ID: 963067761

View in Genome Browser
Species Human (GRCh38)
Location 3:141277520-141277542
Sequence AAGAGGTGCTCTTTTTCTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963067761_963067763 6 Left 963067761 3:141277520-141277542 CCGAAAGAAAAAGAGCACCTCTT 0: 1
1: 0
2: 0
3: 38
4: 345
Right 963067763 3:141277549-141277571 TCTGTATATCACCTGTCTCGAGG 0: 1
1: 0
2: 1
3: 3
4: 67
963067761_963067765 12 Left 963067761 3:141277520-141277542 CCGAAAGAAAAAGAGCACCTCTT 0: 1
1: 0
2: 0
3: 38
4: 345
Right 963067765 3:141277555-141277577 TATCACCTGTCTCGAGGAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 95
963067761_963067764 11 Left 963067761 3:141277520-141277542 CCGAAAGAAAAAGAGCACCTCTT 0: 1
1: 0
2: 0
3: 38
4: 345
Right 963067764 3:141277554-141277576 ATATCACCTGTCTCGAGGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963067761 Original CRISPR AAGAGGTGCTCTTTTTCTTT CGG (reversed) Intronic
904741544 1:32680504-32680526 AAGAGTTGCTTTTTTTTTTTAGG + Exonic
907799006 1:57745591-57745613 TAAAGGAGCTCTTTTTCTCTTGG + Intronic
907865002 1:58390923-58390945 AAGAGCTGCTCTATTAATTTAGG - Intronic
908803763 1:67908469-67908491 AAAGGGTGCTCTCATTCTTTTGG + Intergenic
908820385 1:68079477-68079499 AAGATTTTCTCTTTGTCTTTGGG + Intergenic
909162409 1:72170045-72170067 AAGAGGTACACATTTTCTATAGG - Intronic
909551698 1:76905160-76905182 ACGATGTGCTCTCTATCTTTAGG - Intronic
910670501 1:89767828-89767850 TAAAGCTGCTCTTTGTCTTTAGG - Intronic
911237813 1:95430546-95430568 GAGAGGCACTCTTGTTCTTTTGG + Intergenic
911679975 1:100703914-100703936 AACAGCTGCTCTTATTATTTTGG + Intergenic
913691472 1:121283625-121283647 TATAGGTGCTCCTTTTCTGTGGG + Intronic
914146073 1:144996357-144996379 TATAGGTGCTCCTTTTCTGTGGG - Intronic
914463095 1:147902814-147902836 AATATGTGCTCTTTCTCTCTTGG - Intergenic
915139344 1:153757495-153757517 AAGTGGTGCTCGTTTTCCTCTGG + Intronic
916247639 1:162704933-162704955 AAGATTTGCCCTTTTGCTTTTGG + Intronic
916532096 1:165666529-165666551 AGGAGCTGCTCTTTTGATTTGGG - Intronic
917191493 1:172423285-172423307 AAGAGAGACTCTGTTTCTTTGGG + Intronic
917549805 1:176013969-176013991 AATAAGTGCTCTTTTAATTTTGG + Intronic
917862113 1:179156270-179156292 AATAGGTGCTTTGTTTCTCTTGG - Intronic
918599521 1:186339334-186339356 AGGAGGTTTTTTTTTTCTTTTGG - Intronic
918851439 1:189696146-189696168 AAGAAATACTCTTTTTCTTCGGG - Intergenic
919394905 1:197033946-197033968 AAGAGCTGCTCCTTTATTTTAGG + Intergenic
920478798 1:206302102-206302124 TATAGGTGCTCCTTTTCTGTGGG + Intronic
920605359 1:207377928-207377950 AAGAGGTGGGGTTTTCCTTTTGG - Intergenic
921712075 1:218382923-218382945 ATGAGGTGGTGTTTCTCTTTTGG + Intronic
924822484 1:247506716-247506738 AAGATGTGCTCTTTTTCCCTGGG - Intergenic
1063334414 10:5198131-5198153 AAGAGTTGGTCTTATTTTTTAGG + Intronic
1064747341 10:18490967-18490989 AAGAGGTGCTCTGGCTCTTGAGG - Intronic
1064932943 10:20647795-20647817 AAGAGTTAATTTTTTTCTTTAGG + Intergenic
1064970148 10:21057258-21057280 AAGGGTTGCTCTTTGACTTTTGG + Intronic
1066510775 10:36093176-36093198 AAGAGCTGATCTTTTCCTTGGGG + Intergenic
1067034602 10:42903641-42903663 AAAAGGTGCTAGTTTTGTTTTGG - Intergenic
