ID: 963067607

View in Genome Browser
Species Human (GRCh38)
Location 3:141275663-141275685
Sequence CTTTCTTTCCAGTAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963067607_963067616 11 Left 963067607 3:141275663-141275685 CCTTCCAACTACTGGAAAGAAAG 0: 1
1: 0
2: 3
3: 25
4: 255
Right 963067616 3:141275697-141275719 GCAACCAAAGGGCTAATGTTGGG 0: 1
1: 0
2: 1
3: 11
4: 101
963067607_963067612 0 Left 963067607 3:141275663-141275685 CCTTCCAACTACTGGAAAGAAAG 0: 1
1: 0
2: 3
3: 25
4: 255
Right 963067612 3:141275686-141275708 TGGCCCTAGGAGCAACCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 98
963067607_963067611 -1 Left 963067607 3:141275663-141275685 CCTTCCAACTACTGGAAAGAAAG 0: 1
1: 0
2: 3
3: 25
4: 255
Right 963067611 3:141275685-141275707 GTGGCCCTAGGAGCAACCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 83
963067607_963067619 15 Left 963067607 3:141275663-141275685 CCTTCCAACTACTGGAAAGAAAG 0: 1
1: 0
2: 3
3: 25
4: 255
Right 963067619 3:141275701-141275723 CCAAAGGGCTAATGTTGGGTGGG 0: 1
1: 0
2: 1
3: 6
4: 147
963067607_963067617 14 Left 963067607 3:141275663-141275685 CCTTCCAACTACTGGAAAGAAAG 0: 1
1: 0
2: 3
3: 25
4: 255
Right 963067617 3:141275700-141275722 ACCAAAGGGCTAATGTTGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 114
963067607_963067615 10 Left 963067607 3:141275663-141275685 CCTTCCAACTACTGGAAAGAAAG 0: 1
1: 0
2: 3
3: 25
4: 255
Right 963067615 3:141275696-141275718 AGCAACCAAAGGGCTAATGTTGG 0: 1
1: 0
2: 1
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963067607 Original CRISPR CTTTCTTTCCAGTAGTTGGA AGG (reversed) Intronic
901252785 1:7793945-7793967 CTTTCTTTCTAGCAGCTGCACGG + Exonic
901420612 1:9148634-9148656 GCTTCTTGCCTGTAGTTGGAGGG - Intergenic
902613555 1:17610956-17610978 TTTTTTTTCCAGTTGTGGGATGG + Intronic
903191225 1:21657457-21657479 ATTTCTTCCCAGTAGTTAGCTGG - Intronic
907927718 1:58970132-58970154 GTTTCTTTCCTGTACCTGGAAGG - Intergenic
909462883 1:75939303-75939325 CTTTTTTTCTAGGAGATGGAAGG - Intergenic
910439825 1:87240779-87240801 ATTTCTTTCCAATAAGTGGATGG + Intergenic
912078196 1:105904809-105904831 CTTTTTTTCCATTAGTTTAATGG + Intergenic
912430592 1:109626524-109626546 TTCTCTTTCCAGCAGCTGGAGGG + Intronic
913635407 1:120754757-120754779 CTTTCTTACCATTTGTTTGAAGG - Intergenic
916875196 1:168961567-168961589 CCTTCTTTCCAGTCCTTGGGTGG - Intergenic
918715228 1:187778158-187778180 CTTACTTTATAGTAGTTGCAGGG + Intergenic
919746118 1:201010210-201010232 CTTCCTTTCCAGGAGTTGGGCGG + Intronic
921972705 1:221167709-221167731 CTATGTTTCCAGTAGGTGGTGGG + Intergenic
922291313 1:224211064-224211086 CTTTCTTTCCAGTGGGAAGAGGG - Intergenic
