ID: 963067570

View in Genome Browser
Species Human (GRCh38)
Location 3:141275446-141275468
Sequence CTCCCTTGGAGTCTGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 266}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963067570_963067579 2 Left 963067570 3:141275446-141275468 CCCTGGCCCAGACTCCAAGGGAG 0: 1
1: 0
2: 3
3: 29
4: 266
Right 963067579 3:141275471-141275493 TGCCCACAGGCATGGCCAAGGGG 0: 1
1: 0
2: 0
3: 33
4: 209
963067570_963067583 13 Left 963067570 3:141275446-141275468 CCCTGGCCCAGACTCCAAGGGAG 0: 1
1: 0
2: 3
3: 29
4: 266
Right 963067583 3:141275482-141275504 ATGGCCAAGGGGCCAGGACTTGG 0: 1
1: 0
2: 1
3: 20
4: 283
963067570_963067578 1 Left 963067570 3:141275446-141275468 CCCTGGCCCAGACTCCAAGGGAG 0: 1
1: 0
2: 3
3: 29
4: 266
Right 963067578 3:141275470-141275492 GTGCCCACAGGCATGGCCAAGGG 0: 1
1: 0
2: 1
3: 22
4: 200
963067570_963067577 0 Left 963067570 3:141275446-141275468 CCCTGGCCCAGACTCCAAGGGAG 0: 1
1: 0
2: 3
3: 29
4: 266
Right 963067577 3:141275469-141275491 TGTGCCCACAGGCATGGCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 373
963067570_963067576 -6 Left 963067570 3:141275446-141275468 CCCTGGCCCAGACTCCAAGGGAG 0: 1
1: 0
2: 3
3: 29
4: 266
Right 963067576 3:141275463-141275485 AGGGAGTGTGCCCACAGGCATGG 0: 1
1: 0
2: 3
3: 37
4: 325
963067570_963067582 7 Left 963067570 3:141275446-141275468 CCCTGGCCCAGACTCCAAGGGAG 0: 1
1: 0
2: 3
3: 29
4: 266
Right 963067582 3:141275476-141275498 ACAGGCATGGCCAAGGGGCCAGG 0: 1
1: 1
2: 1
3: 51
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963067570 Original CRISPR CTCCCTTGGAGTCTGGGCCA GGG (reversed) Intronic
900121615 1:1050741-1050763 CACCCTGGGAGCCTGGACCAGGG + Exonic
900477964 1:2884868-2884890 CTTCCTGGGAGCCTGGCCCAGGG - Intergenic
900701074 1:4048969-4048991 GTCCCTTTGATGCTGGGCCAGGG + Intergenic
900762277 1:4481414-4481436 CACGCTTGGAGTCTGGGCTCCGG + Intergenic
901800405 1:11704998-11705020 CTCCCTCGGGGTCGGGGCTAAGG + Intronic
903853577 1:26322266-26322288 CCACCTTGGAGCCTGGGCTAGGG + Exonic
904200735 1:28817559-28817581 CTCTCTTGGGGTCTGGACCCAGG + Intronic
904959772 1:34323233-34323255 CTCCTTGGGAGTCTGGGCATGGG + Intergenic
904962698 1:34347238-34347260 CTACCATGGAGTCTGGTCCATGG + Intergenic
906324998 1:44839964-44839986 CTGCCTTTGGGTATGGGCCAGGG + Intronic
906709982 1:47922287-47922309 CTCTTGTGGAGCCTGGGCCAAGG - Intronic
906859854 1:49347950-49347972 CTCTCTTGGGGTCTGGATCAGGG + Intronic
906941001 1:50255296-50255318 CTCCTTTGCAGTCTGGGGCTGGG + Intergenic
909538586 1:76766111-76766133 GTCCCTTGGAGTGTGGGAAAAGG - Intergenic
911531895 1:99052524-99052546 CAGCCTTGGTGTCTGAGCCATGG + Intergenic
912631772 1:111252597-111252619 CTCCTTTGCAGTCTGGGGCAGGG - Intergenic
916532712 1:165673480-165673502 CTCTCTTGGGGTCTGGATCAGGG + Intronic