1068731114 10:60358927-60358949 AAGAGTTGCTTTATTTATTTAGG - Intronic
1070102810 10:73404344-73404366 AAAAGGTGCTCATTTCCATTTGG + Intronic
1070977545 10:80617230-80617252 GAGAGGTGGCCATTTTCTTTAGG + Intronic
1071063727 10:81605661-81605683 AAGATTTTCTCTTTTTCTTTGGG + Intergenic
1071793375 10:88980039-88980061 AAGAAGTCCACTTTATCTTTCGG - Intronic
1071819575 10:89265533-89265555 AAAAGATGCTTTTGTTCTTTGGG + Intronic
1071875715 10:89840833-89840855 AAAAGGTGCTTTATTTCATTAGG - Intergenic
1073727219 10:106247405-106247427 ACGAGGTGAAGTTTTTCTTTTGG - Intergenic
1074087665 10:110220792-110220814 AAGAGTTGATATTTTTGTTTAGG - Intronic
1076092811 10:127702953-127702975 AAGAATTCCTCTTGTTCTTTGGG - Intergenic
1077965747 11:7131258-7131280 AAGAATTGGTCTTTTTCTTTTGG + Intergenic
1079256162 11:18832945-18832967 ATGAGCTGATCTTTTCCTTTAGG + Intergenic
1079634253 11:22715806-22715828 AAGATTAGCTCTTTATCTTTTGG - Intronic
1079807401 11:24950693-24950715 AACTGGTGCTTTTTTTCTTTGGG - Intronic
1079973904 11:27069013-27069035 CAGATTTGCTCTTTTTTTTTAGG + Intronic
1080149674 11:29036239-29036261 AAGAAGTGCTCTTTTGATATTGG + Intergenic
1081064967 11:38530627-38530649 AAAAGGTACTCATTTTCTTTAGG + Intergenic
1081859233 11:46322944-46322966 AGGAGGTGCTCTCTCTATTTAGG - Intergenic
1082842644 11:57701467-57701489 AACAGGTCCTGTTTTTATTTGGG + Intergenic
1082964013 11:58947312-58947334 AAGAGCTGCTGCTTCTCTTTGGG + Intronic
1083049594 11:59765426-59765448 AAGTGGTGGTGTTTGTCTTTAGG + Intronic
1085516332 11:77113992-77114014 AAGAGTTGCTTTTTTTTTTTTGG + Intronic
1086372580 11:86169728-86169750 TAGAGGTAATCTTTCTCTTTGGG - Intergenic
1086487579 11:87324938-87324960 AAGAAGTGATTATTTTCTTTAGG + Intergenic
1087768946 11:102186079-102186101 AAGAGGTGGTCTTGTTCTTATGG - Exonic
1088147479 11:106699668-106699690 AAGTTTTGCTGTTTTTCTTTAGG - Intronic
1088267610 11:108002597-108002619 GAGAGGTGCTCTTTTCATGTGGG + Intergenic
1088873045 11:113909238-113909260 AAGAGGAGCTTGGTTTCTTTAGG - Intronic
1089242233 11:117091767-117091789 ATGAGTTGCTGTTTTTCTTTTGG + Intronic
1090612276 11:128482056-128482078 AAGAGGTGCCCTTTTGCTAGTGG - Intronic
1091371338 11:135061712-135061734 CAGAGATGCTGTGTTTCTTTTGG + Intergenic
1093921560 12:24865339-24865361 AAGAGATGCTGTTTTCCTTTTGG - Intronic
1094240550 12:28218205-28218227 AAGAGATAATCTTTTTCTCTGGG + Intronic
1094395109 12:29997143-29997165 AAGGGTTGTGCTTTTTCTTTAGG - Intergenic
1095365777 12:41403243-41403265 AATATCTGCTCTTTTTCGTTTGG + Intronic
1098562348 12:71888785-71888807 TAGAAGTGCTCATTTCCTTTTGG + Intronic
1098790387 12:74815506-74815528 AAGATGTGCCCTTTTCTTTTTGG + Intergenic
1100431954 12:94538922-94538944 GAGAGGGGCTCCTTTTCTCTGGG - Intergenic
1100522331 12:95387370-95387392 AAGAAGTACTTTTTTTCATTGGG + Intergenic
1100972871 12:100090138-100090160 AAGATGTGCTTTATTTCTATAGG - Intronic
1101330256 12:103751680-103751702 AAGAGCTTGGCTTTTTCTTTAGG + Intronic
1102595048 12:113985931-113985953 AAAAAGTGCCATTTTTCTTTGGG + Intergenic
1102739024 12:115189693-115189715 AAAAGGCCCTCCTTTTCTTTTGG + Intergenic
1105804218 13:23940694-23940716 ACAAGGTGCTCTTTAGCTTTGGG - Intergenic
1109940357 13:69355325-69355347 AAGAGGGGCTTTTTTTTTCTTGG - Intergenic