922748664 1:228060716-228060738 CTATCTCTCCTGTAGCTGGATGG - Exonic
923467102 1:234258872-234258894 TTTTATTTCCACTAGTTGGATGG - Intronic
923830691 1:237552215-237552237 CTTTCTTCCCAGTGGTTACAGGG - Intronic
1063646626 10:7890202-7890224 CTTTCTTTTCTGTGCTTGGAAGG + Intronic
1063684507 10:8224004-8224026 CTCTCTGTGCAGTATTTGGAAGG - Intergenic
1063800984 10:9577870-9577892 CTTCATTACCAGGAGTTGGAAGG + Intergenic
1064158184 10:12921030-12921052 TTTTCTTGAGAGTAGTTGGAAGG - Intronic
1064532532 10:16324824-16324846 TTTTCTTTTCAGCACTTGGATGG + Intergenic
1065409328 10:25406284-25406306 CTGACTTTCCAGAAGATGGAAGG - Intronic
1066542558 10:36463799-36463821 CTTGTTTTCCAGTAATTAGATGG - Intergenic
1068015996 10:51516793-51516815 CTATATTTCCAGTGCTTGGAAGG - Intronic
1070224583 10:74488342-74488364 CTTATTTTCCAGTGGTTTGAGGG + Intronic
1070680845 10:78448041-78448063 CTTTCTTTCCAGGACTGGGTTGG + Intergenic
1071418860 10:85468682-85468704 GTATATTTCCAGTAATTGGATGG - Intergenic
1071523163 10:86343420-86343442 GTTTCTTTCCATTAGTGAGATGG - Intronic
1071925477 10:90403474-90403496 CTTTGGTTCCAGTAGCTGGCAGG + Intergenic
1072010109 10:91295473-91295495 CTGTCTATCCAGTCGTTGAAAGG + Intergenic
1073066446 10:100762252-100762274 ATTTCTCTCCAGCAGTTTGAGGG + Intronic
1075501983 10:122983365-122983387 CTTTCTTCCCATCAGGTGGATGG - Exonic
1076216055 10:128694281-128694303 CTTTCTTTGTACTATTTGGAGGG - Intergenic
1079042038 11:17068006-17068028 TTTTTTTTCCAGAACTTGGAAGG - Intergenic
1079948937 11:26777920-26777942 TTTTATTTCCAAAAGTTGGATGG + Intergenic
1081255458 11:40888341-40888363 ATTTGTTTCCAGTAAGTGGAAGG + Intronic
1086796287 11:91107749-91107771 CTTTCTTGCAATTGGTTGGATGG - Intergenic
1086959473 11:92967970-92967992 CTTTCTTTCTTGTAGTAGAAAGG - Intergenic
1088086518 11:105987262-105987284 TTTTCCTTCCAGGAGATGGAAGG + Intergenic
1089481246 11:118806975-118806997 CTTTCTTTCAAGTGAATGGAAGG + Intergenic
1091021623 11:132105142-132105164 CTTTCCTCCCAGTGGGTGGAAGG + Intronic
1091906310 12:4192153-4192175 CTTTAATTCCAGTACTTGGGAGG - Intergenic
1092139360 12:6172078-6172100 CTTGCTTTCCTGCAGATGGATGG + Intergenic
1093511266 12:19931659-19931681 CTTTCTTTCCAGTGCTGGAATGG - Intergenic
1093680313 12:21994687-21994709 CTTTCTTTCCAGGAGTGGGTAGG + Intergenic
1095800127 12:46263348-46263370 CATTCCTGCCACTAGTTGGAGGG - Intronic
1096320436 12:50607530-50607552 CCTTCTTTTCAGTAGTAGAAAGG - Intronic
1098617948 12:72553632-72553654 ATTACTTTCCTGTATTTGGAAGG + Intronic
1098622442 12:72619308-72619330 CTTACTTTCCAAGAGTTAGAGGG + Intronic
1099043963 12:77693048-77693070 CTTTCTTTCTATTTTTTGGAGGG - Intergenic
1099623631 12:85036805-85036827 CTTTCTTTACAGGGGTTGAAGGG + Intronic
