669 GGGATCCGCTGAGCTGAGACGGG + Exonic
1148490748 17:48022870-48022892 GCACTTTGGGGAGCTGAGGCGGG - Intergenic
1148511371 17:48172927-48172949 GCACTCTGGTAGGCTGAGATGGG + Intronic
1148518968 17:48250525-48250547 GCACTTTGGGAAGCTGAGACGGG - Intronic
1148532822 17:48411151-48411173 GTACTTTGGGAAGCTGAGACGGG + Intronic
1148543291 17:48497238-48497260 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1148709704 17:49669311-49669333 GGACTTTGGGAGGCTGAGACGGG - Intronic
1149265385 17:54922358-54922380 GCACTCTGGGAAGCTGAGGCAGG + Intronic
1149747105 17:59109061-59109083 GGACTTTGGGAAGCTGAGGCTGG + Intergenic
1149862121 17:60127840-60127862 GGAGTCTTGAGAGATGAGACTGG + Intergenic
1150169115 17:62973276-62973298 GCACTCTGGGAGGCTGAGACGGG - Intergenic
1150240257 17:63625823-63625845 GCACTTTGGGAAGCTGAGACTGG + Intronic
1150942380 17:69706906-69706928 GGACAGTGGGGAGGTGAGACAGG + Intergenic
1151281741 17:73080696-73080718 GCACTCTGGGAGGCTGAGACAGG + Intronic
1151440333 17:74124634-74124656 GCACTCTGGGGGGCTGAGATGGG - Intergenic
1151725550 17:75881787-75881809 GGACTCAGGCGGGCAGAGACTGG + Intronic
1151800884 17:76378993-76379015 GGGCTTTGGGCAGCTGAGACGGG + Intronic
1151933301 17:77246898-77246920 GGACCCAGGTGTGCTGAGAAGGG + Intergenic
1152143228 17:78550970-78550992 GCACTTTGGGAAGCTGAGACAGG + Intronic
1152821065 17:82437988-82438010 GCACTCTGGGAGGCTGAGACGGG + Intronic
1153700441 18:7688020-7688042 GCACTTTGGGAAGCTGAGACGGG - Intronic
1153822401 18:8843479-8843501 AGAAGCTGGTGAGCTGAGATGGG - Intergenic
1154991472 18:21601449-21601471 AGGTTGTGGTGAGCTGAGACTGG + Intergenic
1155283145 18:24261584-24261606 GCACTCTGGGAGGCTGAGACGGG + Intronic
1155888119 18:31233029-31233051 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1156261582 18:35449314-35449336 GGACTCTGGGAAGCGGAGGCAGG + Intronic
1156840406 18:41604199-41604221 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1157749457 18:50165234-50165256 GGACTCTGGGTGGCTGAGGCAGG + Intronic
1157950206 18:52028257-52028279 GGACTCTGTTAAGCAGTGACTGG + Intergenic
1158062563 18:53363677-53363699 AGACTCTGGAGAGCTGAGGTAGG - Intronic
1158901097 18:61962449-61962471 GCACTTTGGTAGGCTGAGACGGG + Intergenic
1159051948 18:63428386-63428408 GCACTCTGGGAAGCTGAGGCGGG - Intergenic
1159185562 18:64967807-64967829 GGAATCTGGTGAGTGGAGATTGG - Intergenic
1159383471 18:67691756-67691778 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1159626583 18:70702237-70702259 GGACGTTGGTGAGCTAAGCCGGG - Intergenic
1159649081 18:70955832-70955854 GCACTTTGGTGGGTTGAGACAGG - Intergenic
1160124193 18:76155371-76155393 GGACACAGGTGAGCTGGCACAGG - Intergenic
1160611471 18:80090614-80090636 GAACTTTGGGAAGCTGAGACGGG + Intronic
1160674132 19:379835-379857 GGGAGCTGGTGAGCTGTGACTGG + Intergenic
1160674144 19:379877-379899 GGGACCTGGTGAGCTGTGACTGG + Intergenic
1160674918 19:384933-384955 GGCGCCTGGTGAGCTGTGACCGG + Intergenic
1160674931 19:384975-384997 GGCGCCTGGTGAGCTGTGACTGG + Intergenic
1160674943 19:385017-385039 GGCGCCTGGTGAGCTGTGACTGG + Intergenic
1160814875 19:1030378-1030400 GCACTTTGGAGGGCTGAGACGGG + Intronic
1160973995 19:1783584-1783606 GGACTCTGATTGGCTGAGCCAGG - Intronic
1161047175 19:2141684-2141706 GCACTTTGGTAGGCTGAGACAGG - Intronic
1161191325 19:2958364-2958386 GCACTTTGGGGAGCTGAGGCAGG + Intergenic
1161303414 19:3554188-3554210 GCACTGTGGGGGGCTGAGACAGG + Intronic
1161433653 19:4249136-4249158 GGGCTCTGGGGAGCTGTGTCGGG - Intronic
1161437183 19:4270598-4270620 GGACTTTGGGGGGCTGAGGCAGG + Intergenic
1161570512 19:5028221-5028243 GAACTCTGGGGGGCTGAGGCGGG - Intronic
1161603290 19:5198755-5198777 GCACTTTGGTGAGCCGAGGCAGG - Intronic
1161696543 19:5771813-5771835 GCACTCTGGAAAGCTGAGGCAGG - Intronic
1161717242 19:5883086-5883108 GCACTTTGGGAAGCTGAGACGGG + Intronic
1161944162 19:7424270-7424292 GCACTCTGGGAGGCTGAGACAGG - Intronic
1162035565 19:7936719-7936741 GCACTTTGGGAAGCTGAGACGGG + Intronic
1162049580 19:8024795-8024817 GCACTCTGGGAAGCTGAGGCGGG - Intronic
1162515999 19:11148101-11148123 GCTCTCTGGTGAGCTGAGTAGGG + Exonic
1162517735 19:11159404-11159426 GCACTCTGGTAGGCTGAGGCAGG + Intergenic
1162754652 19:12850269-12850291 GCACTTTGGGGAGCTGAGACAGG + Intronic
1162868589 19:13568281-13568303 GCACTTTGGGAAGCTGAGACAGG + Intronic
1163157557 19:15447793-15447815 GGAGTCTGGGGTGCTGAGATGGG + Intronic
1163213775 19:15861415-15861437 GCACTCTGGGAGGCTGAGACGGG - Intergenic
1163267445 19:16229431-16229453 GGATTCTGAGGAGCTGAGTCTGG + Intronic
1163418435 19:17200990-17201012 GCACTCTGGGAGGCTGAGACAGG + Intronic
1163683207 19:18695617-18695639 GCACTCTGGGAGGCTGAGACAGG + Intronic
1163985953 19:20951764-20951786 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1164465030 19:28480648-28480670 GCACTCTGGGAGGCTGAGACTGG - Intergenic
1164726787 19:30470932-30470954 GCACTTTGGTAAGCTGAGGCAGG - Intronic
1164818701 19:31227224-31227246 GCACTCTGGGAGGCTGAGACGGG - Intergenic
1164835882 19:31354816-31354838 GGCCTCAGGAGAGCTGAGTCAGG + Intergenic
1165019995 19:32916212-32916234 GGACTATAGTGAGCCGTGACTGG + Intronic
1165072433 19:33263387-33263409 GGACTCCGGGGAGCAGAGACAGG - Intergenic
1165145588 19:33727997-33728019 GGACTTTGGTAAGCAGAGCCTGG + Intronic