1110030738 13:70609639-70609661 AAGTGATACTTTTTTTCTTTTGG - Intergenic
1110235797 13:73216639-73216661 AAGAAGTGCTCTGTTTCTGTTGG - Intergenic
1111465450 13:88602838-88602860 AAGATGTACTCTTTTTCTGGAGG + Intergenic
1112505618 13:99973205-99973227 AGAATGTGATCTTTTTCTTTGGG + Intergenic
1114168487 14:20246715-20246737 AATGGGTACTCTGTTTCTTTGGG + Intergenic
1114995156 14:28340494-28340516 AAGTGTTGCTATCTTTCTTTGGG + Intergenic
1115041456 14:28934494-28934516 AAGAGATGCACTTTTCATTTAGG - Intergenic
1115378822 14:32710196-32710218 AAGAGGTTTTTTTTTTTTTTTGG - Intronic
1116336183 14:43659605-43659627 AAGAGGTGATATCTTTCTTGAGG + Intergenic
1117430272 14:55651629-55651651 ATGTGATGCTTTTTTTCTTTAGG - Intronic
1117536037 14:56704240-56704262 AAGAGGTGCTTTTTGGCTTCTGG - Intronic
1117714639 14:58567918-58567940 ACTAGGTGCTCTGCTTCTTTAGG - Intergenic
1117836142 14:59808225-59808247 TCAAGGTGGTCTTTTTCTTTAGG - Intronic
1118147465 14:63156066-63156088 AAGAGGGACTCTGATTCTTTTGG + Intergenic
1118469488 14:66061956-66061978 ATGAGGTGATTTTTTTTTTTAGG - Intergenic
1118650250 14:67883764-67883786 AAGGGCTTTTCTTTTTCTTTTGG + Intronic
1118901475 14:69989834-69989856 AAGAGGTGCTCTTATTTGCTGGG + Intronic
1119755971 14:77119770-77119792 AAGTGGTTCTGTTTTTCGTTTGG - Intronic
1120175416 14:81288726-81288748 AAAGGGGGCTCTTTTTGTTTCGG + Intronic
1120180205 14:81335509-81335531 AAGAGTTATTGTTTTTCTTTTGG + Intronic
1120524233 14:85559290-85559312 AAGAGGGGCCCTTTCTCCTTCGG + Intronic
1120698336 14:87669518-87669540 AAGCGTTCCTCTTTTTTTTTTGG - Intergenic
1120699405 14:87681977-87681999 AAAACGTGCACTTTTTCTTCTGG - Intergenic
1120774830 14:88422092-88422114 ATGAGGTGCAGGTTTTCTTTGGG + Intronic
1121260645 14:92563662-92563684 AAGTGCTTCTCTTTTTCTTTTGG + Intronic
1122098906 14:99391682-99391704 AAGAGGAGGTCTCTTTCTTCAGG - Intergenic
1124451875 15:29801249-29801271 AAAAGCTGTTCTTTTTCTTTTGG - Intronic
1124784966 15:32671201-32671223 AAAAAGTGCTCTCTTTCTGTGGG + Intronic
1125266810 15:37891068-37891090 TAGAGTTGCTCTTATTCATTTGG - Intergenic
1126389031 15:48126072-48126094 AACCAGTGCTCTTTCTCTTTTGG + Intronic
1127092635 15:55481794-55481816 GAGAGGTGGGGTTTTTCTTTTGG - Intronic
1128829818 15:70757694-70757716 AAGAGTTGTTTTTATTCTTTTGG + Intronic
1131544826 15:93307431-93307453 AAGAGGAATTCATTTTCTTTGGG + Intergenic
1131547334 15:93326860-93326882 AAGATTTGCACTTTTTGTTTTGG + Intergenic
1131598673 15:93825329-93825351 GAGAGATGCTCTTTTTCCTCAGG + Intergenic
1131718360 15:95138748-95138770 GAGAAAAGCTCTTTTTCTTTAGG + Intergenic
1133148670 16:3809770-3809792 AAAAGTTGCTTTTTGTCTTTCGG - Intronic
1133589167 16:7226125-7226147 AGGAGGTGCTCTTTTTCTCCTGG - Intronic
1134847528 16:17452951-17452973 AATAGGTTGTCTTTTTCTGTTGG - Intronic
1135997670 16:27264381-27264403 AAGAAGTGCTTTTTTTGTTTTGG - Intronic
1136415840 16:30103089-30103111 AGGGGCTTCTCTTTTTCTTTGGG - Intergenic
1137911587 16:52383462-52383484 AAGCATTGCTCTTTGTCTTTTGG + Intergenic
1138572952 16:57887474-57887496 AAGAGGTGCTTTCTTTCTGTTGG + Intronic
1139359108 16:66386258-66386280 CAGAGGTTCTTTTTTTTTTTTGG + Intronic
1139715293 16:68808575-68808597 AAGAAGTTCTCTGTTTCTCTGGG + Intronic