1099725891 12:86427270-86427292 CTACCTCTCCAGTAATTGGATGG - Intronic
1099820889 12:87708125-87708147 TTTGCTTTGCTGTAGTTGGATGG - Intergenic
1101533870 12:105599584-105599606 CTTTACTTCCAGTTGGTGGATGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1107307108 13:39034427-39034449 CTTTCTTTGTAGAAGTTGGTAGG - Intronic
1108738809 13:53313527-53313549 CTATCTTTCTAGTTGTTTGATGG + Intergenic
1111772057 13:92609362-92609384 CTTTCTTTTCAGTTTTTTGAAGG + Intronic
1112699322 13:101987212-101987234 CTTTTTTTCCTGGAGTGGGATGG - Intronic
1113447214 13:110378763-110378785 CATTCTTCCCAGTGGTTCGAAGG - Intronic
1113673656 13:112193932-112193954 CTTTATTTTCAGTAATTCGATGG - Intergenic
1114034078 14:18605202-18605224 ATTTCTTTCCAGTAGTCTTAAGG + Intergenic
1114078877 14:19184376-19184398 ATTTCTTTCCAGTAGTCTTAAGG + Intergenic
1114124564 14:19709808-19709830 ATTTCTTTCCAGTAGTCTTAAGG - Intergenic
1114419625 14:22570447-22570469 GTTTCTTTCCAGTCATTGGGGGG - Intronic
1115153013 14:30307070-30307092 CTTATTTTCCAGTACTTGTAAGG - Intergenic
1115290782 14:31769782-31769804 TTTTTTTTTCAGTAGTTGGAAGG + Intronic
1115452737 14:33566703-33566725 CTTTCTTCTCTGTAGTTGCAGGG + Intronic
1116588932 14:46746377-46746399 CTTTTTTTCCAGTGCTTGAAAGG - Intergenic
1116963806 14:50993753-50993775 CTTTCTTTCCATTTGGTTGAGGG + Intronic
1117315274 14:54566529-54566551 CTTTCTTTGCTGTCGTTGGGGGG + Intergenic
1122658949 14:103281655-103281677 CTTCCTTTCCAGCAGAGGGAGGG - Intergenic
1202908805 14_GL000194v1_random:97951-97973 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1123510794 15:20997333-20997355 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1123568014 15:21571090-21571112 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1123604122 15:22006414-22006436 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1124926994 15:34080108-34080130 CATACTTCTCAGTAGTTGGAAGG - Intergenic
1125530400 15:40409529-40409551 CTTTCCTTCCTGCAGTTGTAGGG + Intronic
1127948477 15:63780380-63780402 CTTTATTTCCTGTTGTTAGATGG - Intronic
1129468589 15:75738122-75738144 CCTTCTTTCCAGCACTTGCATGG - Intergenic
1129726991 15:77906385-77906407 CCTTCTTTCCAGCACTTGCATGG + Intergenic
1131825145 15:96315084-96315106 CTTTCTCTCTCTTAGTTGGAAGG - Intergenic
1131835796 15:96389622-96389644 CATTGTTTCCAGCAGTTGGCAGG - Intergenic
1202976373 15_KI270727v1_random:298180-298202 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1134829918 16:17314614-17314636 CTTTCTTTCCTGGAATGGGAGGG - Intronic
1135203627 16:20462887-20462909 CTTTATTCACAGTAGTTGGAAGG + Intronic
1135215378 16:20562049-20562071 CTTTATTCACAGTAGTTGGAAGG - Intronic
1135637085 16:24086871-24086893 CTTTCTTTTAAATATTTGGAGGG + Intronic