1165217409 19:34286083-34286105 GCACTCTGGAAAGCCGAGACAGG + Intronic
1165316957 19:35061817-35061839 GCACTCTGGGCAGCTGAGATGGG + Intronic
1165564058 19:36708134-36708156 GAACTCTGGGAAGCTGAGACAGG - Intronic
1165744305 19:38221701-38221723 GCACTTTGGAGGGCTGAGACAGG + Intronic
1165873294 19:38988420-38988442 GCACTCCTGTGAGGTGAGACAGG - Intergenic
1166074497 19:40405881-40405903 GCACTCTGGGAAGCTGAGGCGGG - Intronic
1166561486 19:43735369-43735391 GCACTTTGGGGAGCTGAGGCGGG + Intronic
1166884397 19:45951228-45951250 GCACTTTGGGGAGCTGAGGCGGG + Intronic
1167417233 19:49381267-49381289 GGACTTTGGGAAGCTGAGGCAGG - Intergenic
1167451361 19:49571738-49571760 GCACTCTGGGAGGCTGAGACGGG + Intronic
1167949995 19:53018776-53018798 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1168006168 19:53489354-53489376 GGACTTTGGGAAGCTGAGGCGGG + Intronic
1168279648 19:55298059-55298081 GCACTCTGGGAAGCTGAGGCGGG - Intronic
1168525606 19:57086265-57086287 GAACTGTGGTTACCTGAGACTGG + Intergenic
925329887 2:3050377-3050399 GGACTCAGGTGTCCTGACACCGG + Intergenic
925450812 2:3968031-3968053 GCACTCTGGGGAGCTGAGTCAGG - Intergenic
925469041 2:4139109-4139131 GAACTCTGGGAGGCTGAGACAGG + Intergenic
926093183 2:10063689-10063711 GCACGCTGGGGGGCTGAGACTGG + Intronic
926145541 2:10395041-10395063 GCACTCTGGGAAGCTGAGGCAGG - Intronic
926339458 2:11893079-11893101 GCACTCTGGGAGGCTGAGACTGG + Intergenic
926725634 2:15995344-15995366 GGACTTTGGGAGGCTGAGACTGG + Intergenic
927415158 2:22871750-22871772 GGACTTTGGGAAGCTGAGGCGGG + Intergenic
927521035 2:23698255-23698277 AGACTCTGGTGGGCTGAGGAAGG - Intronic
927952057 2:27177696-27177718 GCACTTTGGGGAGCTGAGGCGGG - Intergenic
928537517 2:32254862-32254884 GCACTTTGGGAAGCTGAGACGGG - Intronic
929153786 2:38771673-38771695 GCACTCTGGGAGGCTGAGACAGG - Intronic
929719480 2:44352998-44353020 GCACTTTGGGAAGCTGAGACAGG + Intronic
930212912 2:48661498-48661520 GCACTTTGGTAAGCTGAGGCAGG - Intronic
930509814 2:52330301-52330323 GAACACTGGTTAGCAGAGACTGG + Intergenic
930642943 2:53872992-53873014 GCACTTTGGGAAGCTGAGACAGG + Intronic
930783474 2:55247308-55247330 GCACTTTGGGAAGCTGAGACGGG + Intronic
931182429 2:59916166-59916188 AGACTCTGGTGAGCAGTGATTGG - Intergenic
931279837 2:60780520-60780542 GTACTCTGGGAAGCTGAGGCAGG - Intronic
931411058 2:62032287-62032309 GCACTCTGGGAAGCTGAGGCAGG + Intronic
931781710 2:65584338-65584360 GCACTTTGGGAAGCTGAGACGGG - Intergenic
932095498 2:68844719-68844741 GTACTATGGTGAGCAGGGACTGG + Intergenic
932243136 2:70173525-70173547 GCACTCTGGGAAGCTGAGGCAGG - Intronic
932254255 2:70270240-70270262 GCACTCTGGGAAGCTGAGCCAGG - Intronic
932258142 2:70304185-70304207 GCACTTTGGGGAGCTGAGGCAGG + Intergenic
932542563 2:72671446-72671468 GCACTCTGGGAAGCTGAGGCGGG + Intronic
932616566 2:73235078-73235100 GGACTCTGGTGACATAAGAAAGG + Intronic
932690197 2:73906722-73906744 GCACTTTGGGGAGCTGAGACAGG - Intronic
932730077 2:74213534-74213556 GCACTCTGGGGGGCTGAGGCAGG - Intronic
933041870 2:77479140-77479162 GCACTCTGGGGGGCCGAGACAGG - Intronic
933663158 2:84944046-84944068 AGGTTGTGGTGAGCTGAGACTGG - Intergenic
933776951 2:85776833-85776855 GGAATCTGGAGAGCCGTGACCGG + Intronic
933884612 2:86706585-86706607 GCACTTTGGGGAGCTGAGGCGGG + Intronic
934166883 2:89301987-89302009 GCACTTTGGGAAGCTGAGACAGG - Intergenic
934200396 2:89880470-89880492 GCACTTTGGGAAGCTGAGACAGG + Intergenic
934285294 2:91645067-91645089 GCACTCTGGGAGGCTGAGACGGG - Intergenic
934536776 2:95140727-95140749 GCACTCTGGGAAGCTGAGGCAGG + Intronic
935014286 2:99165311-99165333 GGACTCTGGGAGGCTGAGGCAGG - Intronic
935601073 2:104921749-104921771 GCACTCTGGGAAGCTGAGGCAGG + Intergenic
936834720 2:116694842-116694864 GCACTTTGGTAGGCTGAGACAGG + Intergenic
936912703 2:117609381-117609403 GGACTTTGGGAAGCTGAGGCAGG + Intergenic
937151558 2:119689957-119689979 GGGCTCTAGGGGGCTGAGACTGG - Intergenic
938245137 2:129770604-129770626 GCACTCTGGGAGGCTGAGACGGG + Intergenic
938286836 2:130126055-130126077 GCACTTTGGGAAGCTGAGACAGG + Intronic
938428760 2:131212808-131212830 GCACTTTGGGAAGCTGAGACAGG - Intronic
938508156 2:131908920-131908942 GCACTCTGGGAGGCTGAGACGGG + Intergenic
938920592 2:135991010-135991032 GCACTCTGGGCAGCTGAGGCAGG - Intergenic
939326319 2:140693952-140693974 GCACTCTGGGGAGCTGAGGTGGG - Intronic
940297686 2:152145313-152145335 GCACTTTGGTAGGCTGAGACAGG - Intronic
940631350 2:156243454-156243476 GCACTCTGGGAAGCTGAGGCAGG + Intergenic
940963536 2:159812657-159812679 GCACTTTGGGGGGCTGAGACAGG - Intronic
941507125 2:166360153-166360175 GGATTGTAGTGAGCTGAGATCGG + Intronic
941998326 2:171622561-171622583 GCACTTTGGTAGGCTGAGACGGG + Intergenic
942002257 2:171659839-171659861 GGACTTTGGGAGGCTGAGACAGG - Intergenic
943756075 2:191558702-191558724 GCACTCTGGGAGGCTGAGACGGG + Intergenic
944660523 2:201917918-201917940 GCACTCTGGTGGGCCGAGGCAGG - Intergenic
945386927 2:209212360-209212382 GCACTTTGGGAAGCTGAGACAGG - Intergenic
945622328 2:212156081-212156103 AGACCCAGGAGAGCTGAGACAGG - Intronic
946231185 2:218292187-218292209 GGGCACTGGTGAGCGGAGCCAGG - Intronic
946837434 2:223786505-223786527 GCACTTTGGGAAGCTGAGACAGG + Intronic
946911592 2:224467045-224467067 GCACTCTGGGAAGCTGAGGCGGG + Intergenic