1140305728 16:73800812-73800834 GATGGGTGCTGTTTTTCTTTTGG - Intergenic
1140459161 16:75124858-75124880 AAGAGGTTTTTTTTTTTTTTTGG + Intergenic
1140712826 16:77694128-77694150 AAGAGGTGCTTGTTTCCTATAGG - Intergenic
1141094300 16:81152006-81152028 CTGAGGAGCTCTTGTTCTTTGGG - Intergenic
1141257184 16:82413477-82413499 AAAAAATGCCCTTTTTCTTTTGG - Intergenic
1143314977 17:6025722-6025744 AAGCGGTGGTCTTTTTATATCGG - Intronic
1143419104 17:6775620-6775642 GAGAGGTGTTTTTATTCTTTGGG - Exonic
1143426413 17:6842813-6842835 AAGAGTCACTCTTTTTCTTCCGG + Intergenic
1144661376 17:17073056-17073078 AAGAGGTGCAGGGTTTCTTTTGG - Intronic
1148532039 17:48402930-48402952 AAGAGGTTCAGGTTTTCTTTCGG + Intronic
1148636645 17:49154002-49154024 AAAAAGTGCTTTTTTTTTTTTGG + Intronic
1150129126 17:62657509-62657531 AAGAAGTGGTCTTTGTCCTTGGG + Intronic
1150143254 17:62747821-62747843 AAGAGTTGCTATTTGCCTTTTGG - Intronic
1151217682 17:72588951-72588973 AAGTGATTCTCCTTTTCTTTAGG - Intergenic
1154084769 18:11293018-11293040 TTGAGGTGATCTTTTTCTTTTGG - Intergenic
1154091447 18:11367662-11367684 TTGAGGTGGTCTTTTTCTTTTGG + Intergenic
1154518764 18:15203233-15203255 AAGATCTTCTCTTTTTCCTTTGG + Intergenic
1156307505 18:35892001-35892023 AAGAGTTCTTCTTTCTCTTTTGG - Intergenic
1156647092 18:39177599-39177621 TAGAGGTTTTTTTTTTCTTTTGG + Intergenic
1156808172 18:41212666-41212688 AAGAGCTTCTGGTTTTCTTTGGG + Intergenic
1162821292 19:13225110-13225132 AGCTTGTGCTCTTTTTCTTTGGG - Intronic
1165251625 19:34541585-34541607 AAGAGCAGGTGTTTTTCTTTAGG + Intergenic
1165717130 19:38053552-38053574 AGGAGGTACTTTTTTTTTTTTGG + Intronic
1166983667 19:46647558-46647580 GAGAAATGCTCTTTTTCCTTTGG - Intergenic
1168329096 19:55555838-55555860 AAGGGGTGCAATGTTTCTTTTGG + Intergenic
925625811 2:5841389-5841411 AACAAATGCTCTTTTTCTATGGG + Intergenic
927368792 2:22330576-22330598 AGGGGCTGCCCTTTTTCTTTTGG + Intergenic
928526322 2:32145088-32145110 AAGAGATTTTTTTTTTCTTTTGG + Intronic
928721267 2:34124400-34124422 TTGAGGTCCTCATTTTCTTTAGG + Intergenic
929351074 2:40955993-40956015 AAGTGCTGCTTTTTTTTTTTTGG - Intergenic
929737552 2:44566311-44566333 AACAATAGCTCTTTTTCTTTAGG - Intronic
929821724 2:45279636-45279658 AGGTGGAGCTCCTTTTCTTTGGG - Intergenic
930146437 2:48011134-48011156 AAGTGGAACTCTTTTACTTTTGG + Intergenic
930684904 2:54297619-54297641 AATAGTTTCTCTTTTTCTTGGGG - Intronic
930745287 2:54876480-54876502 AAGAGGTGAGCTTTTATTTTAGG - Intronic
932992554 2:76805876-76805898 TAGAGGTGCTGTTTTCCCTTAGG + Intronic
932994280 2:76830085-76830107 ATGAGGTGTTTTTTTTCTGTTGG - Intronic
933716544 2:85365612-85365634 AAGAGCTTCTCCTTTTCTCTTGG - Intronic
933757941 2:85655008-85655030 AAGAGGCACTTGTTTTCTTTTGG + Intergenic
933897016 2:86821095-86821117 TATAGGTGCTCTTTTTATATAGG + Intronic
935760060 2:106312180-106312202 ATGAAGTGCTTTTTTTTTTTCGG - Intergenic
938033852 2:128019199-128019221 AATGTATGCTCTTTTTCTTTTGG + Intronic
938966488 2:136393213-136393235 AAGGCGTGCTCTTTCTGTTTTGG + Intergenic
939103980 2:137928044-137928066 AAGAGATGCAGCTTTTCTTTTGG - Intergenic
940361225 2:152798312-152798334 TCAAGGTGGTCTTTTTCTTTTGG + Intergenic
