ID: 963067002

View in Genome Browser
Species Human (GRCh38)
Location 3:141271928-141271950
Sequence CTGTCGCCACAGAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963066991_963067002 30 Left 963066991 3:141271875-141271897 CCGGGCCATGGGGTTGGCATGAG 0: 1
1: 0
2: 3
3: 16
4: 232
Right 963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG 0: 1
1: 0
2: 2
3: 9
4: 150
963066998_963067002 -6 Left 963066998 3:141271911-141271933 CCCAAAGGAGGATGGGTCTGTCG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG 0: 1
1: 0
2: 2
3: 9
4: 150
963066999_963067002 -7 Left 963066999 3:141271912-141271934 CCAAAGGAGGATGGGTCTGTCGC 0: 1
1: 0
2: 0
3: 10
4: 62
Right 963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG 0: 1
1: 0
2: 2
3: 9
4: 150
963066992_963067002 25 Left 963066992 3:141271880-141271902 CCATGGGGTTGGCATGAGAAGAG 0: 1
1: 0
2: 2
3: 20
4: 220
Right 963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG 0: 1
1: 0
2: 2
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963067002 Original CRISPR CTGTCGCCACAGAAGGAAGT GGG Intronic
903887010 1:26546499-26546521 GTGTTGCCACAATAGGAAGTAGG - Intronic
905503685 1:38459520-38459542 CAGTGGCCACCAAAGGAAGTTGG - Intergenic
908623455 1:66012543-66012565 CAAACGGCACAGAAGGAAGTGGG - Intronic
911430636 1:97782340-97782362 CTGGGGCCACAGAAGAAAATGGG - Intronic
913049400 1:115103794-115103816 CTGTAGCAACACAAGGAAGAAGG - Intergenic
913449073 1:118980091-118980113 GTTTCGCCGCAGAAGGAACTGGG - Intronic
915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG + Intergenic
916214983 1:162386443-162386465 CTCTGTCCACATAAGGAAGTTGG + Intronic
920294911 1:204950176-204950198 CTGATGCCACTGAGGGAAGTGGG - Intronic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
1064633981 10:17345194-17345216 CTGTTGTCACAAGAGGAAGTGGG - Intronic
1065237126 10:23664223-23664245 CTGCCCTCACAGAAGGAATTTGG - Intergenic
1065300346 10:24315411-24315433 CTGTCTGCAAGGAAGGAAGTAGG + Intronic
1067381628 10:45779109-45779131 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1067889327 10:50119743-50119765 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1074007163 10:109438836-109438858 CTGTGACCACAGAAGTAAATCGG - Intergenic
1077213578 11:1384607-1384629 CTGTAGCTACAGAAGGCAGAGGG - Intergenic
1077929599 11:6717239-6717261 CTGTGGACACAGAAGGACTTCGG - Intergenic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1080620186 11:33980803-33980825 CAGTTGTCACAGAAGGAAGTTGG - Intergenic
1081719638 11:45278701-45278723 CTGTACCCAAAGAAGGAACTAGG + Intronic
1081773326 11:45662911-45662933 CAGTCCCCACCGAAGGGAGTTGG + Intronic
1087040602 11:93795705-93795727 CTGTCGTCTTAGAAGGAAGTAGG + Intronic
1088279852 11:108124713-108124735 CTGAGGCCACAGAACTAAGTAGG - Intronic
1089529558 11:119117595-119117617 CTGTTGCCTCAGAAGAAACTGGG + Exonic
1091553348 12:1553630-1553652 CTGTGGCCCCAGGAGGAAGCTGG + Intronic