917924533 1:179778273-179778295 CTTCCTTGGAGTCAGGGATATGG - Intronic
919816454 1:201443847-201443869 CTCCCATGGGCTCTGGGCCTGGG - Intergenic
920855466 1:209657773-209657795 CTCTCATGGAGGCTGGACCATGG - Intergenic
921303347 1:213771335-213771357 CTACCTTGGATTCTGATCCATGG - Intergenic
923008545 1:230070642-230070664 CACCCTTGGACTCTCGGGCAAGG - Intronic
924686880 1:246301987-246302009 CTCCCTGGGAGTCTGTTCCAAGG - Intronic
1064210019 10:13353782-13353804 CTCTCTTGGGGTCTGGATCAGGG - Intergenic
1065578837 10:27151256-27151278 CTCTCTTGGGGTCTGGATCAGGG + Intronic
1069589062 10:69630699-69630721 CTCCCCTTGAGTCTGGGTAAAGG - Intronic
1070214638 10:74363959-74363981 CTCCCTTGGGATCTGTGGCATGG + Intronic
1070728324 10:78807663-78807685 CTGCCTTGGAGACTGTCCCAGGG - Intergenic
1070845775 10:79521863-79521885 GTCCCTTGGAGGCTTGGCCAGGG + Intergenic
1070928018 10:80238455-80238477 GTCCCTTGGAGGCTTGGCCAGGG - Intergenic
1071043427 10:81342009-81342031 CTGCATTGCAGCCTGGGCCAGGG + Intergenic
1072409520 10:95187126-95187148 CTCCATAGGTATCTGGGCCATGG - Intergenic
1072780447 10:98247611-98247633 CTCCCATGGAGCCAGGGCCTGGG - Intergenic
1073044435 10:100628530-100628552 CTCCCCTGCAGGCTGGGGCAAGG - Intergenic
1073232398 10:101983208-101983230 CTCCCTGGAAGTCAGGGCTAGGG - Intronic
1073300925 10:102470583-102470605 CTCCCCTGGGGCCTGGGCAAGGG + Intronic
1073363465 10:102918395-102918417 CTCCGTTGCAGTCTCGCCCAGGG + Exonic
1074695266 10:116044888-116044910 CTACCCTGGAATCTGGGCAATGG + Intergenic
1075163097 10:120041872-120041894 CCCCCTTGCAGCCTGGGGCAGGG + Intergenic
1075786824 10:125055651-125055673 CTCCCTTGGAGTGTGGTTCGGGG - Intronic
1076766129 10:132634433-132634455 CTCCCTTGGTGAGTGTGCCACGG + Intronic
1077243717 11:1525486-1525508 CTGCCTTGGAGTAAGGGCCTCGG + Intergenic
1077306053 11:1869126-1869148 CCCACTTGGAGCCTGGGGCAGGG - Intronic
1077474699 11:2780783-2780805 CTTCCTTGGTGTCCTGGCCAGGG + Intronic
1077807625 11:5605222-5605244 CTCCCTGGGAGGCTTGGCCCAGG + Intronic
1078902930 11:15658362-15658384 CTCCCTTGGGGTGTAGGGCAAGG - Intergenic
1080586289 11:33685788-33685810 CTGCACTGTAGTCTGGGCCACGG + Intergenic
1080898674 11:36467180-36467202 CTCTGTGGGAGTCTAGGCCATGG - Intergenic
1081468128 11:43344091-43344113 CTCCCTTGGAATCTGAACAAAGG + Intronic
1082830689 11:57614712-57614734 CTCCCTGAGGGTCTGGGCAAGGG + Exonic
1083238240 11:61366195-61366217 CTCCCTTCATGTCTGGGTCATGG + Exonic
1083268415 11:61557944-61557966 CTTCCCTGGAGTCCTGGCCATGG - Intronic
1083286225 11:61660855-61660877 CTGCCTTGGGGTCTGGACCGGGG + Intergenic
1083659056 11:64243778-64243800 CTCCCTTCCAGTGTGGGCAAAGG - Intronic
1084271917 11:68033523-68033545 CCCCCTTGGGGTCTGGCCAAGGG + Intronic
1084929624 11:72544231-72544253 ATCGCTTGGTGTCTGTGCCATGG + Intergenic
1085128689 11:74019293-74019315 CCAACTTGCAGTCTGGGCCAGGG + Intronic