1138253654 16:55530843-55530865 CTTTCTGTCCAGAAGTGGAATGG + Intronic
1138968031 16:62109909-62109931 CCTTCTATTCAGTAGTTTGAGGG - Intergenic
1140256462 16:73340811-73340833 GTTTTTTTCCAGTACTTGTAGGG - Intergenic
1140536754 16:75716714-75716736 CCTCCTCTCCAGAAGTTGGAGGG + Intronic
1141120795 16:81354227-81354249 TTTTTTTTCCAAGAGTTGGAAGG - Intronic
1141768314 16:86073220-86073242 CTCTCTTTCCAGAATTTTGAAGG + Intergenic
1142499338 17:323618-323640 CTTTCTCTACATTAGCTGGAGGG - Intronic
1146590088 17:34121339-34121361 GTTCCTTTCCAGTGTTTGGAAGG - Intronic
1146986684 17:37226835-37226857 CCTTCTTTCCAAAAGTGGGAGGG - Intronic
1147000189 17:37356854-37356876 CTTTTTTTCCTTTAATTGGATGG - Intronic
1147233229 17:39035044-39035066 CTTCCTTCCCAGTACTTAGAGGG + Intergenic
1148284936 17:46380412-46380434 TTTCTTTTCCAGTAGTGGGAAGG - Intergenic
1148307157 17:46598333-46598355 TTTCTTTTCCAGTAGTGGGAAGG - Intronic
1148466965 17:47870857-47870879 CTTTCTCTCCACTGGTTTGATGG + Intergenic
1149123009 17:53192595-53192617 CTTCATTTGCAGTAGTTGAATGG - Intergenic
1149945379 17:60919848-60919870 ATTTCTTAGCGGTAGTTGGAGGG - Intronic
1150119969 17:62592821-62592843 CTTGCTTTCCTGCAGTTGAACGG + Intronic
1152741083 17:82018616-82018638 CTTTCTTACCAGGAGTGGAAGGG + Intergenic
1154928371 18:20964118-20964140 TTTTTTTTTAAGTAGTTGGATGG - Intronic
1157091307 18:44640234-44640256 CTTTCTTACCTGCAGTGGGAAGG - Intergenic
1158330538 18:56357430-56357452 TTTTCTTTCCATTGGGTGGAGGG + Intergenic
1159869053 18:73740056-73740078 CTTTCTTCCCAATTATTGGAGGG - Intergenic
1161355573 19:3817632-3817654 CTGTAGTTCCAGTACTTGGAAGG + Intronic
1163663631 19:18593091-18593113 CTGTCTATCCAGTATTTGCAAGG - Intronic
1165681291 19:37778539-37778561 CTTTCTTTCCAGTAGATGTTGGG - Intronic
1166643442 19:44513395-44513417 CTTGTTTTCCAGTCGTTGGGAGG + Intronic
926021351 2:9498287-9498309 CTATCATTCCAGCACTTGGAAGG - Intronic
926153630 2:10438387-10438409 CTTTGTTTCCAGTAGGTTTATGG + Intergenic
928075758 2:28263034-28263056 CTTGCCTTCCAGTAGATGAAAGG + Intronic
930504448 2:52264535-52264557 CTTTCTTCCCAGTAGTGAAAGGG - Intergenic
930982922 2:57549819-57549841 CTGGTTTTCCAGTAGTGGGATGG + Intergenic
932778928 2:74548008-74548030 GTTTCTTCCCAGTTGGTGGAAGG + Intronic
932803731 2:74765679-74765701 CTTTCTTTCCATTAGGAGGTGGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934968514 2:98744055-98744077 CTACCTTTGCAGTGGTTGGAGGG - Intergenic
935292983 2:101625533-101625555 CTTTCTTTCAAGAAGTTGCCGGG - Intergenic
936936286 2:117841292-117841314 CTTTCTTCCCAGTGGTTGACAGG - Intergenic
937212764 2:120287182-120287204 CTATCCTTCCAGGACTTGGATGG + Intronic