1096826455 12:54281928-54281950 CTGTCTCCAGAGAAGTGAGTGGG + Exonic
1098266498 12:68726802-68726824 CTGTGGCCACAGAATGCTGTTGG + Intronic
1099376295 12:81899108-81899130 CTGTAGCCACTCAAGGAAGGTGG - Intergenic
1099627168 12:85090002-85090024 CTGTGGCCACACAGGGCAGTGGG - Intronic
1100188998 12:92170625-92170647 CTGTAGCCATGGATGGAAGTGGG - Intergenic
1101694528 12:107112580-107112602 CAATTGCCTCAGAAGGAAGTAGG + Intergenic
1103841385 12:123868075-123868097 CTGTTGACACAGAAGGAGTTTGG + Exonic
1105017865 12:132796956-132796978 CTGTCGCCACACGAGAAAGTCGG - Intronic
1107282500 13:38752918-38752940 CTGGCGCCACAAAAGGAATTAGG + Intronic
1110708576 13:78624814-78624836 CAATTGCCACAGAAGCAAGTAGG - Intronic
1110938152 13:81318358-81318380 CCCTGGCCTCAGAAGGAAGTTGG - Intergenic
1111770505 13:92590164-92590186 CTTTCACTACAGCAGGAAGTGGG - Intronic
1111770771 13:92592950-92592972 CTTTCACTACAGCAGGAAGTGGG + Intronic
1112628608 13:101135696-101135718 CTGTGGCAACACAAGGAAGCAGG + Intronic
1113110222 13:106814658-106814680 CTGTGACCACAGAAGGATCTAGG + Intergenic
1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG + Exonic
1115982574 14:39070368-39070390 CTGTCGTCACAGAATGACCTGGG - Intronic
1119425830 14:74534156-74534178 CTGTGGCCACAGTGGGATGTGGG + Intronic
1121919093 14:97863982-97864004 CAGTTGCCACAGCTGGAAGTTGG + Intergenic
1129760754 15:78128125-78128147 CTGTGGCCACACAAGGGACTGGG + Intronic
1131629326 15:94159243-94159265 CTGTACCCAAAGAAGGCAGTAGG - Intergenic
1133305214 16:4804179-4804201 CTGTCTCCACGGGAGGAAGAGGG + Exonic
1134063785 16:11213845-11213867 CTGTCGCCACCCGAGGAGGTGGG - Intergenic
1134760827 16:16713411-16713433 CTCTCCCCCCAGAAGGAAGGCGG - Intergenic
1134985231 16:18645762-18645784 CTCTCCCCCCAGAAGGAAGGCGG + Intergenic
1136248696 16:28989762-28989784 CTGTCCCCACAGATGGCAGCCGG + Exonic
1137541450 16:49364968-49364990 CTGTCTCCACAGAAGGCAGCTGG - Intergenic
1137601945 16:49762280-49762302 CCAGCGCCCCAGAAGGAAGTGGG + Intronic
1138525169 16:57600930-57600952 CAGTCCCCACTGAAAGAAGTGGG - Intergenic
1139000489 16:62504556-62504578 CTGTCGGCAAATCAGGAAGTGGG + Intergenic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1143978632 17:10848610-10848632 CAGTGACCACAGAAGGAACTTGG + Intergenic
1144319685 17:14102185-14102207 CTGTCCCAACAGAAGTAAGCAGG - Exonic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG + Intronic
1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG + Intergenic
1161914721 19:7219822-7219844 CTGACACCATAGAAGGAAGCAGG - Intronic
1162126130 19:8500340-8500362 CTGTCACCCCAGGAGGTAGTGGG + Intronic
1162448310 19:10738090-10738112 GTCTCACAACAGAAGGAAGTAGG + Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1166131901 19:40750684-40750706 CGGGCGCCACGGAAGGAGGTGGG + Intronic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1166984681 19:46652746-46652768 CTGTCCCCACAGAAGGTTGAGGG + Exonic
929040882 2:37743435-37743457 CTGTCACCACAAAAGTAAGAAGG - Intergenic
