ID: 963064530

View in Genome Browser
Species Human (GRCh38)
Location 3:141252971-141252993
Sequence CTGGCCTCCTTGGGGAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963064530_963064540 2 Left 963064530 3:141252971-141252993 CCAGTATTCCCCAAGGAGGCCAG 0: 1
1: 0
2: 1
3: 25
4: 150
Right 963064540 3:141252996-141253018 GTTGGGAGGAGATAGGACCCTGG 0: 1
1: 1
2: 2
3: 27
4: 442
963064530_963064541 17 Left 963064530 3:141252971-141252993 CCAGTATTCCCCAAGGAGGCCAG 0: 1
1: 0
2: 1
3: 25
4: 150
Right 963064541 3:141253011-141253033 GACCCTGGCCCTAGAAAATAAGG 0: 1
1: 0
2: 0
3: 17
4: 214
963064530_963064545 22 Left 963064530 3:141252971-141252993 CCAGTATTCCCCAAGGAGGCCAG 0: 1
1: 0
2: 1
3: 25
4: 150
Right 963064545 3:141253016-141253038 TGGCCCTAGAAAATAAGGGTAGG 0: 1
1: 0
2: 1
3: 6
4: 111
963064530_963064538 -5 Left 963064530 3:141252971-141252993 CCAGTATTCCCCAAGGAGGCCAG 0: 1
1: 0
2: 1
3: 25
4: 150
Right 963064538 3:141252989-141253011 GCCAGGTGTTGGGAGGAGATAGG 0: 1
1: 0
2: 6
3: 75
4: 585
963064530_963064542 18 Left 963064530 3:141252971-141252993 CCAGTATTCCCCAAGGAGGCCAG 0: 1
1: 0
2: 1
3: 25
4: 150
Right 963064542 3:141253012-141253034 ACCCTGGCCCTAGAAAATAAGGG 0: 1
1: 0
2: 0
3: 20
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963064530 Original CRISPR CTGGCCTCCTTGGGGAATAC TGG (reversed) Intronic
901838368 1:11938590-11938612 CTGGCCTCTTTGGGGGCTGCTGG - Intronic
903377815 1:22877393-22877415 CTGGGCACCATGGGGCATACGGG + Intronic
904120474 1:28194468-28194490 CTGGCCTCCTGTGGGCAAACTGG - Intergenic
904300381 1:29550048-29550070 CTAGCCTCCTTGGGGAACTGGGG + Intergenic
905038470 1:34932090-34932112 CTAGCCTCTTGGGGGCATACAGG + Intergenic
906885836 1:49647567-49647589 CAGGTCTTCTTGGTGAATACTGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
912260561 1:108107973-108107995 ATGTCTTCCTTGGGGAATTCTGG - Intergenic
912764523 1:112396423-112396445 GCCGCCTCCTCGGGGAATACCGG - Intronic
913245737 1:116868554-116868576 CTGGCTTCCCTGGGGGATGCAGG - Intergenic
913657426 1:120974647-120974669 CTGGCCTGCTTTGAGTATACCGG - Intergenic
914008775 1:143757729-143757751 CTGGCCTGCTTTGAGTATACCGG - Intergenic
914647405 1:149666382-149666404 CTGGCCTGCTTTGAGTATACCGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
919821445 1:201475514-201475536 GTGCCCACCTTGGGGAATCCTGG - Intergenic
921159818 1:212464914-212464936 GTGGCCTCCTTGGGCAAGCCAGG - Intergenic
921959803 1:221022710-221022732 CTGGCATCCTAGGGTAAAACAGG - Intergenic
1067578827 10:47426247-47426269 ATTACCTCCTTGGGGAATGCTGG - Intergenic
1068709906 10:60122458-60122480 CTGGCCTCCATCAGGAATAAAGG + Intronic
1076427847 10:130380213-130380235 CTGGCCTCTGTGGGGAAGAGGGG + Intergenic
1077446447 11:2593240-2593262 CTGGCCTCCTAGGGGCATTCAGG - Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1077899848 11:6479447-6479469 ATGGCCTCCTTGGGGGTTAGAGG + Intronic
1081839078 11:46182794-46182816 CTGGCCTCCTTCAGCAAGACTGG - Intergenic
1081861459 11:46335532-46335554 CTGGCATCCTTGGTGATTACAGG - Intronic
1083467711 11:62859828-62859850 CTGGCCCCCTTCAGGATTACAGG - Intronic
1083506747 11:63164959-63164981 CTGCCCTCCTTGCAGAAAACAGG + Intronic