1086274420 11:85108877-85108899 CTCTCTTGGAGTCTGTGAAATGG - Intronic
1086287933 11:85271068-85271090 CTTCCTTGGCTTCTGAGCCAAGG - Intronic
1089526576 11:119101122-119101144 CTCCCTGGGATTCTGGGCTGTGG + Exonic
1091236260 11:134024387-134024409 TTCCCTCGGAGTCGGGGCCCTGG - Intergenic
1091478891 12:806408-806430 CTTCCTTGGAGACTGGGGCCAGG + Intronic
1095905105 12:47369407-47369429 CTTCCTTGTAGGATGGGCCAGGG + Intergenic
1096478874 12:51924794-51924816 CTTCCTTGGAGGCTGGTGCAAGG - Intergenic
1097181401 12:57174018-57174040 CTGGGTAGGAGTCTGGGCCAAGG + Intronic
1097182718 12:57180289-57180311 CTGCCGGGGAGTCTGGCCCAGGG - Intronic
1102932966 12:116876576-116876598 CTGCCTGGGAGTCGGGGCCAGGG - Intronic
1103419843 12:120771624-120771646 CACCCTTGTAGTCTAGGCCAGGG + Intronic
1103904716 12:124321428-124321450 CTCCCCTGGAGTGGGGACCAGGG - Intergenic
1103934134 12:124466366-124466388 CCCCCTTGCAGCCCGGGCCACGG + Intronic
1104747531 12:131219640-131219662 GTCCCGGGGACTCTGGGCCATGG + Intergenic
1105884725 13:24631955-24631977 CTCCCTTCGGGTCTGGATCAGGG + Intergenic
1107675487 13:42792406-42792428 CTCCCCTAAAGTCTGGCCCATGG + Intergenic
1110559978 13:76900554-76900576 CTCCTTTGGAGAATGGCCCAAGG - Intergenic
1111195968 13:84874689-84874711 CTTCCTTGGATTCTGGCTCATGG - Intergenic
1112998159 13:105599542-105599564 CTCCTTTGGTATTTGGGCCACGG - Intergenic
1114505421 14:23208599-23208621 CTCTCTTGGGGTCTGGGTCTGGG - Intronic
1114547675 14:23514318-23514340 CTTCCTTGGGGTCTTGGCAATGG - Intergenic
1116112554 14:40605539-40605561 CTGCCTAGGAGGCTGGGACAGGG + Intergenic
1116742924 14:48779377-48779399 CTACTTTGGAGGCTGGGGCAGGG + Intergenic
1118923628 14:70172007-70172029 CTCAATTGGTGTCTGGGCCGGGG - Intronic
1121505516 14:94474028-94474050 CTCCCTTGGAATCAGGGTGAAGG + Intronic
1121932004 14:97980594-97980616 CTCCCTTGGTGTGTGTGCCTGGG + Intergenic
1122105088 14:99446889-99446911 CTGCCTTGGAGCCTGGGGGAGGG - Intronic
1122552742 14:102558808-102558830 CTCTCTGGGCCTCTGGGCCAAGG + Intergenic
1122905398 14:104799405-104799427 CTGCCTTGGAGTCCGGGAAATGG - Intergenic
1122974660 14:105166155-105166177 CTTCCTTGGAGTCCGGGCACTGG - Intronic
1123108614 14:105854853-105854875 CTCCCTTGGCCTCTGGGGCATGG - Intergenic
1123901828 15:24884824-24884846 CTCTTTTGGGGTCTGGGTCAGGG - Intronic
1125502247 15:40247014-40247036 CTTCCTTGGAGCTTGGGCCTGGG + Intronic
1125535460 15:40439493-40439515 CAGCCTTGGAGTGTGGCCCAGGG - Intergenic
1126119308 15:45237090-45237112 CTTCCTTGGATTCTGGCTCATGG + Intergenic
1127306549 15:57711387-57711409 CTTCATTGCAGTCTGGGCCTAGG + Intronic
1127642914 15:60932278-60932300 CTGCCTTGGAATCTGGTCCAAGG - Intronic
1128186261 15:65645655-65645677 CTCCCTTGATGTCTGGAACAGGG - Exonic
1129970622 15:79774916-79774938 CTCCCTTGGAGGCAGGGGCAGGG - Intergenic
1130093462 15:80839706-80839728 CTCCCTTGGACTGTGGGCTGTGG + Intronic