941804359 2:169695193-169695215 TAGTCGTGCTATTTTTCTTTAGG + Exonic
942206429 2:173624298-173624320 TAGAAATGCTCTTTTTTTTTAGG - Intergenic
942262762 2:174186486-174186508 AAGAGGGTCTTTTTTTCTCTTGG - Intronic
942539886 2:177004756-177004778 AGGAGGTGATTTTTTTCCTTTGG - Intergenic
942669973 2:178364650-178364672 AAGAGGAGCTGGTTTGCTTTAGG + Intronic
943545268 2:189268677-189268699 AAGAGGTGATTTTTACCTTTTGG - Intergenic
944974017 2:205026768-205026790 ATGAGATACTCTTTGTCTTTTGG + Intronic
944978794 2:205090295-205090317 AAGATTTCCTCTTTTTCATTTGG + Intronic
946116752 2:217469507-217469529 AAGATTAGCTCTATTTCTTTGGG - Intronic
946552408 2:220817047-220817069 CAGAGGAGCAGTTTTTCTTTAGG + Intergenic
946994808 2:225379278-225379300 AAGAAGTGCTCTCTTTCTGCTGG - Intergenic
947245217 2:228039204-228039226 AAGAAGTGCTCGTGTTCTTTCGG - Intronic
948092247 2:235303960-235303982 AAAATGTTCCCTTTTTCTTTTGG - Intergenic
1169594997 20:7188298-7188320 AAGAGGTACTTTCTTTCTGTTGG + Intergenic
1170375057 20:15691145-15691167 AATTGCTGCTCTATTTCTTTGGG - Intronic
1171891306 20:30719378-30719400 ATAAGGTGCTCTTTAGCTTTGGG - Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172667789 20:36612844-36612866 AAGAGGTGTTATTTTTTATTCGG + Exonic
1174274488 20:49393824-49393846 AAGAGGTGGTCTCTTTCATCAGG + Intronic
1176033047 20:63023076-63023098 AAGAGGTGCTCGTTTTCCTCCGG - Intergenic
1179833143 21:44011188-44011210 TCGAGGTGGTCTTTTTCTTTGGG - Intergenic
1180676353 22:17589115-17589137 AAGTGGAGGTCTTCTTCTTTGGG - Intronic
1182042135 22:27246452-27246474 AAGAGGTGCTGTTTTAGATTCGG + Intergenic
1182381058 22:29888348-29888370 AAAAGGTTGTTTTTTTCTTTTGG + Intronic
1182568584 22:31218666-31218688 AAAATGTGATCTTTTTCTCTTGG + Intronic
1182813773 22:33139921-33139943 CAGAGGTGGTCTGATTCTTTTGG + Intergenic
1184806771 22:46799924-46799946 AAGAGCTCCCCTTTTTCCTTTGG + Intronic
1185264917 22:49896283-49896305 GTGAGATGCTCTTTTTCTTCAGG + Intergenic
1185397991 22:50602145-50602167 GGGAGGTGCTCCTTTGCTTTGGG + Intronic
949625632 3:5863646-5863668 ATGATGTTCTCATTTTCTTTTGG + Intergenic
950726254 3:14918906-14918928 AGGATGTGCTGTTTTTATTTTGG + Intronic
953650186 3:44795552-44795574 AAGTGGTCATCTTTTTCTGTGGG - Intronic
954546576 3:51441152-51441174 AAGAGGTGCATCATTTCTTTAGG - Intronic
954676221 3:52316918-52316940 ATGGGGTGATGTTTTTCTTTTGG + Intronic
955322704 3:57985747-57985769 AAGAGGTGCTCTCTCCCTGTTGG + Intergenic
955881914 3:63555923-63555945 AAAAGGAGCTCCTTTCCTTTAGG - Intronic
957217330 3:77337320-77337342 AAGAGATGCCATTTTTCTTAGGG - Intronic
957808453 3:85184555-85184577 AAGACATGCTCTCTTTCCTTAGG + Intronic
958100996 3:89010400-89010422 AAGACTTGAGCTTTTTCTTTAGG + Intergenic
958973699 3:100641352-100641374 CTGAGGTGGTCTTTTTCTTTTGG + Intronic
960051410 3:113242254-113242276 AAGTGGTTTTCCTTTTCTTTCGG + Intronic
960542404 3:118876014-118876036 AAGATATGCAGTTTTTCTTTTGG - Intergenic
961409118 3:126705357-126705379 AAGAGCTGCTTTTATTCTTCTGG - Intronic
961558039 3:127710070-127710092 AAGAGGTGCTGTTTTTCCACTGG + Intronic
961566120 3:127764262-127764284 CAGAGTTGCCCTTTGTCTTTAGG - Intronic
962369884 3:134812606-134812628 AATAGGTGTTCATTTTGTTTGGG + Intronic