1084490364 11:69475172-69475194 CTTGCCTCCTTGAGGAGTTCAGG + Intergenic
1084648456 11:70474292-70474314 ATGGCCACCCTGGGGAAGACAGG - Intronic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1086899060 11:92345724-92345746 CTTGCCTCCTTTAGGAATGCAGG - Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1089561677 11:119346298-119346320 CTGGCATCCTCTGGGAAAACTGG + Exonic
1091786399 12:3245605-3245627 CTGGCCTCCTTGCAGTATATCGG + Intronic
1092955966 12:13550288-13550310 CTCCCCTCCTTGGGGAATGGTGG - Exonic
1094741607 12:33296160-33296182 ATGGACTCCTTGAGAAATACAGG + Intergenic
1096007536 12:48184616-48184638 CTGGTCTCCTTGGGGGGGACGGG + Exonic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098749647 12:74278080-74278102 CAGGTCTCCTTGGGGAAGAATGG - Intergenic
1099255779 12:80309677-80309699 CTGGCTTCCTGGGTGGATACTGG + Intronic
1099960641 12:89393669-89393691 CTGTCCTCGTTGGGAAATTCAGG - Intergenic
1100985303 12:100197899-100197921 CTGGCTTCCTTCGGGGAAACAGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1104475799 12:129069360-129069382 CTGGCTTCCTTGGGGAAATTTGG + Intergenic
1104798356 12:131535862-131535884 CTGGCATCCTTGGGGGCTCCTGG + Intergenic
1106855712 13:33849622-33849644 TCGGCCTCCTTTGGGATTACAGG - Intronic
1108085878 13:46792876-46792898 CTGGTTTCCTTGTGGAATAATGG - Intronic
1108520646 13:51244115-51244137 TTGGCCTCGTCGGGGATTACTGG + Intronic
1110345505 13:74443156-74443178 TTGGCTTCCTTGGGGCACACTGG - Intergenic
1114204850 14:20559573-20559595 CTGGCCTACCTGTGGAATGCAGG + Exonic
1115164658 14:30434831-30434853 CTGAGCTCCTTGGTGGATACTGG + Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1119162925 14:72468135-72468157 CTGCCCACCTTGGGGATTACAGG - Intronic
1122139312 14:99652871-99652893 GTGGCTTCCTTGGGGAACCCGGG + Intronic
1122679628 14:103448182-103448204 CTGGCCTCTTTGGGGATGAAGGG - Intronic
1128486416 15:68094959-68094981 CTGGATGCCTTGGGGAATTCTGG - Intronic
1128492826 15:68167077-68167099 TTGGCCTCCCTTGGGATTACAGG + Intronic
1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG + Intergenic
1132630000 16:912687-912709 CTGGCTTCCGTGGGGAAGATGGG - Intronic
1135182767 16:20290020-20290042 CTGGCCTCCTTGGGGAGTGCGGG - Intergenic
1136143618 16:28302509-28302531 CTGGCCTGCTGTGGGAATTCAGG + Intronic
1141425774 16:83943539-83943561 CTGGCCCTCCTGGGGAATCCAGG - Intronic
1141657530 16:85424011-85424033 CTGGCCTCCCTGGTGGATGCAGG - Intergenic
1142205912 16:88783128-88783150 TTGGCCTCCTTGGGGAGGATGGG - Intronic
1142571487 17:877799-877821 CTGGCCTGCCTGGTGAAAACCGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1146708673 17:35021528-35021550 CTGTCCTCCTGGGAGATTACAGG + Exonic
1149186263 17:54001332-54001354 GTGCCCTCATTGGGGAAAACTGG - Intergenic
1155231991 18:23783128-23783150 CTGGCCTCCTTGAGGACAAAAGG - Intronic
1157305480 18:46514015-46514037 CTGGGCTCCTTAGGGACCACTGG + Intronic
1157904838 18:51560596-51560618 CTGACCTGCTTGGTGAATGCTGG + Intergenic
1163125414 19:15241734-15241756 CTGTCCTCCCTGGGAAATACTGG - Intronic
1163826477 19:19527417-19527439 CTGGCCACCTTCGGGGATGCAGG - Intronic
1164946130 19:32294603-32294625 CTGGCCTCCTTGTGGGTCACAGG + Intergenic