947213160 2:227726164-227726186 GCACTTTGGGAAGCTGAGACAGG + Intergenic
947592464 2:231393514-231393536 GGAATCTGGTCAGTTGAGACAGG - Intergenic
948352731 2:237354262-237354284 GCACTCTGGGAGGCTGAGACAGG - Intronic
948664238 2:239524711-239524733 AGACTTTGGGAAGCTGAGACAGG - Intergenic
948871643 2:240802874-240802896 GCACTTTGGGGAGCTGAGATGGG - Intronic
948911093 2:241003068-241003090 GGATTCTGGCGAGGAGAGACAGG - Intronic
1168767417 20:391232-391254 GGACTCCCGGGAGCTGAGGCTGG - Intronic
1168894799 20:1316634-1316656 GTACTTTGGGAAGCTGAGACAGG - Intronic
1169011851 20:2257631-2257653 GCACTCTGGGAGGCTGAGACGGG - Intergenic
1169037747 20:2467575-2467597 GGACTGTGGGGGGCGGAGACTGG - Intronic
1169127870 20:3143346-3143368 GCACTCTGGGAAGCTGAGGCGGG - Intronic
1169155907 20:3329403-3329425 GGACTCTGGGGGGCCGAGGCAGG - Intronic
1169432278 20:5548326-5548348 AGCCTCTGGTGACCTGACACTGG + Intronic
1169588078 20:7109470-7109492 GCACTCTGGGAAGCTGAGGCGGG + Intergenic
1169619848 20:7493210-7493232 GCACTCTGGTAGGCTGAGGCAGG + Intergenic
1169630747 20:7627922-7627944 GGAGCCTCCTGAGCTGAGACTGG - Intergenic
1169885231 20:10391293-10391315 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1170202978 20:13764974-13764996 GCACTCTGGGAAGCTGAGGCAGG + Intronic
1170457305 20:16545282-16545304 GTACTTTGGGAAGCTGAGACAGG + Intronic
1170661219 20:18342426-18342448 GCACTCTGGGAAGCTGAGGCAGG + Intergenic
1171108578 20:22459370-22459392 GCACTTTGGTAGGCTGAGACGGG + Intergenic
1171502954 20:25608542-25608564 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1171845140 20:30265089-30265111 GGACTTTGGGAGGCTGAGACAGG - Intergenic
1172333539 20:34094136-34094158 GCACTTTGGGAAGCTGAGACAGG - Intronic
1172686950 20:36762998-36763020 GGACTTTGGGAAGCTGAGGCAGG - Intronic
1172769578 20:37372232-37372254 GCACTCTGGGAGGCTGAGACAGG - Intronic
1173484791 20:43433017-43433039 GCACTCTGGGAAGCTGAGGCGGG + Intergenic
1173510185 20:43621707-43621729 GAACTTTGGGAAGCTGAGACAGG - Intronic
1173565856 20:44038147-44038169 GCACTCTGGGGAGCTGAGGAGGG + Intronic
1174319402 20:49729123-49729145 GCACTTTGGAAAGCTGAGACAGG - Intergenic
1174373388 20:50109502-50109524 GGACTTTGGGAGGCTGAGACGGG + Intronic
1174596088 20:51684762-51684784 GCACTTTGGTAGGCTGAGACAGG + Intronic
1174809868 20:53636516-53636538 GCACTTTGGTAGGCTGAGACAGG + Intergenic
1175370808 20:58489288-58489310 GCACTCTGGTAGGCTGAGGCAGG + Intronic
1175592774 20:60206720-60206742 GCACTTTGGTAGGCTGAGACAGG + Intergenic
1175850511 20:62089099-62089121 GCACTCTGGAAAGCTGAGGCAGG - Intergenic
1176342132 21:5709011-5709033 GGACTCAGTTGAGATGAGGCTGG + Intergenic
1176474386 21:7141163-7141185 GGACTCAGTTGAGATGAGGCTGG + Intergenic
1176502695 21:7615445-7615467 GGACTCAGTTGAGATGAGGCTGG - Intergenic
1176510753 21:7745661-7745683 GGAGTCTGGGCAGCTGAGATCGG + Intronic
1176536453 21:8107080-8107102 GGACTCAGTTGAGATGAGGCTGG + Intergenic
1177006527 21:15679533-15679555 GCACTCTGGAAAGCTGAGGCGGG + Intergenic
1178088671 21:29138733-29138755 GCACTCTGGGAAGCTGAGCCAGG + Intronic
1178530915 21:33375150-33375172 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1178644866 21:34376190-34376212 GGAGTCTGGGCAGCTGAGATCGG + Intronic
1178952449 21:36996170-36996192 GGACTTTGGGAAGCTGAGGCGGG + Intergenic
1180327812 22:11447364-11447386 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1180595402 22:16969834-16969856 GGAATCTGGTGCACTGAGAGTGG + Intronic
1180781044 22:18519823-18519845 GCACTCTGGGAGGCTGAGACAGG + Intergenic
1181237932 22:21459173-21459195 GCACTCTGGGAGGCTGAGACAGG + Intergenic
1182284269 22:29235099-29235121 GCACTTTGGGGGGCTGAGACGGG + Intronic
1182337548 22:29594550-29594572 GCACTCTGGGGGGCTGAGGCAGG - Intergenic
1182431262 22:30300199-30300221 GCACTCTGGGGAGCCGAGAAGGG + Intronic
1182545395 22:31072706-31072728 GCACTCTGGGGGGCTGAGGCGGG - Intronic
1183132664 22:35854336-35854358 GCACTCTGGGAAGCTGAGTCAGG + Intronic
1183152914 22:36052152-36052174 GCACTCTGGGAGGCTGAGACTGG - Intergenic
1183300849 22:37058419-37058441 GGACTCTTGTGAGATTAGAAGGG + Intronic
1183643790 22:39110325-39110347 GCACTCTGGAGGGCTGAGGCGGG + Intergenic
1183652516 22:39166105-39166127 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1183698907 22:39438602-39438624 GGACTCTGGTGAGCGGAGGACGG - Intergenic
1183899160 22:40992056-40992078 GCACTCTGGGAAGCTGAGGCAGG - Intergenic
1184088452 22:42279958-42279980 GGCCTCTGGGGAGCTGCTACTGG + Intronic
1184254416 22:43278934-43278956 GGACACCTGTGGGCTGAGACAGG + Intronic
1184436249 22:44479195-44479217 GCACTTTGGGGAGCTGAGGCAGG + Intergenic
1185145228 22:49130521-49130543 GGACTTTGGGAGGCTGAGACGGG - Intergenic
1185249735 22:49794418-49794440 GGCCTCTGGTGAGCAGGGCCTGG - Intronic
1203241398 22_KI270733v1_random:23492-23514 GGACTCAGTTGAGATGAGGCTGG + Intergenic
949972808 3:9425637-9425659 AGACTGCAGTGAGCTGAGACAGG - Intronic
950382233 3:12626339-12626361 GGACTCTGGAAGGCTGAGATGGG + Intronic
950743285 3:15066390-15066412 GCACTTTGGGAAGCTGAGACGGG - Intergenic
950782318 3:15402485-15402507 GCACTCTGGGAAGCTGAGGCGGG + Intronic
952057191 3:29462020-29462042 GCACTTTGGGAAGCTGAGACGGG - Intronic
952384754 3:32832218-32832240 GCACTCTGGGAAGCTGAGACAGG + Intronic