937541057 2:122954263-122954285 CTTTTATTCCAGTGGATGGATGG + Intergenic
938061191 2:128255708-128255730 CTCTCCTTCCAGGATTTGGATGG - Intronic
938068050 2:128292490-128292512 CTTGCTTCCCAGAAGCTGGAAGG + Intronic
938450985 2:131419769-131419791 ATTGCTTTCCAGCAGTGGGAAGG - Intergenic
939991463 2:148879940-148879962 ATTTCTTGGCAGTAGATGGATGG + Intronic
940722942 2:157301546-157301568 TCTTCTTTCCAGTGCTTGGATGG - Intronic
941026461 2:160461440-160461462 CTTTAATTCCAGTAAGTGGAGGG + Intronic
942160146 2:173176525-173176547 CTTTCTTAGCAGTAGTTCAAGGG - Intronic
944514078 2:200493784-200493806 CTTTATTCCCAGTAGTCGTAGGG + Intronic
945266295 2:207894516-207894538 ATGTCTTTCCACTGGTTGGAAGG - Intronic
946233484 2:218307378-218307400 CTTGTTTTCCAGCAGCTGGATGG + Intronic
946917233 2:224536368-224536390 CTTTCTTTGAAGTAATTGGTTGG - Intronic
947210095 2:227700609-227700631 ATATCTTTCCAGATGTTGGAAGG - Intronic
947273055 2:228360571-228360593 AGTTCTTTCCAGTAGATGCAGGG + Intergenic
947332936 2:229049127-229049149 CTTTCTTTCCAATAGCTACATGG + Intronic
1176628166 21:9112614-9112636 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1176947262 21:14997937-14997959 TTTATTTTCCAGTAATTGGAAGG + Intronic
1177949358 21:27514954-27514976 CTTTCTTTCCAGTAGTTGTCAGG + Intergenic
1180458195 22:15532245-15532267 ATTTCTTTCCAGTAGTCTTAAGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181516858 22:23419279-23419301 GTTTCTTTGCAGTGTTTGGATGG - Intergenic
1182650077 22:31844525-31844547 CGTTCTCTCCACTAGTTGGCTGG + Intronic
1183724347 22:39580268-39580290 CTTTCTCCACAGCAGTTGGAGGG - Intronic
1183836715 22:40460313-40460335 CTGTCTTTCCTGTAGTAGCAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949515916 3:4806878-4806900 CTTACTTTCCTGTAGTTGGAGGG + Intronic
951354689 3:21650404-21650426 CTTTCTTTACAGTAATTGGCAGG - Intronic
951607069 3:24447436-24447458 CCTTCTTTGCAGTAATGGGAGGG + Intronic
952325253 3:32314798-32314820 CTTTCTTTCCATTATTGGTAAGG + Intronic
955436725 3:58907960-58907982 ATTTCTTTCAGGTATTTGGAAGG - Intronic
955549727 3:60070824-60070846 CTTTCTTCAAAATAGTTGGATGG + Intronic
960608248 3:119530454-119530476 CTGTGTTTCCAGTAGCTAGAGGG - Intronic
961140074 3:124548322-124548344 CTCTCTTCCCAGTTTTTGGAGGG + Intronic
961433394 3:126899125-126899147 CTTTCTGTGCAGTGTTTGGAGGG + Intronic
963067607 3:141275663-141275685 CTTTCTTTCCAGTAGTTGGAAGG - Intronic
964892322 3:161551929-161551951 GTGCCTTTCCAGTGGTTGGATGG + Intergenic
965602562 3:170469484-170469506 CTTTCTTTTCTGTAGGTGGGGGG + Intronic
966772066 3:183512878-183512900 CTTTCTTCCCTGAAATTGGATGG - Intronic
967067305 3:185930155-185930177 CTTTCTTTCCTTTAGTGGGCTGG + Intronic