1165075486 19:33277887-33277909 CTGGCCTCATGGGGCTATACTGG + Intergenic
1166695402 19:44848862-44848884 TTGGCCTCCTCGGGGAATGCGGG + Intronic
1166860015 19:45804649-45804671 CTCTCCTCCTTGGGGATCACGGG + Exonic
1167617277 19:50542314-50542336 CTGGCCCCCTGGGAGAAGACCGG - Intronic
925164725 2:1709047-1709069 CTGGCTCCCGTGGGGAAGACCGG - Intronic
926784996 2:16509735-16509757 CAGGCTTCCTTGGGAAATGCTGG + Intergenic
927863271 2:26573650-26573672 CTGGCCTCCGCGGGGAACTCAGG + Intronic
928967885 2:36995339-36995361 TTGGCCTCCTTTGGGATTACAGG + Intronic
931892440 2:66688913-66688935 TTTGCCTCAGTGGGGAATACAGG + Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934621696 2:95813908-95813930 CGGGCCTCTTTGGGGATTCCAGG - Intergenic
934811748 2:97284905-97284927 CGGGCCTCTTTGGGGATTCCAGG + Intergenic
934825943 2:97423035-97423057 CGGGCCTCTTTGGGGATTCCAGG - Intergenic
934888155 2:98042464-98042486 CTGGCCTCCTTTGGCACTAGGGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935782349 2:106519267-106519289 CTGGCCACCTTGGGGGATAGTGG + Intergenic
937665976 2:124487103-124487125 CTAGCCACCATGGGGGATACTGG - Intronic
938161432 2:128987950-128987972 CTGGCCTACTTGGGGGATCAAGG + Intergenic
939995928 2:148919536-148919558 CTTGCCTCCTTGGGGGCTACTGG + Intronic
940376587 2:152965192-152965214 CTGGCCTCATTTGGGATTGCTGG + Intergenic
941081843 2:161070823-161070845 CTGGCCTTCTTGGGCAATGCTGG + Intergenic
944474796 2:200092622-200092644 CTGGCTTCCTGTGGGGATACTGG - Intergenic
948530292 2:238599789-238599811 TTGGCCTCCTTGGGGTAGCCTGG + Intergenic
1170957427 20:20993965-20993987 CTGGCCTCCTTGAACAACACAGG - Intergenic
1172197481 20:33102036-33102058 CTTGCCTCCTTGGGAACTCCTGG - Intronic
1173485385 20:43437329-43437351 ATGGCCTCCTTTGGGCAGACAGG - Intergenic
1175503422 20:59466181-59466203 ATGGCCTTCATGGGGAAGACAGG - Intergenic
1175989815 20:62782836-62782858 CTGGGCTCACTGGGGAATCCAGG - Intergenic
1176024082 20:62977078-62977100 CTGACCTCCTTGGGGACTGAGGG + Intergenic
1178457133 21:32765880-32765902 TTGGCCTCCCAGGGGATTACAGG - Intronic
1179647731 21:42785467-42785489 CTGGCCGCCCTGGGGAGTTCAGG - Intergenic
1180947186 22:19702648-19702670 ATGGCATCATTGGGGAAAACTGG + Intergenic
1182741363 22:32570304-32570326 CTGGCTCCCTTGTGAAATACTGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950898404 3:16474491-16474513 CTGGCTTCCTGGGGGTGTACTGG - Intronic
952990411 3:38826585-38826607 CTGGACTCCTTGGGGTCTGCAGG + Intergenic
954035652 3:47849616-47849638 GTGGCCTCCCTAGGGAACACAGG - Exonic
963064530 3:141252971-141252993 CTGGCCTCCTTGGGGAATACTGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
968491497 4:892836-892858 CTGGCCTCCTTGAGGTTTGCAGG - Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
970989113 4:22192064-22192086 CTGGCCACCTGGGTGAAGACAGG - Intergenic
971259890 4:25046426-25046448 CTGGCCTACTTAGGGAATTCAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973924899 4:55727691-55727713 CTAGCCTCCTTGGTGAATTCTGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
978290664 4:107135605-107135627 CTGTCCTCCTTTGGGATTAAAGG + Intronic
978552498 4:109942586-109942608 CTGGTCTTCTTGGGGAATGGAGG - Intronic