952459270 3:33507181-33507203 GCACTCTGGGAAGCTGAGGCAGG - Intronic
952462942 3:33548617-33548639 GAACTCTGGAGAGCTGAAAAAGG - Intronic
952765312 3:36948061-36948083 GCACTTTGGGAAGCTGAGACAGG + Intergenic
953027784 3:39154561-39154583 GGATTCTGGTAAGCAGAGAGAGG - Intronic
953031837 3:39184852-39184874 GGCCTTTGGGGAGCTGACACGGG - Exonic
953313724 3:41906276-41906298 GCACTCTGGGAGGCTGAGACAGG + Intronic
953601603 3:44371302-44371324 GCACTCTGGGAAGCTGAGGCAGG - Intronic
953886654 3:46717910-46717932 GGCCTCTGGTGAGCTGGGTGGGG + Exonic
954738009 3:52722654-52722676 GGACTCTGGGAGGCTGAGGCAGG + Intronic
954850459 3:53595573-53595595 AGACTCTGGTGAGTTGGGTCAGG - Intronic
955029887 3:55205748-55205770 GGACTCTGGTCACCTAAGAAGGG - Intergenic
955265905 3:57444436-57444458 GGACTCTGGGAGGCTGAGATGGG - Intronic
955334152 3:58071198-58071220 GCACTATGGGAAGCTGAGACAGG - Intronic
955600176 3:60636673-60636695 GGACGCTGGAGAGGTGAGAGCGG - Intronic
955738308 3:62062898-62062920 GCACTCTGGGAGGCTGAGACGGG - Intronic
956087361 3:65626568-65626590 GCACTTTGGTAGGCTGAGACAGG - Intronic
956496475 3:69831834-69831856 AGGCTCTGGTGAGCAGAGAAGGG + Intronic
956697129 3:71928099-71928121 GCACTCTGGGGAGCTGAGGTGGG + Intergenic
957546918 3:81650920-81650942 GCACTCTGGGAGGCTGAGACAGG - Intronic
957656273 3:83081318-83081340 GCACTTTGGGAAGCTGAGACAGG + Intergenic
958926446 3:100162725-100162747 GCACTCTGGGAGGCTGAGACGGG + Intronic
960871398 3:122253487-122253509 GCACTATGGGGAGCTGAGGCAGG - Intronic
960883090 3:122365927-122365949 GCACTTTGGGAAGCTGAGACGGG + Intronic
960964354 3:123094553-123094575 GGGCTCTGTGGAGCTGACACGGG - Intronic
961220722 3:125197536-125197558 GCACTCTGCAGGGCTGAGACAGG - Intronic
961470144 3:127106298-127106320 GGACTGGGGTGAGCATAGACTGG - Intergenic
961666714 3:128497416-128497438 GTGCCCTGGTGAGCTGAGAGAGG + Intergenic
961703927 3:128769138-128769160 GCACTCTGGGAAGCAGAGACAGG - Intronic
961770258 3:129244403-129244425 GCACTTTGGGGAGCTGAGGCAGG - Intergenic
961855936 3:129871110-129871132 GCACTTTGGAAAGCTGAGACAGG + Intronic
962306194 3:134288486-134288508 GGACTAGGGTGAGTTGAGAATGG + Intergenic
963063860 3:141246948-141246970 GGACTCTGGTGAGCTGAGACAGG - Intronic
963597234 3:147343644-147343666 GTACTTTGGTAGGCTGAGACAGG - Intergenic
963800976 3:149675949-149675971 GCACTTTGGGAAGCTGAGACGGG - Intronic
963820738 3:149889919-149889941 GGACTCTGGGAGGCTGAGGCGGG - Intronic
964046194 3:152330344-152330366 GGACTTTGGGAGGCTGAGACAGG - Intronic
964518449 3:157538618-157538640 GCACTTTGGGGGGCTGAGACAGG - Intergenic
965279293 3:166727497-166727519 GGACTTTGGGAAGCCGAGACGGG - Intergenic
965470340 3:169082264-169082286 GCACTGTGGGGAGCTGAGCCAGG - Intergenic
965569316 3:170155472-170155494 GCACTTTGGGAAGCTGAGACAGG + Intronic
966136388 3:176703983-176704005 GCACTCTGGAAGGCTGAGACGGG + Intergenic
966171251 3:177083841-177083863 GCACTCTGGGAAGCTGAGGCGGG + Intronic
966262762 3:178000248-178000270 GCACTTTGGGAAGCTGAGACAGG + Intergenic
967325418 3:188233905-188233927 GGACTCTGGAGTGCTGAGCAGGG - Intronic
968127995 3:196174312-196174334 GAACTCTGGGGGGCTGAGGCAGG + Intergenic
968208053 3:196822341-196822363 GGACTCTTGAGTACTGAGACTGG + Intronic
968662687 4:1805291-1805313 GGACCGTGGTGGGCTGAGAGTGG + Intronic
968719760 4:2192719-2192741 GCACTTTGGGAAGCTGAGACAGG + Intronic
968992108 4:3921322-3921344 GGACTTTGGGAAGCTGAGGCGGG - Intergenic
969182587 4:5453655-5453677 GCACTCTGGGAGGCTGAGACGGG + Intronic
969823236 4:9736363-9736385 GGACTTTGGGAAGCTGAGGCGGG + Intergenic
970427325 4:15957617-15957639 AGACTATGGTGAGGTGAGAATGG - Intergenic
971176090 4:24284034-24284056 GCACTCTGGGAGGCTGAGACTGG + Intergenic
971245718 4:24925946-24925968 GCACTCTGGGAGGCTGAGACGGG + Intronic
971698712 4:29939166-29939188 GCACTCTGGGAGGCTGAGACAGG - Intergenic
972310563 4:37878360-37878382 GCACTCTGGGAAGCTGGGACGGG - Intergenic
972510786 4:39766995-39767017 GCACTCTGGGAAGCTGAGGCAGG - Intronic
972534859 4:39991088-39991110 GCACTTTGGGAAGCTGAGACAGG - Intergenic
972649114 4:40999192-40999214 GTACTCTGGGAGGCTGAGACAGG + Intronic
972676640 4:41266166-41266188 GCACTCTGGGAAGCTGAGGCAGG - Intronic
972692539 4:41413582-41413604 GGACACTGAGAAGCTGAGACAGG - Intronic
974003228 4:56531117-56531139 GGGCTCTGGTGATCAGAGAGGGG - Exonic
974007589 4:56574171-56574193 GCACTCTGGGAGGCTGAGACGGG + Intronic
974566548 4:63584107-63584129 GCACTTTGGGAAGCTGAGACAGG - Intergenic
974808653 4:66916659-66916681 GCACTCTGGGAGGCTGAGACGGG - Intergenic
975120836 4:70726616-70726638 GCACTCTGGGAAGCTGAGGCGGG - Intronic
975627843 4:76367636-76367658 TGACTCTGGAGAGCTCAGAGAGG - Exonic
976245178 4:83000138-83000160 GCACTTTGGAGAGCTGAGGCAGG - Intronic
976518236 4:85996160-85996182 GGATTCAGATGAGCTGAGAGAGG + Intronic
977250515 4:94683509-94683531 GCACTCTGGGAGGCTGAGACTGG - Intergenic
977723724 4:100270188-100270210 GCACTCTGGGAGGCTGAGACAGG - Intergenic
977806055 4:101299197-101299219 GGACTTTGGGAGGCTGAGACGGG - Intronic
978068569 4:104437453-104437475 GGACTCTGGGAGGCTGAGGCAGG + Intergenic
978303497 4:107295648-107295670 GTTCTCTGGTGAGCAGAGGCAGG + Intergenic
978371366 4:108032734-108032756 GCACTTTGGGAAGCTGAGACGGG + Intronic
978767328 4:112417730-112417752 GGACTTTGGGAAGCTGAGGCAGG - Intronic