967576495 3:191100816-191100838 CTTGCTTTCCAGAGGTTAGAGGG - Intergenic
967881071 3:194302007-194302029 CTTTATTACTAGTTGTTGGAGGG - Intergenic
967944108 3:194788638-194788660 CTTTCCCTCCTGTAGGTGGAAGG + Intergenic
967965614 3:194957861-194957883 CTGTCTTTGCAGTTGATGGAAGG + Intergenic
968310875 3:197682216-197682238 CTTTCCTCCCAGTAGTTGTGTGG - Intronic
968955121 4:3715188-3715210 CGTTCTTTCCAGTTGTTTGTTGG - Intergenic
971577266 4:28291590-28291612 CTTTTTTACCAGTTGTTGGGAGG - Intergenic
971762348 4:30782837-30782859 CTTTCCTTCGAGTATATGGAGGG + Intronic
972645547 4:40964659-40964681 CATTGTTTCCAGTGGCTGGATGG - Intronic
974375737 4:61073736-61073758 CTTTCTTTCCAGTAGTTTTCAGG + Intergenic
977744197 4:100525697-100525719 ATTTATTTCGAGAAGTTGGATGG - Intronic
979491390 4:121331981-121332003 CTTTCTTTCAAGTAAGTGGGAGG + Intronic
979910906 4:126364275-126364297 CTTACTTTCCAGCTCTTGGATGG - Intergenic
980829326 4:138110801-138110823 CTTACTTTCTAGTTGTTGTAGGG + Intergenic
981420577 4:144545498-144545520 CTTTCTTTCCATTAGGTAGCAGG - Intergenic
981420677 4:144546682-144546704 CTTTCTTTCCAGGGGGTGGGTGG + Intergenic
981700445 4:147602138-147602160 TATTCTTTCCAACAGTTGGATGG - Intergenic
983001053 4:162414452-162414474 TTTTCTTTCAAGTAGGTCGAAGG - Intergenic
983177635 4:164610199-164610221 CTTTCTTTTCATAAGATGGAGGG + Intergenic
984181116 4:176483363-176483385 ATTTCTTTTCAGTATTTAGATGG + Intergenic
984263833 4:177472615-177472637 CTTTCATTCCATTTTTTGGAAGG + Intergenic
984298219 4:177881280-177881302 CTGTCTTTCCAGTTTGTGGAGGG + Intronic
985422856 4:189801917-189801939 TTTTCTTTACAGCACTTGGAAGG - Intergenic
985874777 5:2586373-2586395 CTTTCTTCCCAGTTGGTGGTTGG + Intergenic
987042220 5:14073579-14073601 CATGCTTTCCAGGAGTTGCAAGG + Intergenic
987186476 5:15425526-15425548 CTAGCTTTCAAGTAGTTGGATGG - Intergenic
987314248 5:16709535-16709557 TTTTCTTTCTAGTTGTTGGCTGG - Intronic
987621664 5:20343761-20343783 CTCTCTTTCCAGTAGTGGCATGG - Intronic
988368148 5:30329419-30329441 CTTTCCTTCCAGCATTTGAAAGG + Intergenic
990898259 5:60723098-60723120 CTTTCTTTTCAGTAGTGACAAGG + Intergenic
991713342 5:69429541-69429563 CTTACTTTCCAGTAGCAGTATGG + Intronic
992673548 5:79083123-79083145 CTTTTTTTTTAATAGTTGGAAGG - Intronic
994773031 5:104007536-104007558 CTTTATTTCCTGTAGTTTCATGG + Intergenic
995873453 5:116766047-116766069 CTTTCCTACCAGTATTGGGAGGG + Intergenic
997034207 5:130168064-130168086 CTTTCCTTTAAGTAGTTGAAAGG + Intronic
997310130 5:132872880-132872902 CTTTCTTCCCAGTAGTTGAGTGG - Exonic
997677314 5:135722644-135722666 CTTTCTTTACAGTATTATGAGGG + Intergenic
999109840 5:149109507-149109529 CTTTCTTCCCAGTCCTTGTAAGG - Intergenic