1130234833 15:82124476-82124498 GTCCCTTGGAGTCTGGTCTAGGG + Intergenic
1131067722 15:89444651-89444673 CTGCCTTGGTGTGTGGGCAAGGG - Intergenic
1132490691 16:229054-229076 CTCTCTCGGAGTCTGCGCCATGG - Intronic
1132710424 16:1263842-1263864 GGCACTTGGAGCCTGGGCCAGGG + Intergenic
1134592847 16:15470634-15470656 CTACCTGGGAGTCTGAGGCAGGG - Intronic
1135076240 16:19396178-19396200 CTTCCTTGGATTCTGGCTCATGG + Intergenic
1136297134 16:29309967-29309989 CTGCCTTGGGGCCTGGGCAAGGG - Intergenic
1136894472 16:33988626-33988648 TTTCCTTAGAGTGTGGGCCAGGG - Intergenic
1137337017 16:47559664-47559686 CTGCCTGGGATTCTGGGCCTTGG - Intronic
1138117116 16:54369624-54369646 CTTCCTTGTAATCTGGGCAAAGG - Intergenic
1138441496 16:57037611-57037633 CTCCCTGGGAGACTAGGCCAAGG + Intronic
1138498662 16:57424858-57424880 ATCCCTTGGAGTAGGGCCCAGGG - Intergenic
1139204488 16:65013857-65013879 CTCCCTTTGAGACTGGTCCTAGG - Intronic
1139379546 16:66521839-66521861 CCCCCTTGGGGTCAGGGCAAGGG - Intronic
1139650224 16:68358713-68358735 CTTCCTTTGAGACTGGGCCTAGG + Exonic
1141324061 16:83039103-83039125 CTCCGTGGGAACCTGGGCCATGG - Intronic
1142058684 16:88016070-88016092 CTGCCTTGGGGCCTGGGCAAGGG - Intronic
1142766333 17:2066402-2066424 CTCCCTATGTGTCTGGGACATGG + Intronic
1143088887 17:4436836-4436858 CTGAGTTGGAGTGTGGGCCAAGG + Intronic
1144728776 17:17514942-17514964 GTGCCTTAGAGTCTGGGGCAGGG + Intronic
1144769350 17:17750914-17750936 CTCTCTGAGGGTCTGGGCCAGGG + Intronic
1144922526 17:18776208-18776230 CTACCTGGGAGGCTGGGGCAGGG + Intronic
1145236031 17:21209056-21209078 GTGCCTTTGAGTCTGGGGCACGG - Intronic
1145355815 17:22148649-22148671 CCCCATTGGACTCTGGGGCAAGG + Intergenic
1148914239 17:50961089-50961111 CTCCTGTGGGGTCTGGGCCCAGG - Intergenic
1150645214 17:66973636-66973658 CTCCCGTGGTGTCTGTGCCTCGG + Intronic
1150708296 17:67508165-67508187 CTCTCTTGGGGTCTGGATCAGGG - Intronic
1151340437 17:73467527-73467549 TTCCCTGGGATTCTGGGCCTAGG - Intronic
1151423929 17:74017373-74017395 CTGCCTTGGAGGCCCGGCCAAGG - Intergenic
1151436010 17:74097971-74097993 CTTCCTTTGAGATTGGGCCATGG - Intergenic
1151649384 17:75456817-75456839 GTCCTTTGGATTCTTGGCCAAGG + Intronic
1151662276 17:75525367-75525389 CTCCCCTGGAGTCTGGGAGGCGG + Intronic
1151772974 17:76177167-76177189 CCCCCTTGCAGCCTGGGGCAGGG - Intronic
1152603742 17:81278543-81278565 CTCCCTTCTAGCCTGGGCCGAGG - Intronic
1152784781 17:82242008-82242030 CTCCCTTGGCCCCTTGGCCAGGG - Intronic
1155173858 18:23286456-23286478 GTCCCTGGGACTCTGGCCCAAGG + Intronic
1156535035 18:37854278-37854300 CTCCCTTAGAGTTTGGGAAATGG - Intergenic
1158650373 18:59279016-59279038 CACCCTGGGAGTCTGGGACCCGG - Intronic
1160463020 18:79053857-79053879 CTCCCTGGGTGGCTGAGCCATGG - Intergenic
1160753075 19:743944-743966 CTCCTTGGCAGCCTGGGCCACGG - Intronic