978895311 4:113879745-113879767 GCACTCTGGGAGGCTGAGACAGG + Intergenic
978939250 4:114416686-114416708 GGACTCTGGGAAACTGAGGCAGG - Intergenic
979333993 4:119446363-119446385 GCACTTTGGGGGGCTGAGACAGG - Intergenic
979470052 4:121084896-121084918 GGGCTCTGTGGAGCTGAAACTGG - Intergenic
980057253 4:128090017-128090039 GCACTTTGGTAGGCTGAGACAGG - Intronic
980612937 4:135182714-135182736 GGACTTTGACGAGCTGAGAGAGG - Intergenic
980774884 4:137424903-137424925 GGACTTTGGAAAGCTGAGGCGGG - Intergenic
981215734 4:142164842-142164864 GCACTTTGGGAAGCTGAGACAGG - Intronic
982996317 4:162352118-162352140 GCACTTTGGTTGGCTGAGACAGG - Intergenic
983644788 4:169978715-169978737 GCACTTTGGAAAGCTGAGACGGG - Intergenic
983844496 4:172500172-172500194 GCACTTTGGGAAGCTGAGACAGG + Intronic
984990907 4:185380067-185380089 GCACACTGGGAAGCTGAGACAGG - Intronic
985285234 4:188330395-188330417 GGACTTTGGGAAGCTGAGACGGG - Intergenic
985680062 5:1251339-1251361 GCACTCTGGGAAGCTGAGGCCGG + Intergenic
986242718 5:5975739-5975761 GGACTCAAGTGATCTGAGACTGG - Intergenic
986260732 5:6143755-6143777 GGACTCTTGTGGGCTGAGGCTGG - Intergenic
987191181 5:15480034-15480056 GGACTCTGGGAAGCCGAGATGGG - Intergenic
989069797 5:37498066-37498088 GGACTTTGGGAGGCTGAGACTGG - Intronic
990313625 5:54564032-54564054 GCACTCTGGGAAGCTGAGGCAGG + Intergenic
990976937 5:61568779-61568801 GCACTTTGGGAAGCTGAGACTGG - Intergenic
991200348 5:63984724-63984746 AGATTGTGGTGAGCTGAGATCGG + Intergenic
992762708 5:79965230-79965252 GCACTTTGGAAAGCTGAGACGGG + Intergenic
992794966 5:80247702-80247724 GCTCACTGGTGAGCTGATACAGG - Intronic
992803213 5:80311864-80311886 GGACTTTGGGAAGCCGAGACAGG - Intergenic
992963555 5:81979144-81979166 GCACTTTGGGAAGCTGAGACAGG - Intronic
992964577 5:81986795-81986817 GCACTCTGGGAAGCTGAGGCTGG + Intronic
993022280 5:82605805-82605827 GGGCTGTGGTGAGCAGGGACTGG - Intergenic
993482824 5:88446219-88446241 GCACTTTGGGAAGCTGAGACAGG + Intergenic
993906990 5:93634154-93634176 GGACTTTGGGAAGCTGAGGCGGG + Intronic
993912951 5:93706619-93706641 GGACTTTGGGCAGCCGAGACTGG + Intronic
994410940 5:99406860-99406882 GCACTCTGGGAAGCTGAGGCGGG + Intergenic
994455230 5:99997352-99997374 GGAGTCTGGTGTTCTGAAACTGG + Intergenic
994460630 5:100065098-100065120 GCACTCTGGGAAGCCGAGACAGG + Intergenic
995212471 5:109556270-109556292 GGACTTTGGGAAGCTGAGGCGGG + Intergenic
995445849 5:112242965-112242987 GCACTTTGGGGAGCTGAGGCAGG + Intronic
995648018 5:114335167-114335189 GCACTCTGGGAGGCTGAGACTGG - Intergenic
995782821 5:115796056-115796078 GCACTCTGGGGAGCTGAAGCAGG + Intergenic
995850863 5:116544543-116544565 GCACTTTGGTAAGCTGAGACGGG - Intronic
996557851 5:124797418-124797440 GGACTTTGGGAAGCTGAGGCAGG - Intergenic
996714472 5:126576013-126576035 GCACTCTGGGGGGCCGAGACGGG + Intronic
996720587 5:126626345-126626367 GCACTCTGGGAGGCTGAGACAGG + Exonic
997058290 5:130470669-130470691 GGACTTTGGGAGGCTGAGACGGG - Intergenic
997099039 5:130947556-130947578 GCACTTTGGAAAGCTGAGACAGG + Intergenic
997379615 5:133426285-133426307 GGAGTCTGGGGAGGTGAGAGGGG + Intronic
997567597 5:134901655-134901677 GGACTTTGGGAAGCTGAGGCAGG + Intergenic
997987861 5:138518131-138518153 GGCTTGTGGTGAGCTGAGATCGG + Intronic
997989079 5:138528898-138528920 GGACTTTGGGAAGCCGAGACAGG + Intronic
998024449 5:138803047-138803069 GCACTCTGGGAAGCTGAGGCAGG - Intronic
998024852 5:138807252-138807274 GGACTTTGGGAGGCTGAGACCGG - Intronic
998153447 5:139770308-139770330 GCACTTTGGGGAGCTGAGGCAGG + Intergenic
998265113 5:140662121-140662143 GGCCTCAGGTGAGCTTAGATGGG + Intronic
998279704 5:140794460-140794482 GGACTGTGGTTACCAGAGACTGG + Intronic
998361760 5:141594493-141594515 GCACTCTGGGAGGCTGAGACGGG + Intronic
998455619 5:142270419-142270441 GCACTCTGGGAGGCTGAGACGGG + Intergenic
998997802 5:147884913-147884935 GCACTCTGGGAAGCTGAGGCAGG - Intronic
999147858 5:149407628-149407650 GGATGCTGGTGAGAGGAGACGGG + Intergenic
999756239 5:154666701-154666723 GGACTTTGGGAAGCTGAGGCAGG + Intergenic
1000540630 5:162535267-162535289 GCACTTTGGGAAGCTGAGACGGG + Intergenic
1000787525 5:165564276-165564298 GGAATCTGGTGAGAGGTGACTGG - Intergenic
1001094827 5:168768035-168768057 TGCCTTTGGTGAGTTGAGACTGG + Intronic
1001436512 5:171703514-171703536 GGAGGCTGGAGAGCTGGGACTGG - Intergenic
1002126132 5:177045735-177045757 GCACTCTGGGAAGCTGAGATGGG - Intronic
1003090331 6:3096803-3096825 GCACTCTGGGAGGCTGAGACGGG - Intronic
1003285683 6:4732086-4732108 GCACTCTGGGAGGCTGAGACAGG + Intronic
1003392919 6:5728885-5728907 GGACAGTGGTGAGCTCAGGCAGG - Intronic
1003548193 6:7078893-7078915 GCACTTTGGGAAGCTGAGACGGG + Intergenic
1004725771 6:18309821-18309843 GCACTCTGGGGGGCTGAGGCAGG + Intergenic
1005564359 6:27075269-27075291 GGACTTTGGGAAGCTGAGGCAGG - Intergenic
1006532161 6:34665207-34665229 GCACTCTGGGAGGCTGAGACAGG + Intronic
1007037480 6:38689698-38689720 GCACTTTGGGGGGCTGAGACGGG + Intronic
1007234760 6:40382583-40382605 GGACCCTGGAGAGTTGAGACGGG - Intergenic
1007625611 6:43244561-43244583 GGACTATGCTCAGCTGAGACTGG - Intronic
1007650247 6:43415171-43415193 GCACTCTGGGAGGCTGAGACGGG + Intergenic
1007666821 6:43518924-43518946 GCACTCTGGGAGGCTGAGACGGG - Intronic
1008117896 6:47573733-47573755 GCACTCTGGGAGGCTGAGACTGG - Intronic