999472784 5:151870708-151870730 CTTTCTTGCCATTAGAAGGAGGG + Intronic
1000281172 5:159783582-159783604 CTCTTTCTCCAGTAGTTGAAAGG + Intergenic
1001305242 5:170567651-170567673 CTTTCTGATCAGAAGTTGGATGG + Intronic
1001861936 5:175063514-175063536 CTTTCCTTCCAGTATAGGGAGGG - Intergenic
1001933877 5:175691244-175691266 CTTCCTCTCCAGGAGTGGGAGGG - Intergenic
1009176595 6:60467502-60467524 CTTTCTTTCCTTTAGTTGGGGGG - Intergenic
1009251048 6:61299294-61299316 CTTTTTTTCCATTATGTGGATGG - Intergenic
1010716725 6:79238934-79238956 CTTTCTCTTCTGTAGTTGCAAGG + Intergenic
1011428777 6:87261468-87261490 TTTTGTTTCCAGTATTCGGATGG - Exonic
1012695165 6:102371845-102371867 CGTTTTTTCCAATAGTTGAATGG + Intergenic
1012776843 6:103506862-103506884 CTGTCTTTCTTGTAGTTGGAAGG + Intergenic
1012807387 6:103911658-103911680 CTTTCCTTCTAGTAGAGGGAGGG + Intergenic
1012832667 6:104225253-104225275 TTTTCTTACCAGTAGTTGAGGGG + Intergenic
1014276619 6:119396453-119396475 CTTTCTTTCCAGTTAGTGGCAGG + Intergenic
1015398659 6:132763628-132763650 TTTTCTTTCAAGGAGTTGTATGG + Intergenic
1015932232 6:138373408-138373430 TTTTCTTTCCAGTTGTTTGTTGG + Intergenic
1015986472 6:138889224-138889246 CATTCTATCCAGTAGCTGGCTGG - Intronic
1016179827 6:141131647-141131669 CTATCTTGGCAGTAGTGGGAAGG + Intergenic
1018215717 6:161525443-161525465 CTTTTATTCCAGTATTTAGAGGG - Intronic
1018880550 6:167874970-167874992 ATTTCTTTCTTGTGGTTGGAAGG + Intronic
1018992360 6:168683937-168683959 CTTTCTTCCAAGTAGATGAAAGG + Intergenic
1020100321 7:5390687-5390709 GTTTATTTCCAGGAGCTGGAAGG - Intronic
1021733333 7:23618506-23618528 CTTTGTCTCCAGTTGTTGGGAGG - Intronic
1022690821 7:32651196-32651218 CTTTCTTTCCAGTGTTGGTAAGG - Intergenic
1024332358 7:48168934-48168956 CCTTATTTCCTGTAGTTGCAGGG + Intergenic
1025533425 7:61918582-61918604 CATTCTTTCTAGTTTTTGGAGGG - Intergenic
1027932611 7:84557043-84557065 CTTTCAGGCCAGTAGTTAGAAGG + Intergenic
1027980392 7:85212219-85212241 CTTTCCTTCCAGTATAGGGAGGG + Intergenic
1028674436 7:93442629-93442651 CTCTCTTACCAGTACTTGTAGGG + Intronic
1028736925 7:94224519-94224541 CTTTTGTTCTAGTTGTTGGATGG - Intergenic
1030643305 7:112030530-112030552 ATTTATTTCCTGTAGTTTGAGGG + Intronic
1032763713 7:134970367-134970389 CTTTTATTCCAATATTTGGATGG + Intronic
1033560429 7:142525639-142525661 TTTTCGTTTAAGTAGTTGGAAGG + Intergenic
1036083059 8:5579480-5579502 CTCTGTTACCAGTAGATGGAGGG + Intergenic
1037140289 8:15511227-15511249 ATTTCTCTCCAGTAGAAGGAGGG + Intronic
1038693766 8:29786566-29786588 CAGTCTTTCCTGTAGTTGGATGG - Intergenic
1040360783 8:46662227-46662249 CTTTCTCTCCAGGAGTTGTGCGG + Intergenic
1042067893 8:64899154-64899176 CTTTATCCCCAGTAGTTGCAGGG + Intergenic