1161084107 19:2326108-2326130 CTCCTCTGGAGTGTGGGCTAGGG + Intronic
1161114274 19:2488201-2488223 CTCCCCAGGACGCTGGGCCAGGG + Intergenic
1161851778 19:6740921-6740943 CTCCCTGGGAGTCTGGTCGGCGG + Intronic
1162191391 19:8949752-8949774 CTCCCTTGGTGTGGGGGTCAGGG + Exonic
1163043737 19:14623640-14623662 CTCCCCTGGAGCCTGTTCCATGG + Intronic
1166026869 19:40095006-40095028 CCACCTTGGAGTTTGGGTCAAGG - Intergenic
1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG + Intronic
1167787402 19:51647120-51647142 CTCCCTGGGAGTCAGGGCCTCGG + Intergenic
925363849 2:3297561-3297583 CTCCCTTGCATTCTAGTCCAAGG + Intronic
925493121 2:4417996-4418018 CTCCCGTGGAGGGTGAGCCATGG - Intergenic
930740802 2:54830987-54831009 CTGCCATAGAGTGTGGGCCAGGG + Intronic
930754400 2:54960349-54960371 CTCCCCTGGGGGCTGGGCCAGGG + Intronic
931823940 2:65979817-65979839 CTCCTTTAGAGCCTGGGCCAGGG + Intergenic
933276121 2:80286209-80286231 CTCCTTAGGAGGCTGGGTCATGG - Intronic
933419548 2:82028647-82028669 CTTCCTTGGATTCTGGCTCATGG - Intergenic
933969090 2:87455686-87455708 TTGCCTTGGAGTCTGGGCTGTGG + Intergenic
934913178 2:98277378-98277400 CTCCCTGGGAGCCTGGTCTAGGG + Intronic
935649023 2:105366354-105366376 CTACCCTTGCGTCTGGGCCATGG - Intronic
935692088 2:105741212-105741234 CTACCTTGGAGCCTGTGCCTTGG - Intergenic
936324700 2:111494822-111494844 TTGCCTTGGAGTCTGGGCTGTGG - Intergenic
940817026 2:158308690-158308712 CTCCCCAGGAGTGTTGGCCAGGG - Intronic
946327261 2:218991143-218991165 CTCCCTGGCAGTCTGGGAAATGG + Intronic
946330534 2:219006364-219006386 CTTTCTGGGAGTCTGGTCCAGGG + Intronic
947188058 2:227472403-227472425 CTCCCTTGGCGCCGCGGCCATGG + Exonic
948370771 2:237487756-237487778 CTGCCATGCAGACTGGGCCAAGG + Intronic
948982744 2:241503011-241503033 TTCCCCTGGACTCTGGGCCTGGG - Intronic
949004179 2:241636412-241636434 CTCCCTTAGAGCCTGGCCCGGGG - Intronic
1169488971 20:6055627-6055649 CTCCCAGGGAGCCTGGGCCCAGG + Intergenic
1170837332 20:19895473-19895495 CTTCCTTGGCCTCTGGGACAGGG + Intronic
1172977498 20:38918023-38918045 CTCCCTGGGTATCGGGGCCAGGG - Intronic
1173658543 20:44717488-44717510 CTCCCTTGGCTTGTGGGCAATGG - Intronic
1175124412 20:56740722-56740744 GTCCCTCGGAGCCTGGGCCCTGG + Intergenic
1175281452 20:57806722-57806744 CTCCCCTGGAGGCTGGGCAGAGG - Intergenic
1175394252 20:58648190-58648212 CTCCCTTCCAGTGTGGGTCAGGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1178622340 21:34187623-34187645 TTTCCTTAGACTCTGGGCCAAGG - Intergenic
1179167596 21:38946889-38946911 CTTCCTGGGTGTCTGCGCCATGG + Intergenic
1179982702 21:44904946-44904968 TTCACTTGGCCTCTGGGCCAAGG + Intronic
1180996285 22:19967288-19967310 CTGCCTTCCAGTCTGGGCCAGGG - Intronic
1182978566 22:34646638-34646660 TTCCCTTGTCCTCTGGGCCATGG + Intergenic
1183278072 22:36913839-36913861 CGCCCTAGGAGTCTGGGCTCAGG - Intronic