1008275891 6:49543975-49543997 GGACTCTGGGAGGCTGAGGCGGG + Intergenic
1010690209 6:78902377-78902399 GCACTCTGGGAAGCTGAGGCAGG - Exonic
1011151395 6:84277331-84277353 GGACTCTGGGAAGCTAAGACGGG - Intergenic
1011484504 6:87828234-87828256 GGCCCCTGGTGAGAGGAGACTGG + Intergenic
1011601986 6:89068244-89068266 GGACTTTGGAAGGCTGAGACGGG + Intergenic
1011632016 6:89336577-89336599 GGACTTTGGGAAGCTGAGGCAGG - Intronic
1011744126 6:90392842-90392864 GCACTCTGGGGGGCTGAGGCGGG - Intergenic
1011883304 6:92059083-92059105 GCACTTTGGGAAGCTGAGACCGG + Intergenic
1011883318 6:92059203-92059225 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1011883332 6:92059323-92059345 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1013005875 6:106072904-106072926 TGACTCTGGTGGGCTGAGGAAGG + Intergenic
1013052938 6:106554751-106554773 ATACTCTAGTGAGCTGAGACAGG - Intronic
1013270418 6:108540489-108540511 GTACTATGGGGAGCTGAGGCAGG + Intergenic
1013415162 6:109918243-109918265 GCACTCTGGGAAGCTGAGGCGGG - Intergenic
1013579225 6:111516188-111516210 GGACTCTGGGAGGCTGAGGCAGG - Intergenic
1013685798 6:112580518-112580540 GGACTTTGGGAGGCTGAGACAGG - Intergenic
1014021915 6:116601016-116601038 GGACTATGGTGAGATGAGTGAGG - Intergenic
1014207538 6:118672518-118672540 GCACTCTGGGAGGCTGAGACAGG + Intronic
1014260922 6:119216099-119216121 GGCCTCTGGAGAGCTGATGCAGG + Intronic
1014433038 6:121391516-121391538 GGACTCTGGGAGGCTGAGGCAGG + Intergenic
1014756932 6:125311617-125311639 GGACTTTGGTAGGCTGAGGCAGG - Intergenic
1015263531 6:131265379-131265401 GAACTTTGGGGAGCTGAGGCGGG - Intronic
1016037464 6:139397732-139397754 GCACTCTGGGAGGCTGAGACAGG - Intergenic
1016098348 6:140065830-140065852 GAACTTTGGGGAGCTGAGGCAGG + Intergenic
1016282997 6:142440540-142440562 GGACTCTGGGAGGCTGAGGCAGG - Intronic
1016541093 6:145165774-145165796 GGACTCTGGGAGGCTGAGGCGGG + Intergenic
1016654863 6:146507176-146507198 GGATTCTGGTGAGTAGAGAGGGG + Intergenic
1016674449 6:146748028-146748050 GGACTTTGGGAGGCTGAGACAGG - Intronic
1016808431 6:148236456-148236478 GCACTCTGGGAGGCTGAGACAGG - Intergenic
1016824793 6:148378298-148378320 GGACTCTGGGAGGCTGAGGCGGG - Intronic
1016828579 6:148410911-148410933 GCACTTTGGGGGGCTGAGACGGG + Intronic
1017042883 6:150322118-150322140 GGAGTCTGCTGAGGTGACACAGG + Intergenic
1017789468 6:157783887-157783909 GCACTCTGGGAAGCTGAGGCGGG - Intronic
1018337991 6:162816596-162816618 GCACTTTGGGAAGCTGAGACAGG - Intronic
1018385979 6:163303760-163303782 GCACTTTGGGGGGCTGAGACGGG + Intronic
1018885647 6:167933975-167933997 GGACTCTGGGGAGCTTTGTCAGG + Intronic
1019299361 7:295717-295739 GGCCCCTGGTGGGCTGGGACTGG + Intergenic
1019543882 7:1563716-1563738 GCACTTTGGGGGGCTGAGACAGG + Intergenic
1019686029 7:2382753-2382775 GCACTCTGGTTAGCTCAGCCTGG + Intergenic
1020029614 7:4923796-4923818 GTGCTCTGCTGAGCAGAGACTGG - Intronic
1020745956 7:12077998-12078020 GGACTTTGGGGGGCTGAGGCGGG - Intergenic
1020792640 7:12645071-12645093 GCACTTTGGGAAGCTGAGACGGG + Intronic
1021446615 7:20740858-20740880 GGACTTTGGGAGGCTGAGACGGG + Intronic
1021709588 7:23401860-23401882 GGAATTTGGTTGGCTGAGACAGG + Intronic
1021727733 7:23565742-23565764 GCACTCTGGGAAGCTGAGGCGGG - Intergenic
1022127852 7:27375394-27375416 TGAGACTGGGGAGCTGAGACAGG + Intergenic
1022162373 7:27724708-27724730 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1022173057 7:27847912-27847934 GGACTTTGGGAGGCTGAGACGGG - Intronic
1022407489 7:30104970-30104992 GCACTCTGGGAGGCTGAGACAGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1022953403 7:35360091-35360113 GTCATCTGGTGAACTGAGACTGG + Intergenic
1023378414 7:39581623-39581645 GCACTTTGGGAAGCTGAGACAGG + Intronic
1023952257 7:44855872-44855894 CTACTCGGGGGAGCTGAGACAGG + Intergenic
1024070064 7:45777334-45777356 GCACTTTGGGGGGCTGAGACAGG + Intergenic
1024094316 7:45972218-45972240 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1024340541 7:48253728-48253750 GCACTCTGGGAAGCTGAGGCAGG - Intronic
1024622841 7:51177525-51177547 GCACTCTGGGGGGCTGAGGCGGG + Intronic
1025031321 7:55559451-55559473 GGGCCCTGGTCAGCTGAGCCAGG - Intronic
1025079946 7:55972854-55972876 GGACTTTGGGAAGCTGAGGCAGG + Intronic
1025244543 7:57306567-57306589 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1025856491 7:65284730-65284752 GCACTTTGGGAAGCTGAGACGGG + Intergenic
1025965938 7:66271421-66271443 GCACTCTGGGAAGCTGAGGCGGG - Intronic
1026231293 7:68486178-68486200 GCACTTTGGGGGGCTGAGACGGG + Intergenic
1026297582 7:69068412-69068434 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1026782018 7:73274624-73274646 GCACTCTGGTAGGCTGAGGCTGG - Intergenic
1026872569 7:73862041-73862063 GCACTTTGGGGAGCTGAGGCGGG - Intronic
1026916443 7:74122641-74122663 GCACTCTGGGAGGCTGAGACAGG + Intergenic
1027065145 7:75117834-75117856 GCACTCTGGTAGGCTGAGGCTGG + Intronic
1027153729 7:75751649-75751671 GAACTTTGGGAAGCTGAGACAGG + Intergenic
1027167384 7:75844819-75844841 GCACTTTGGGAAGCTGAGACGGG - Intronic
1027398920 7:77787619-77787641 GCACTCTGGGAAGCTGAGGCGGG - Intergenic
1027614081 7:80399788-80399810 GGACTTTGGGAAGCTGAGGCAGG + Intronic
1028666580 7:93350776-93350798 GGACCCTGATAAGGTGAGACTGG + Intronic