962583152 3:136816585-136816607 AATAAGTGCTCTGCTTCTTTTGG + Intergenic
962964520 3:140341199-140341221 GAAAGGAGCTCTTTTTATTTTGG + Intronic
963067761 3:141277520-141277542 AAGAGGTGCTCTTTTTCTTTCGG - Intronic
964073315 3:152662747-152662769 AAGATGTGTTCTTTTGTTTTGGG - Intergenic
964278336 3:155032951-155032973 CTGAGGTGGTCTTTTTCTTTTGG + Intronic
964444277 3:156742268-156742290 AAGAGGAGCTGTTTTCCTCTTGG - Intergenic
964876498 3:161373145-161373167 AGCAGGTGCTCTGTTTCTATTGG - Intergenic
967072033 3:185970925-185970947 AAGAGATGGCCTTTTTCTCTGGG - Intergenic
967338269 3:188368625-188368647 AAGAGGTTAACTGTTTCTTTTGG + Intronic
968242146 3:197099825-197099847 AATAGTTTCCCTTTTTCTTTAGG - Intronic
969456006 4:7300001-7300023 CAAAGCTGCTCTTTGTCTTTGGG + Intronic
970843197 4:20501203-20501225 ATGAGGTGCTCTGTGTCTGTAGG - Intronic
971958214 4:33451155-33451177 AAGAGGATTTTTTTTTCTTTGGG + Intergenic
972145189 4:36015422-36015444 AAGAAGTTCTGTTCTTCTTTGGG + Intronic
973554102 4:52064761-52064783 AAGATGGCTTCTTTTTCTTTGGG + Intronic
973926062 4:55738788-55738810 CAGATTTGCTCTTTTTGTTTAGG - Intergenic
974232313 4:59132856-59132878 AAGATTTGGTCTTTTTCTATAGG - Intergenic
974352723 4:60771275-60771297 AAAAGATGCTTTTTGTCTTTTGG + Intergenic
974603285 4:64117396-64117418 AAGAGGTACTCTTTACCTTAAGG - Intergenic
975283448 4:72589965-72589987 AAAAGGTACTTTTTTTCTTTTGG - Intergenic
975591723 4:76007419-76007441 AAGTGGTGTTCTTTTCCTCTTGG - Exonic
975799809 4:78048701-78048723 ACTATGTGCTCTTTTTTTTTTGG - Intergenic
978212557 4:106156210-106156232 AAGAGGCTCTATTTTTTTTTAGG - Intronic
978270939 4:106889921-106889943 AAGATTTGCTCTTTTACTTAAGG - Intergenic
978365983 4:107982157-107982179 AAAAAGTGCTCTATTTATTTGGG + Intergenic
978552964 4:109947901-109947923 AAAAGGTGCTCTATTTCTTCAGG - Intronic
978564655 4:110069211-110069233 ACCAGGTGTTCTGTTTCTTTTGG - Intronic
978834192 4:113128141-113128163 AAAATGTGATCTTTCTCTTTGGG + Intronic
978996184 4:115156460-115156482 AAGAGGTGCTGTTTTTAATAAGG - Intergenic
980124212 4:128758064-128758086 TAGAGGTTGGCTTTTTCTTTTGG - Intergenic
981543905 4:145874601-145874623 AAGATGTTTTCTTTTTCTTTGGG + Intronic
981993338 4:150950962-150950984 AAGAAGGGCTCTTGGTCTTTGGG + Intronic
982834530 4:160108008-160108030 AAGAAGTGCTGTTTTCCATTAGG - Intergenic
982942709 4:161578692-161578714 AAGAGTTTCTCTTTATCATTGGG - Intronic
984106624 4:175555954-175555976 AATATGTGCTATTTGTCTTTTGG + Intergenic
986421176 5:7585132-7585154 AATAGCTGCTTTTTTTCTTTTGG + Intronic
986594381 5:9405587-9405609 ATGAGGTGCTGTTTCTCTGTGGG + Intronic
986777934 5:11036072-11036094 AAAAGAAGCTCTTGTTCTTTGGG - Intronic
986853878 5:11845487-11845509 ATGTGGTGCTCCTTTTCTTAAGG - Intronic
986992197 5:13567549-13567571 AAGAGGTGCTTTTTTTCCCAAGG - Intergenic
987394121 5:17405150-17405172 AAGAGTTGCTCTTTTTTTATTGG - Intergenic
988140473 5:27232689-27232711 AAGAGGTCCCCGTTGTCTTTTGG + Intergenic
988299594 5:29404731-29404753 AAGAGAGGCTCCATTTCTTTAGG + Intergenic
988383805 5:30535609-30535631 AATTGTTGCTCTTGTTCTTTTGG - Intergenic
989427143 5:41309061-41309083 ACAATGTGCCCTTTTTCTTTAGG + Exonic