1183928664 22:41223841-41223863 CTCCTAGGGAGTCAGGGCCAAGG + Intronic
1185314217 22:50171755-50171777 CTCCCCTGGGGTCTGGGCCAAGG + Intronic
1185343247 22:50300723-50300745 CTCCCCTGCAGTCTGGGCTCTGG + Intronic
950224709 3:11224301-11224323 CAGCCTTGGAGTCTGGGTCAGGG + Intronic
953540174 3:43811137-43811159 CTCCCCTGTTGTCTGGGACAGGG + Intergenic
954439928 3:50516279-50516301 CTCCCCTCCAGTCCGGGCCATGG - Intergenic
954632106 3:52053193-52053215 CTTCCTTGCACCCTGGGCCAGGG + Intronic
955453507 3:59096198-59096220 CTCTCTTGGGGTCTGGATCAGGG + Intergenic
956747530 3:72321417-72321439 CTCCCATGGAGGCTGGGGTAGGG + Intergenic
961154315 3:124666017-124666039 TTCCTTTGCAGTATGGGCCAAGG - Intronic
962137918 3:132756822-132756844 ATCCCCTGCACTCTGGGCCACGG + Intergenic
962384244 3:134920177-134920199 CTCCCATGGAGACTGGGGGAAGG - Intronic
963067570 3:141275446-141275468 CTCCCTTGGAGTCTGGGCCAGGG - Intronic
965637714 3:170801451-170801473 CTCCCTTGGAGACTGGTACTGGG - Intronic
965673781 3:171173892-171173914 CTCCCCGGGAGTCTGATCCAGGG + Intronic
965813547 3:172614905-172614927 CTTCCTTACAGTCTGGGGCAAGG + Intergenic
968484078 4:850367-850389 CTCCCTCGGAGTCTGGGGCCTGG - Intronic
968811401 4:2801120-2801142 CACCCCTGCAGTCTGGGCCCCGG - Intronic
969576437 4:8038715-8038737 CCCCTTTGGAGCCTGGGGCAGGG + Intronic
970896683 4:21111701-21111723 CTGCCTTGGAGTAGGGGTCAGGG + Intronic
973713347 4:53650873-53650895 CTCCCTTGGAGCCAGGCACATGG + Intronic
981751656 4:148098045-148098067 CTCCCCAGGAGTTTGGGGCAGGG - Intronic
983645094 4:169981596-169981618 CCTCCTTGGAGTTTGGGCCAAGG + Intergenic
983660500 4:170126609-170126631 CTTCCTTGGATTCTGGCTCATGG + Intergenic
985601345 5:836110-836132 CTCTCTTGGAGGCTGGGCACAGG - Intronic
985644652 5:1079238-1079260 CTCCCTGGGAGACGGGGCAAGGG - Intronic
987379697 5:17273789-17273811 CTCCCTTGGGGTCCAGGGCAAGG + Intronic
990029514 5:51240090-51240112 TTGCCTTGAAGTCTGTGCCAGGG + Intergenic
991292392 5:65045363-65045385 CTCTCTTGGTTTCTGGGCCGTGG + Intergenic
994148685 5:96423190-96423212 GTCCCTGGGATTATGGGCCAAGG - Intronic
994190882 5:96867961-96867983 CTACCTGGGAGTCTGAGGCAGGG + Intronic
997368876 5:133343381-133343403 CTCCCTGGGAGGCTGGCCCACGG + Intronic
997880273 5:137583051-137583073 CTCCCTTGGACAGAGGGCCAAGG - Intronic
999268790 5:150284430-150284452 ATGCCCTGCAGTCTGGGCCATGG - Intronic
1000107957 5:158078725-158078747 CTGCCTTGGAGGCTGGGTCATGG + Intergenic
1001032538 5:168273148-168273170 CTCCCTTGGTGCCTGGGGGAGGG + Intergenic
1001326798 5:170734221-170734243 CTTCCTTGTAGTCTGGGAAATGG - Intronic
1002533841 5:179865304-179865326 CTACCTTCGAATGTGGGCCAAGG - Exonic
1002912009 6:1497723-1497745 CACCCCTGCAATCTGGGCCAAGG - Intergenic
1003035929 6:2640156-2640178 CTCCCTGGGAGCCTGGGAAAAGG + Intergenic
1003123894 6:3339941-3339963 CTCTCTTGGGGTCTGGATCAGGG + Intronic