1028905951 7:96154541-96154563 GCACTCTGGGGGGCTGAGGCAGG - Intronic
1029136717 7:98378035-98378057 GAACTGTGGGAAGCTGAGACAGG + Intronic
1029202841 7:98850658-98850680 GGACTCTGGGAGGCTGAGGCGGG - Intronic
1029417766 7:100454160-100454182 GCACTTCGGGGAGCTGAGACAGG + Intergenic
1029628694 7:101736742-101736764 GGACTTTGGGAAGCTGAGGCTGG - Intergenic
1029632581 7:101762342-101762364 GCACTCTGGGGGGCTGAGGCGGG + Intergenic
1029996284 7:105011909-105011931 GCACTTTGGGAAGCTGAGACGGG + Intergenic
1030070335 7:105692691-105692713 GCACTCTGGGAGGCTGAGACGGG - Intronic
1030085590 7:105812752-105812774 GCACTCTGGGAGGCTGAGACGGG + Intronic
1030133612 7:106224356-106224378 GTACTCTGGGAGGCTGAGACAGG - Intergenic
1030138000 7:106276594-106276616 GCACTTTGGTGGGCCGAGACAGG + Intronic
1030350675 7:108482222-108482244 GTACTTTGGGGAGCTGAGGCAGG + Intronic
1032047455 7:128621621-128621643 GCACTTTGGGGGGCTGAGACAGG + Intergenic
1032053016 7:128661353-128661375 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1032110122 7:129068807-129068829 GGACTTTGGGGGGCTGAGGCAGG + Intergenic
1032336845 7:131033064-131033086 GCACTCTGGGAAGCTGAGGCGGG + Intergenic
1032350723 7:131160774-131160796 GGACTTTGGGAGGCTGAGACAGG - Intronic
1032541063 7:132703709-132703731 GCACTTTGGGAAGCTGAGACAGG - Intronic
1032844574 7:135741575-135741597 GGACTTTGGGAAGCTGAGGCGGG + Intronic
1033103765 7:138500311-138500333 GCACTCTGGGAGGCTGAGACAGG + Intronic
1033128245 7:138723634-138723656 GTACTCAGGAGAGCTGAGGCTGG - Intronic
1033443937 7:141404057-141404079 GCACTCTGGGGGGCCGAGACGGG + Intronic
1034513599 7:151555630-151555652 GCACTCTGGTAGGCTGAGGCAGG + Intergenic
1034651956 7:152698429-152698451 GCACTTTGGGAAGCTGAGACCGG - Intergenic
1035190715 7:157165643-157165665 GCACTTTGGGAAGCTGAGACAGG - Intronic
1036392313 8:8334195-8334217 GTACTTTGGTGAGCTGAGGCAGG + Intronic
1036530695 8:9583731-9583753 GGACTTTGGGAGGCTGAGACAGG - Intronic
1036804986 8:11824979-11825001 GCACTTTGGGAAGCTGAGACGGG - Intronic
1036944178 8:13079188-13079210 GCACTCTGGGAAGCTGAGGCAGG - Intergenic
1037057066 8:14456160-14456182 GGACTTTGGGAAGCTGAGGCAGG + Intronic
1037485273 8:19340842-19340864 GCACTCTGGGAGGCTGAGACAGG - Intronic
1037695587 8:21221331-21221353 GAACTGTGGGGAGCTGGGACAGG - Intergenic
1038017110 8:23524503-23524525 GGACTTTGGGAAGCTGAGGCAGG + Intergenic
1038513669 8:28164517-28164539 GGACTCTAGTGAGTTCAGAAGGG + Intronic
1038594473 8:28874537-28874559 GCACTTTGGGAAGCTGAGACAGG - Intronic
1038802637 8:30763090-30763112 GGACTTTGGGAGGCTGAGACAGG - Intronic
1038987103 8:32823509-32823531 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1039061809 8:33577852-33577874 GCACTCTGGGAGGCTGAGACTGG - Intergenic
1039108981 8:34021255-34021277 GCACTCTGGGAGGCTGAGACAGG + Intergenic
1039115036 8:34083697-34083719 GGACTCTGATGGGCTGAGGATGG + Intergenic
1039321901 8:36441255-36441277 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1039468147 8:37797860-37797882 GGACTTTGGGGACCTGAGAAGGG + Intronic
1039616172 8:38956551-38956573 GGACTTTGGGAAGCTGAGGCAGG + Intronic
1039773212 8:40709790-40709812 GGACTCTGGGAGGCTGAGGCTGG + Intronic
1040279747 8:46033589-46033611 GCACTTTGGTAGGCTGAGACGGG + Intergenic
1041240083 8:55841868-55841890 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1041497481 8:58503025-58503047 GCACTTTGGGGAGCTGAGACGGG - Intergenic
1041925880 8:63235814-63235836 GGACTTTGGGTGGCTGAGACAGG + Intergenic
1042593085 8:70417159-70417181 GAACTCTGGAAGGCTGAGACAGG + Intergenic
1042745133 8:72098953-72098975 GCACTTTGGTGACCTGAGATGGG + Intronic
1042930921 8:74013532-74013554 GCACTCTGGGAAGCTGAGGCAGG - Intronic
1042935979 8:74058764-74058786 GGACTTTGGGAAGCTGAGGCGGG - Intergenic
1043165236 8:76895058-76895080 GAAGTCTTGTGAGGTGAGACAGG + Intergenic
1043508191 8:80923396-80923418 GCACTTTGGGGAGCTGAGAAGGG - Intergenic
1044651380 8:94499245-94499267 GCACTCTGGTGGGCTGAGGTGGG - Intronic
1044688533 8:94853063-94853085 GCACTTTGGGGAGCTGAGATGGG + Intronic
1045619651 8:103959668-103959690 GCACTCTGGGAAGCTGAGGCAGG - Intronic
1046872860 8:119222579-119222601 GGACTTTGGGAAGCTGAGGCAGG + Intronic
1046928054 8:119814645-119814667 GCACTCTGGGAGGCTGAGACAGG + Intronic
1047277344 8:123416412-123416434 GGGCTCTGGTGGGCGGAGTCAGG - Intergenic
1047607671 8:126491035-126491057 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1047718637 8:127618854-127618876 GCACTTTGGGAAGCTGAGACAGG - Intergenic
1048256481 8:132908786-132908808 GGACGCTGGTGAGATGAGAGGGG + Intronic
1049551762 8:143263259-143263281 GGAATCTGGTGTGCAGAGGCGGG + Intronic
1049614046 8:143568657-143568679 GGACTCTGGTGCGCCGGGGCCGG - Exonic
1050076658 9:1872783-1872805 GGAGGGTGGTGAGCAGAGACTGG - Intergenic
1050366066 9:4874930-4874952 GCACTTTGGGGAGCTGAGTCAGG - Intronic
1050738064 9:8787080-8787102 GCACTTTGGGAAGCTGAGACAGG - Intronic
1050806968 9:9693268-9693290 GGAATCTGGTGAGAAGTGACTGG + Intronic
1052426809 9:28315156-28315178 GCACTCTGGGAAGCTGAGGCGGG + Intronic
1052461724 9:28773117-28773139 GCACTCTGGGAGGCTGAGACGGG + Intergenic
1052595345 9:30550833-30550855 GCACTCTGGGAGGCTGAGACGGG + Intergenic
1052939314 9:34119951-34119973 GCACTTTGGGAAGCTGAGACAGG - Intronic