991698461 5:69295721-69295743 TTGAGGTGATCGTTTTCTTTTGG - Intronic
991901629 5:71466286-71466308 AAGAGGTCCTCTTTCTGTATTGG + Intronic
992752040 5:79870704-79870726 AGGGGGTGCTCTTCTTCTTTTGG + Intergenic
993739425 5:91519364-91519386 AAGAGGTTTTTTTTTTTTTTTGG + Intergenic
995355052 5:111227699-111227721 CAGATGTGCTCACTTTCTTTTGG + Intronic
995957313 5:117793580-117793602 GAGAGGGTCTCTTTTTCTTAAGG + Intergenic
996477314 5:123936544-123936566 AAAAGCGGCTCATTTTCTTTCGG - Intergenic
996669260 5:126098036-126098058 ACGAAGTGCTCATTTTCTATTGG + Intergenic
996800670 5:127399157-127399179 ATGAGTTGCTGTTGTTCTTTGGG + Intronic
997349897 5:133223109-133223131 AAGAGGTGGTGTTTTCCTTAGGG - Intronic
997362364 5:133303244-133303266 AAGAGGTGCTCCTTAGCCTTTGG + Intronic
998426442 5:142033012-142033034 AAGAGGTGCTCTTATTTTTCAGG - Intergenic
998791972 5:145775480-145775502 GGGAGGTGCTTTTTTTCTTATGG - Intronic
1000929633 5:167235709-167235731 AAAAGGTGGTCTTTTTCTGCTGG - Intergenic
1002282845 5:178143093-178143115 CAGAGGTGCTGATTTCCTTTAGG - Intronic
1003544482 6:7047662-7047684 AAAAGAAGCTCTTTTTATTTTGG + Intergenic
1003765388 6:9230519-9230541 AAGATATTCTCTCTTTCTTTTGG - Intergenic
1003829564 6:9993136-9993158 AAAAGGTGGTATCTTTCTTTAGG - Intronic
1004160544 6:13209073-13209095 AAGAGGGCCTCTCTTTCTCTGGG - Intronic
1006219074 6:32472743-32472765 CAGAGATGCTCTTTATCTGTAGG + Intergenic
1006871516 6:37256474-37256496 TAGAGGGGCTTTTTTTCTCTGGG + Intronic
1008687284 6:53939911-53939933 CTGAGTTACTCTTTTTCTTTTGG + Intronic
1009486144 6:64224918-64224940 AAGAGGGGCCATTTTTCCTTGGG - Intronic
1009608001 6:65898535-65898557 AGGAGGAGGTCTTTCTCTTTAGG + Intergenic
1009636289 6:66268935-66268957 AGGATGACCTCTTTTTCTTTGGG + Intergenic
1009745512 6:67808611-67808633 AAGAGGTGCTCAATATTTTTAGG - Intergenic
1009771121 6:68144436-68144458 GAGAGGGGCTCTGTTTGTTTGGG - Intergenic
1010169068 6:72953554-72953576 GAGAGGAGCTCTTATTCTGTGGG - Intronic
1010190599 6:73192137-73192159 AAGCCATGGTCTTTTTCTTTCGG - Intronic
1010879163 6:81146963-81146985 AGGAAGTGCTCTTTCTCCTTGGG + Intergenic
1011476909 6:87757266-87757288 TAGGGGTGATCTTTTCCTTTAGG + Intergenic
1011581262 6:88868147-88868169 AAGAGCTGTTTTTTTTTTTTTGG - Intronic
1011767063 6:90633351-90633373 GGGAGGTGTTCATTTTCTTTAGG + Intergenic
1012652412 6:101772196-101772218 AAGAGGTACTTTCTTTCTTGTGG - Intronic
1013888648 6:115000370-115000392 AAGACGGCCTCTTTTTCATTGGG - Intergenic
1013991662 6:116260925-116260947 AAGATTTGTTCTTTTTGTTTAGG + Intronic
1015370418 6:132444701-132444723 AATATGTGCTGCTTTTCTTTGGG - Intergenic
1015898966 6:138045182-138045204 GAGAGTTGCTATTATTCTTTGGG - Intergenic
1016729024 6:147407631-147407653 AAGAGGCGGTCTTGTTCTTATGG - Intergenic
1017232157 6:152084655-152084677 AAAATGTGTTCTTTTTGTTTTGG - Intronic
1017710996 6:157167888-157167910 AAGTGGTACTCATTGTCTTTAGG - Intronic
1018274793 6:162119139-162119161 AAAAAGTGTGCTTTTTCTTTGGG - Intronic
1018388268 6:163323705-163323727 AAGAGGAGCTCGTGTTCTTAGGG + Intergenic
1019262768 7:91421-91443 GAGCTGTGCTCTTTTCCTTTTGG + Intergenic
1020432857 7:8131104-8131126 AAGAGGGCCTCTCTTTCTTTGGG + Intronic
1020736180 7:11951224-11951246 CACAGGTTCTCTATTTCTTTGGG + Intergenic