1003192570 6:3887477-3887499 TTCCCTGGGAACCTGGGCCACGG - Intergenic
1004179965 6:13372567-13372589 ACCCCTGGGAGTCTGGGCAAGGG + Intronic
1004457361 6:15803469-15803491 CTCCTTTGGAGTCTGGTACTAGG - Intergenic
1005331621 6:24756209-24756231 CTCTCTTGGGGTCTGGATCAGGG - Intergenic
1006611876 6:35298909-35298931 CTCCTTTGGAGGATGGGGCAGGG - Intronic
1007819668 6:44551958-44551980 CCCCCTTGGAACCTGTGCCAGGG + Intergenic
1008063594 6:47024641-47024663 CTCACATGGAATCTGGACCAAGG + Intronic
1008222958 6:48876753-48876775 CTTCCTTGGACTCTGGCTCATGG - Intergenic
1008645006 6:53504863-53504885 CGCCTTTGGTTTCTGGGCCAGGG - Intronic
1010378856 6:75204941-75204963 CTCCCTGGGACTCTGGGCCAGGG - Intronic
1012250651 6:96976389-96976411 CTCCCTTGGCATCTGAGCCAAGG + Intronic
1013364421 6:109425035-109425057 CTCTCTTGGGGTCTGGATCATGG + Intronic
1013982403 6:116147329-116147351 CTACCTGGGAGTCTGAGGCAGGG + Intronic
1014213460 6:118730793-118730815 CTCCCTTGGAGTCCAGTCCCAGG - Intergenic
1015709207 6:136121085-136121107 GTCCCTCGGTGTCTGGGCCCTGG + Intronic
1017603834 6:156112049-156112071 CTCCCTGGCTGTCAGGGCCAGGG - Intergenic
1017980823 6:159400036-159400058 CTTCCTAGGAGGCTGGGACAGGG + Intergenic
1018645982 6:165948853-165948875 CTCACTGGGACTCTGGGCCAAGG - Intronic
1018849040 6:167574714-167574736 CTGCCTCGTAGGCTGGGCCAGGG - Intergenic
1019186682 6:170224602-170224624 CTTCTTTAGAGTATGGGCCAGGG - Intergenic
1019313203 7:372776-372798 CACCCTTGGAGAGTGGGGCAGGG + Intergenic
1022519303 7:30995522-30995544 GTCCCTCTCAGTCTGGGCCAGGG - Intergenic
1023101379 7:36721800-36721822 CTCCCTTTGAGTCTGGGTGGAGG + Intronic
1023157379 7:37264732-37264754 CTCCCTTGGAGTCTGGAGTCTGG - Intronic
1023998610 7:45177011-45177033 CTCCCAAGGAGTTTGGCCCAGGG + Intronic
1026119814 7:67526933-67526955 CTCTCTTGGAGTCTGGATCAGGG + Intergenic
1026858740 7:73771014-73771036 CTCCCTTTGAGCCTGAGTCAGGG + Intergenic
1029410982 7:100410480-100410502 CTCCCTTGAGGTCTATGCCATGG + Intronic
1029647477 7:101867348-101867370 CTCCCTTGATGCCTGGGGCAGGG - Intronic
1032767876 7:135017110-135017132 CTTCCTTGGAGTCTGGATAAAGG - Exonic
1032784077 7:135186897-135186919 CTCCCTGGAGGTCTGGGCCATGG - Intronic
1034182248 7:149147800-149147822 CTCCCTCGGGGTCTGGGTCTCGG - Intronic
1034434378 7:151056220-151056242 CTCCCCTGGAACCTGGACCAAGG + Intronic
1034479821 7:151310956-151310978 CTACCTGGGAGGCTGGGACATGG + Intergenic
1034579826 7:152032712-152032734 CTACCTTGAAGTCTGGGCATTGG - Intronic
1035569173 8:660706-660728 CTCCCTCCCAGTTTGGGCCAGGG - Intronic
1035962942 8:4157732-4157754 TTTCCTAGGAGTCAGGGCCAGGG + Intronic
1036292972 8:7511141-7511163 CTCCTTGGGAGTCTGAGACAGGG + Intergenic
1036329589 8:7809867-7809889 CTCCTTGGGAGTCTGAGACAGGG - Intergenic
1037946478 8:22992841-22992863 CTTCCTGGGAGGCAGGGCCAGGG + Intronic