931572669 2:63685590-63685612 CTGTCGTCACAGAACGCATTTGG - Intronic
932173401 2:69577774-69577796 CTGTCTCCACAGGAGGCAGGAGG + Intronic
935014330 2:99165699-99165721 TTGTTTCCATAGAAGGAAGTAGG - Intronic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
946122375 2:217527618-217527640 CTGTCTCCTGAGAAGGAACTGGG + Intronic
947129655 2:226908376-226908398 TTGTCCCTACAGAAGGCAGTAGG - Intronic
947859771 2:233350301-233350323 ATGTTGCCACTGGAGGAAGTTGG - Intergenic
948467563 2:238159463-238159485 CTTTTGGGACAGAAGGAAGTTGG + Intronic
948541850 2:238696953-238696975 ATGTCACCACTGAAGGAAGCTGG - Intergenic
948694303 2:239725494-239725516 CTGTAGCCACAGGACGAAGAGGG - Intergenic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1175474418 20:59260783-59260805 CTGTGGCCACAGACAGAACTGGG - Intergenic
1177135097 21:17299445-17299467 CTGTAGCCACTCAAGGAAGGTGG - Intergenic
1177901821 21:26926254-26926276 CTGTCTAAACAGAAGGTAGTTGG + Intronic
1180955439 22:19739277-19739299 CGCTGGCCACAGAAAGAAGTTGG + Intergenic
1181584674 22:23846621-23846643 CAGCGGCCACAGCAGGAAGTGGG - Intergenic
1182684850 22:32114110-32114132 CTGTCCCTACAGAGTGAAGTTGG - Intergenic
1183737344 22:39651197-39651219 GTCTTGCCACAGAAAGAAGTTGG - Intronic
1185120100 22:48960897-48960919 CTGTAACCACTTAAGGAAGTGGG - Intergenic
950019981 3:9780282-9780304 CTGTGCCCAAAGAAGGAAGTGGG + Exonic
952553543 3:34506251-34506273 CTATTGCCACAGAAGTATGTGGG - Intergenic
953568567 3:44053712-44053734 CTGTTGCCACAGGAGCTAGTGGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
967431373 3:189389887-189389909 CTGTCTACCTAGAAGGAAGTAGG + Intergenic
969411799 4:7033452-7033474 CTGTCTCCCCAGCAGGCAGTGGG + Intergenic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
974844862 4:67340060-67340082 ATGTCCCCACAGATGGAAGAAGG + Intergenic
977808073 4:101326129-101326151 CTGTCTCCAAAAAAGGAAGGAGG + Intronic
982745570 4:159102525-159102547 TTATCGCCACAGAAGCAACTCGG + Intergenic
984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG + Intronic
985617386 5:931772-931794 ATCACGCCACAGAAGGAAATCGG + Intergenic
987991839 5:25222749-25222771 TTGTGGCCATAGAAAGAAGTAGG - Intergenic
992227787 5:74635577-74635599 CTGTCCTCCCAGAAGGAAGAGGG + Exonic
996151774 5:120045873-120045895 ATGTTGCCACTGAAAGAAGTAGG + Intergenic
996182894 5:120441797-120441819 TTGTTGAGACAGAAGGAAGTAGG - Intergenic
997476241 5:134144221-134144243 CTGTCCCCACACAGGGAAGCTGG + Intronic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
998504482 5:142660907-142660929 CTGGAGCCAGAGAAGGAAGGAGG - Intronic
1002123133 5:177021475-177021497 GAGTAGCCAGAGAAGGAAGTGGG + Intronic
1002528055 5:179826107-179826129 CTGTAGCCACAGGAGGCAGCAGG - Intronic
1002928255 6:1617517-1617539 CTGCCCCCACAGAAGGCTGTGGG + Intergenic
1003516960 6:6825696-6825718 ATGTCAGCACCGAAGGAAGTGGG + Intergenic