983574429 4:169245594-169245616 CTTGCCTACTTGGAGAAAACCGG + Intronic
988161010 5:27518298-27518320 GAGGCCTCCTTGGGGAAGAATGG + Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
1000313751 5:160069399-160069421 GTGGCCACTTTGGGCAATACCGG - Intronic
1001253698 5:170167759-170167781 CTGGCCTTCTGGGGGAATCTGGG - Intergenic
1001407673 5:171487315-171487337 TTGGCCTCCTGGGGGAAGAAGGG + Intergenic
1001653858 5:173333471-173333493 CTGGCTTCCATGGAGAGTACTGG + Intergenic
1005064131 6:21801808-21801830 GTGGCCTCATTAGGAAATACGGG - Intergenic
1006515749 6:34544708-34544730 CTGGCTTCCTTGGGGATTGAGGG - Intronic
1015924382 6:138294632-138294654 CTGGCCTCATTGGAGACAACAGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1016911976 6:149208177-149208199 CTGGCCCCCTTGCTGCATACTGG - Intergenic
1017143107 6:151209686-151209708 CTGGGCTCCTTGGGAAATGGAGG - Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018367939 6:163140344-163140366 CTGGCCTCCATGGGGTAGAGAGG + Intronic
1019928176 7:4206688-4206710 CTGGCCTCCTTAGAGAGTACAGG + Intronic
1021382997 7:19991126-19991148 CTGGCTTGCTTGGGAACTACTGG - Intergenic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026485221 7:70812380-70812402 CTGGCTTCAATTGGGAATACAGG + Intergenic
1029277951 7:99418696-99418718 CTGGACTCCTTGTGGAATCTGGG - Exonic
1030400736 7:109046444-109046466 CTGGTTTCCTTGGACAATACAGG + Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1032755707 7:134888940-134888962 CTCTCCTCCATGGAGAATACTGG + Intronic
1035969255 8:4228870-4228892 CTGGCCAACTTGGGGAAAGCCGG - Intronic
1038560689 8:28576623-28576645 AGGGCCTCCATGGGTAATACAGG - Intergenic
1039988479 8:42467817-42467839 CTGGGCTCCTCGGGGACTAGTGG + Intronic
1043610336 8:82054965-82054987 TTGGCCTCCTTGGGCCATATTGG - Intergenic
1043757975 8:84028418-84028440 CTTGCCTCCTTGGTGGATCCAGG + Intergenic
1043910798 8:85861492-85861514 CTGGCCTCCATCAGGAATCCTGG + Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044441451 8:92229131-92229153 GTGGCCTCCTAGTGAAATACAGG - Intergenic
1046573115 8:115991626-115991648 CTGGCTTCCTGAGGGAATGCAGG + Intergenic
1046930000 8:119832591-119832613 CCGGCTTCCTAGGGGGATACGGG + Exonic
1048329402 8:133461805-133461827 CTGGCCTCTCTTGGGAACACAGG + Intronic
1049323412 8:142009499-142009521 GAGGCCTCCTTGGGGCACACTGG + Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053046034 9:34918034-34918056 CAGGCCTCCTTTGGGATCACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1061296929 9:129681884-129681906 CTGGGCTCCCTGGGGATCACGGG + Intronic
1061617590 9:131790453-131790475 CTTGCCTCCTTGGGGAGCCCAGG - Intergenic
1185933967 X:4234862-4234884 GTGGCCTCCTTAGTGTATACAGG + Intergenic
1194443372 X:93959677-93959699 GTGGTCTCCTTGGGGAATGATGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1200171223 X:154076515-154076537 GTTGCCTCCTTGGGGAAGGCAGG + Intronic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic
1201446495 Y:14062321-14062343 TTGACCTACTTGGGGAATTCAGG - Intergenic
1201550773 Y:15214358-15214380 CTGGACTCCTAGGGCAATCCAGG - Intergenic
1201714834 Y:17033124-17033146 GTGGCCTCCTTAGTGTATACAGG + Intergenic