1039518032 8:38149236-38149258 TGCCCCTGGATTCTGGGCCAGGG + Intronic
1043728932 8:83650396-83650418 CTCCCATGGATTCTGAGCTAGGG - Intergenic
1045624595 8:104028807-104028829 CTCTCTTGGAGTCTGGATCAGGG - Intronic
1046672011 8:117066394-117066416 CTTTCTTGGAGTCAGGGCCCTGG + Intronic
1047526896 8:125641490-125641512 CTCCCAGGGAGCCAGGGCCAAGG + Intergenic
1048469532 8:134695131-134695153 CTCCACTGCAGCCTGGGCCATGG - Intronic
1048517490 8:135124140-135124162 CTCCTTTGAAGTCTGGCCCCAGG + Intergenic
1048720189 8:137314795-137314817 GTCCCTTGGAGTCAGGGCAGGGG - Intergenic
1049229359 8:141474063-141474085 CTCCTTTGGAGTCTGGCCATAGG + Intergenic
1049256895 8:141618966-141618988 CTCCCTGGGAGTTGGGCCCAGGG + Intergenic
1049604804 8:143524325-143524347 CTCCCTGGGAGTCTGGGCTAAGG + Intronic
1049658629 8:143809865-143809887 CTTCCTTGCAGGCTGGGACAGGG - Intronic
1055514922 9:77024205-77024227 CTCCCTTGGGATCAGGGCCTTGG - Intergenic
1056985710 9:91362061-91362083 CTCGCTTGGAGAATGGGGCAAGG - Intergenic
1057035849 9:91811265-91811287 TTCCCGTGCAGTCTGGGCCTGGG - Intronic
1059321663 9:113475153-113475175 CTCCCTTTGGCTCTGGGCCCTGG + Intronic
1061924125 9:133797666-133797688 CAACCTTGGAGCCAGGGCCAGGG + Intronic
1062019246 9:134308647-134308669 CTCCCATGGTGTCTGTTCCATGG - Intergenic
1062019288 9:134308825-134308847 CTCCCATGGTGTCTGTTCCATGG - Intergenic
1185702665 X:2242939-2242961 CTCCCTTGGGGTCTGGACTGGGG + Intronic
1185775649 X:2800937-2800959 CTACCTTCCAGCCTGGGCCATGG + Intronic
1189412525 X:40785823-40785845 ATCCCTTGAAGTCTGGGAGAGGG - Intergenic
1191617040 X:63180909-63180931 GTCTCTTGGAGTCTGGATCAAGG + Intergenic
1191619257 X:63198014-63198036 GTCTCTTGGAGTCTGGATCAAGG - Intergenic
1192808689 X:74531490-74531512 CCCCATTGGGGTCTGGGTCAGGG - Exonic
1195487704 X:105428256-105428278 ATCCCTTGGAGTCTGGAACTGGG - Intronic
1195670543 X:107466257-107466279 ATCCCTGGGAGTCTGGGAGAGGG + Intergenic
1195682558 X:107559801-107559823 CACCCTGGGCTTCTGGGCCAGGG + Intronic
1195732375 X:107980376-107980398 GTCACTTGGAGTTGGGGCCAGGG - Intergenic
1196477410 X:116104785-116104807 CTCCCTTGGAATCTGAACAAAGG - Intergenic
1198297991 X:135305607-135305629 CTCCCTTGAAGTTTGGGGGAGGG - Intronic
1199318352 X:146407946-146407968 CTCCCTTTGAGTTTTAGCCAGGG - Intergenic
1199559284 X:149146173-149146195 CTCCCTTGGGGTCAGGCCCTGGG + Intergenic
1199677339 X:150199512-150199534 CTCTGTTGGAGTCTGGGCCTGGG + Intergenic
1200960282 Y:8990253-8990275 CTCACTTGAACACTGGGCCATGG - Intergenic
1201294276 Y:12450396-12450418 CTGCCTTCCAGCCTGGGCCATGG - Intergenic
1201858112 Y:18567749-18567771 CTGCCTGGGTGGCTGGGCCATGG + Intronic
1201875209 Y:18752632-18752654 CTGCCTGGGTGGCTGGGCCATGG - Intronic
1202067670 Y:20957976-20957998 CTCTCTTGGAGTCTGGATCAGGG - Intergenic
1202113553 Y:21449171-21449193 CTTCCTTGGACTCTGGCTCATGG + Intergenic