1042409192 8:68442836-68442858 GTTTCTTTCAAGTTGTTGAAAGG + Intronic
1043217526 8:77612165-77612187 TTTTCTCTCCAGTATTTGTATGG - Intergenic
1043873508 8:85461496-85461518 CTATCTTTCCATTAGAGGGAAGG - Intergenic
1043983829 8:86670909-86670931 CTTTCTTCCCAGTACTTGGAGGG + Intronic
1045949570 8:107836455-107836477 GTTCTTTTCCAGTAGTTTGAAGG - Intergenic
1046333531 8:112753423-112753445 CATTCTTTCCAGAAATAGGAAGG - Intronic
1046656148 8:116897673-116897695 GTTTCTTTCTAGTAGTTTCATGG - Intergenic
1050157492 9:2683030-2683052 CTTTCTTTCAAGCAATGGGAAGG + Intergenic
1050737382 9:8779484-8779506 CATTCTTTCTAATAATTGGAAGG - Intronic
1052223430 9:26055162-26055184 CTTTTTTTTCAGTATCTGGAAGG + Intergenic
1053552717 9:39101132-39101154 CCTCCTTTCCAGTAGTTTGATGG + Intronic
1053816832 9:41921296-41921318 CCTCCTTTCCAGTAGTTTGATGG + Intronic
1054107091 9:61064978-61065000 CCTCCTTTCCAGTAGTTTGATGG + Intergenic
1054613766 9:67266147-67266169 CCTCCTTTCCAGTAGTTTGATGG - Intergenic
1054845407 9:69791233-69791255 CTTTCTTACCAGCATTTAGATGG + Intergenic
1055785014 9:79862963-79862985 CATTCTTTCCTGTAGCCGGATGG + Intergenic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1058769103 9:108213066-108213088 GTTTCTTTCCAGTAGTCAGAGGG - Intergenic
1059965670 9:119611068-119611090 CTTTCTTTCAAGTTCTTGAAAGG + Intergenic
1060049794 9:120370147-120370169 TTTTCATTCCAGTGATTGGAAGG - Intergenic
1061061213 9:128251190-128251212 CCTTCTTTCCAGCACTTGCATGG + Intronic
1061539501 9:131270472-131270494 GTTTGTTTCCAGTGCTTGGAAGG + Intronic
1203751010 Un_GL000218v1:80294-80316 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1203482976 Un_GL000224v1:24049-24071 CTGTCTCTGTAGTAGTTGGATGG + Intergenic
1203582631 Un_KI270746v1:26005-26027 CTTTCTTTCAAGAAATTAGAAGG - Intergenic
1186096059 X:6103342-6103364 CTTTCCTTCCAGAAAATGGAGGG - Intronic
1187272111 X:17788660-17788682 GTTTCTTCCCAGTAGGTGGGTGG + Intergenic
1187319205 X:18225545-18225567 CTTATTTTCCAGTAGTGGGATGG + Intergenic
1188308131 X:28584257-28584279 TTTTCTTTCCAGTAATATGATGG - Intergenic
1188651525 X:32636377-32636399 CTTCATTTCTAGTTGTTGGATGG - Intronic
1190452721 X:50597131-50597153 CTTTGTTTCCTGTAGCAGGAGGG + Intronic
1194147005 X:90277755-90277777 CTTTCTTTCCCCTAGTTTTAGGG + Intergenic
1196214587 X:113035668-113035690 CTGTCTTTCAAGTATTTGGGCGG + Intergenic
1196798836 X:119524066-119524088 CTTTTTTTCCAGGAGTTTCAGGG - Intergenic
1198408609 X:136342246-136342268 CTTACTTTCCAGTAGATATAGGG + Intronic
1199991524 X:152990097-152990119 CTTACTTTCCACCAGCTGGAAGG - Exonic
1200493406 Y:3854521-3854543 CTTTCTTTCCCCTAGTTTTAGGG + Intergenic
1201164663 Y:11197917-11197939 CTGTCTCTGTAGTAGTTGGATGG - Intergenic