1004493652 6:16142644-16142666 CTGTGGCCAGGGAAGGAGGTAGG - Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1008535484 6:52503708-52503730 CAGTGGCCACAGAAGGGAGGGGG + Intronic
1010352852 6:74896149-74896171 CTGACGTCACAGAAGGAGTTTGG + Intergenic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1012261696 6:97094879-97094901 GTGTGGCCAGAGAAGGTAGTGGG - Intronic
1012261700 6:97094890-97094912 CTCTGGCCACACAAGGAAATTGG + Intronic
1012960482 6:105616661-105616683 CTGTCCCCACAGATGGAATGAGG - Intergenic
1013822150 6:114167373-114167395 CTGTAGACACAGTAGTAAGTAGG + Intronic
1013895116 6:115078717-115078739 CTGGAGCCAGAGAAGGGAGTGGG + Intergenic
1017122927 6:151041030-151041052 GTGTGGCCACAGGAGGAACTCGG - Intronic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1023772183 7:43567905-43567927 CAGTCACCAAAGAAGGATGTGGG + Intergenic
1024480833 7:49860849-49860871 GTGAGGCCACAGAAGGAAGGTGG + Intronic
1024661767 7:51502111-51502133 CTGTGGCCAAAAAAGAAAGTTGG + Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1026237359 7:68538937-68538959 CTGTCACCAAAGAAAGAAGAAGG - Intergenic
1029045818 7:97627105-97627127 CTCTCTCCACAGACGGAAGTAGG - Intergenic
1036727098 8:11230117-11230139 CTGGTGCTTCAGAAGGAAGTGGG + Intergenic
1038385937 8:27145244-27145266 CTGTTGTGAAAGAAGGAAGTAGG - Intergenic
1038423753 8:27451482-27451504 CAGACGCCAGAGAAGGAGGTCGG + Exonic
1040388162 8:46927938-46927960 CTGTAGCCACATGAGGGAGTGGG - Intergenic
1047330571 8:123883312-123883334 CTGCCTCAAGAGAAGGAAGTGGG + Intronic
1048334052 8:133490094-133490116 CTTTGGGCAGAGAAGGAAGTTGG + Intronic
1048810945 8:138285479-138285501 CTGTCGCTACAGAAGGAACCTGG - Intronic
1053684311 9:40507166-40507188 ATGTGGCCACAGGAGGAACTCGG - Intergenic
1053934278 9:43135452-43135474 ATGTGGCCACAGGAGGAACTCGG - Intergenic
1054279414 9:63117787-63117809 ATGTGGCCACAGGAGGAACTCGG + Intergenic
1054297405 9:63342630-63342652 ATGTGGCCACAGGAGGAACTCGG - Intergenic
1054395423 9:64647138-64647160 ATGTGGCCACAGGAGGAACTCGG - Intergenic
1054430070 9:65152338-65152360 ATGTGGCCACAGGAGGAACTCGG - Intergenic
1054500314 9:65869194-65869216 ATGTGGCCACAGGAGGAACTCGG + Intergenic
1055844191 9:80541392-80541414 GTATCTCCACAGAAGGAAGAGGG + Intergenic
1056511271 9:87308432-87308454 CTGAAGCTCCAGAAGGAAGTGGG + Intergenic
1058936225 9:109772005-109772027 CTGTCCCCACGGAAAGAAGAAGG - Intronic
1060118599 9:120966768-120966790 GACTGGCCACAGAAGGAAGTAGG + Intronic
1061149371 9:128820263-128820285 CTGTCTTCCCAGAAGGAAGCTGG - Exonic
1062305187 9:135902013-135902035 CTGTGGACACAGCAGTAAGTGGG + Intronic
1187697540 X:21937172-21937194 CTGTCTGCTCAGAAGCAAGTGGG + Intergenic
1189954979 X:46268691-46268713 GGGTCACCACAGCAGGAAGTAGG - Intergenic
1193611205 X:83633368-83633390 CTGTCTCCACAAAAGAAGGTGGG + Intergenic
1193669934 X:84372111-84372133 CTGTTGAGACAGAAAGAAGTGGG + Intronic
1194086882 X:89538918-89538940 CTGCAGCCAAAGAAGGGAGTAGG + Intergenic
1196145005 X:112306837-112306859 CAGTGGCCACAGCAGGAAGCTGG + Intergenic