1053326140 9:37153415-37153437 GCACTTTGGTAGGCTGAGACTGG - Intronic
1053819663 9:41953379-41953401 GGAGTCTGCTGAGCAGAAACGGG + Exonic
1054109930 9:61097032-61097054 GGAGTCTGCTGAGCAGAAACGGG + Intergenic
1054610927 9:67234093-67234115 GGAGTCTGCTGAGCAGAAACGGG - Intergenic
1054774214 9:69111341-69111363 GCACTTTGGGAAGCTGAGACGGG + Intergenic
1054942907 9:70763261-70763283 GGACTTTGGGAAGCTGAGGCAGG + Intronic
1055323475 9:75104426-75104448 GCACTTTGGGAAGCTGAGACAGG + Intronic
1055909533 9:81332213-81332235 AGACTGCGGTGAGCTGAGATTGG + Intergenic
1056361898 9:85866864-85866886 GCACTTTGGGGGGCTGAGACAGG + Intergenic
1056390282 9:86134774-86134796 GCACTCTGGGAGGCTGAGACGGG + Intergenic
1056582107 9:87896654-87896676 GGACTTTGGGAGGCTGAGACAGG + Intergenic
1057727653 9:97579530-97579552 GCACTCTGGGAAGCTGAGGCAGG - Intronic
1058706380 9:107640999-107641021 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1058713765 9:107704368-107704390 GCACTCTGGGGGGCTGAGGCGGG - Intergenic
1059106251 9:111514356-111514378 GGACTCTGGGAGGCTGAGGCAGG - Intergenic
1059448100 9:114351564-114351586 GCACTCTGGGAGGCTGAGACGGG + Intronic
1059704916 9:116813786-116813808 GCACTTTGGGGGGCTGAGACTGG + Intronic
1060022121 9:120140737-120140759 GGACTATGGTGAGATGGGAGGGG - Intergenic
1060655463 9:125369621-125369643 GTACTTTGGGAAGCTGAGACAGG - Intergenic
1060774261 9:126359114-126359136 GCACTCTGGGAAGCTGAGACTGG - Intronic
1061047552 9:128174902-128174924 GCACTCTGGGAAGCTGAGATGGG - Intronic
1061136836 9:128739552-128739574 GCACTTTGGGAAGCTGAGACAGG - Intronic
1061605706 9:131709100-131709122 GCACTTTGGGAAGCTGAGACAGG + Intronic
1061847896 9:133398115-133398137 GGCCTGTGGGGAGCTGAGGCTGG + Intronic
1061938078 9:133869357-133869379 GCACTCTGGGAGGCTGAGACGGG + Intronic
1062041622 9:134407031-134407053 GGACTCAGGTGGGCTGCGAGAGG - Intronic
1062186091 9:135219314-135219336 GCACTTTGGGGGGCTGAGACAGG + Intergenic
1062289642 9:135788812-135788834 GGACTCTGCTGAGCACTGACGGG - Intronic
1203457719 Un_GL000220v1:6565-6587 GGACTCAGTTGAGATGAGGCTGG + Intergenic
1185585528 X:1239834-1239856 GGGTTCTGGGGAGCTGAGACAGG + Intergenic
1185626414 X:1485970-1485992 GCACTTTGGGAAGCTGAGACAGG + Intronic
1185864125 X:3607751-3607773 GGACTTTGGGAAGCTGAGGCAGG - Exonic
1186358592 X:8813941-8813963 GGACTCTGGTGAGATGATTGAGG - Intergenic
1187193624 X:17060052-17060074 GCACTCTGGGAAGCTGAGGCAGG + Intronic
1187364964 X:18659225-18659247 GCACTTTGGGAAGCTGAGACAGG + Intronic
1187877358 X:23815424-23815446 GTACTCTGGAAAACTGAGACGGG - Intergenic
1188638415 X:32465828-32465850 GCACTCTGGGCAGCTGAGGCAGG - Intronic
1188847592 X:35092581-35092603 GCACTTTGGGAAGCTGAGACAGG + Intergenic
1189279665 X:39812313-39812335 GGACTTTGGGGGGCTGAGGCAGG - Intergenic
1189295735 X:39916225-39916247 GGACTTTGGGAGGCTGAGACAGG + Intergenic
1189455380 X:41183183-41183205 GCACTCTGGGAAGCTGAGGCAGG - Intronic
1189914720 X:45845485-45845507 GCACTTTGGTGGGCTGAGGCAGG + Intergenic
1190209228 X:48431421-48431443 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1190725607 X:53188619-53188641 GCACTTTGGGAAGCTGAGACGGG - Intergenic
1190831225 X:54061055-54061077 GAACTTTGGGGAGCTGAGGCGGG + Intergenic
1190840586 X:54140370-54140392 GCACTTTGGTAAGCTGAGGCGGG + Intronic
1190850328 X:54234125-54234147 GCACTCTGGGAGGCTGAGACAGG + Intronic
1191792659 X:64987172-64987194 GCACTTTGGGAAGCTGAGACGGG - Intronic
1192144872 X:68675338-68675360 GCACTTTGGGAAGCTGAGACGGG - Intronic
1192453954 X:71262188-71262210 GCACTCTGGGAAGCTGAGGCTGG - Intergenic
1192798940 X:74447730-74447752 GCACTCTGGAAAGCTGAGGCGGG + Intronic
1193161583 X:78234712-78234734 GGCCTTTGGTGAGCTGAGAATGG - Intergenic
1193391826 X:80937708-80937730 TGACTTTGATGAGCTGAGAGAGG + Intergenic
1194430471 X:93797747-93797769 GAACTCTGGAAGGCTGAGACAGG + Intergenic
1194743333 X:97602160-97602182 AGACTCTGGTGGGCTAAGAGTGG - Exonic
1195063149 X:101216158-101216180 GCACTTTGGTGGGCTGAGGCAGG - Intergenic
1195718619 X:107843630-107843652 GGACTTTGGGGAGGTGAGAGAGG + Intronic
1195921555 X:109988933-109988955 GCACTCTGGGAAGCTGAGGCAGG + Intergenic
1196288065 X:113905665-113905687 GCACTCTGGAAGGCTGAGACAGG - Intergenic
1196438911 X:115700914-115700936 GCACTTTGGTAAGCTGAGGCGGG + Intergenic
1196835449 X:119809472-119809494 GCACTTTGGGAAGCTGAGACTGG + Intergenic
1197291338 X:124662206-124662228 GCACTTTGGGAAGCTGAGACGGG + Intronic
1197378899 X:125714118-125714140 GGACACTGGTGGGGTGAGGCTGG - Intergenic
1197621885 X:128759871-128759893 TGACTCAGGTTAGCTTAGACTGG - Intergenic
1197876543 X:131114808-131114830 TGACTCAGGTGTGCTGAGTCAGG - Intergenic
1197994759 X:132361294-132361316 GCACTTTGGGGGGCTGAGACGGG + Intergenic
1198823746 X:140677265-140677287 AGGTTATGGTGAGCTGAGACTGG - Intergenic
1198882110 X:141292812-141292834 GGACTCTGGGGGGCCGAGGCGGG - Intergenic
1200077845 X:153560496-153560518 GGACTCTGGTTGGTTGAGCCTGG + Intronic
1200749276 Y:6929893-6929915 GGTCTCTGGAGAGTGGAGACAGG - Intronic
1200764189 Y:7066610-7066632 GCACTTTGGGAAGCTGAGACAGG - Intronic
1201524548 Y:14917350-14917372 GGACTTTGGGAAGCTGAGCCTGG + Intergenic
1201560245 Y:15308690-15308712 GGACTTTGGGAGGCTGAGACAGG - Intergenic
1202050661 Y:20777152-20777174 GCACTCTGGGGAGTTGAGGCGGG - Intronic