1021268084 7:18549737-18549759 AAAAGGTGGTTTTTTTTTTTTGG + Intronic
1021874008 7:25031705-25031727 AACAGGTGCTCTTTGTTTTGTGG - Intergenic
1022325335 7:29325792-29325814 AAGAGCCGCCCATTTTCTTTAGG + Intronic
1022984115 7:35633562-35633584 CAGAGGTGTTTTTTTTCTTTAGG - Exonic
1023087085 7:36581570-36581592 AAGAGGGGTTATTTTTCTTTGGG + Intronic
1024128569 7:46326171-46326193 AACATGTACTCTTTTTTTTTGGG - Intergenic
1024804830 7:53126574-53126596 AAGAGCTTCTCTTGTTCCTTTGG + Intergenic
1026226849 7:68449698-68449720 TAGAGATGCCCTTTTTCTGTTGG - Intergenic
1027751995 7:82161025-82161047 ACAAGGTGCCCTGTTTCTTTGGG - Intronic
1028197604 7:87925399-87925421 AATAGGTTTTTTTTTTCTTTAGG - Intergenic
1028368431 7:90062491-90062513 AAGAGGTATTCTATTACTTTGGG - Intergenic
1028431779 7:90755807-90755829 AAGTACTGCTATTTTTCTTTAGG - Intronic
1028635428 7:92984041-92984063 AAGAGGAGCTCTCTTTCCTCTGG - Intergenic
1029167043 7:98599654-98599676 AGGACATGCTTTTTTTCTTTAGG + Intergenic
1030188487 7:106787687-106787709 CAGAGGTGCTCTTTTGTCTTGGG - Intergenic
1030305011 7:108008888-108008910 AAGAGGTGTTTTTTGTTTTTTGG - Intergenic
1030985167 7:116232955-116232977 AGGATGTGGTCATTTTCTTTAGG + Intronic
1031252229 7:119399897-119399919 GAGAAGTGCATTTTTTCTTTAGG - Intergenic
1031343791 7:120639281-120639303 AGGAGGTCCTCTTTTACTATGGG + Intronic
1033250598 7:139755207-139755229 AAGAGATGCTCTTTTTCCCATGG + Intronic
1033830981 7:145252181-145252203 AAGGCATGCTCTTTCTCTTTTGG - Intergenic
1034204192 7:149301480-149301502 AAGAGGTCCTACTTTCCTTTGGG - Intergenic
1034862519 7:154611426-154611448 AAGAGGTCCACTTTTTGTTGTGG - Intronic
1035173811 7:157036477-157036499 TGGAGGTGCTCTCTTTATTTGGG + Intergenic
1035971173 8:4250878-4250900 AAGAGGTGCTCTTTTCATCAGGG - Intronic
1036165137 8:6425607-6425629 AAGATGTGTTCTGTTCCTTTGGG - Intronic
1036981953 8:13479568-13479590 AAGAGCAGCTTTGTTTCTTTTGG - Intronic
1037265153 8:17050836-17050858 AAGAGTTGCTCTTTTTCAATGGG + Intronic
1037423505 8:18729064-18729086 TACAGCTGTTCTTTTTCTTTGGG - Intronic
1037642395 8:20758343-20758365 AATATGTGCTCTTTTTTTTCTGG + Intergenic
1037989490 8:23310333-23310355 TAGAGGTGTTCTTTCTCTCTGGG - Intronic
1038087291 8:24212987-24213009 TAAAGGATCTCTTTTTCTTTTGG - Intergenic
1038578946 8:28730301-28730323 ATGAGATGCTCTTTGTTTTTGGG + Intronic
1039323781 8:36463021-36463043 AAGATTTTCTCTTTATCTTTTGG - Intergenic
1039354358 8:36798975-36798997 AAGAGGTGCTCTTTGGAGTTGGG - Intronic
1039708345 8:40030639-40030661 AAGGAGGACTCTTTTTCTTTGGG - Intergenic
1041127620 8:54660607-54660629 ATGAGGTTCTTTTTGTCTTTGGG + Intergenic
1043265574 8:78264214-78264236 AGGACCTGCTCCTTTTCTTTAGG - Intergenic
1044925933 8:97208825-97208847 GAGAGGTGCTCTGTTAATTTTGG - Intergenic
1045257435 8:100539340-100539362 AAGAGTTGCTCTCTTTCTGTGGG + Intronic
1046183149 8:110678881-110678903 AATAGGATCTCTTTTCCTTTGGG + Intergenic
1046538337 8:115546033-115546055 AAAAGATATTCTTTTTCTTTAGG - Intronic
1046750464 8:117921254-117921276 AACAGGTGCTCCTTTTATCTGGG + Intronic
1047324152 8:123820254-123820276 AAAAAGTGGCCTTTTTCTTTTGG - Intergenic
1047345637 8:124025617-124025639 TAGATTTGTTCTTTTTCTTTAGG + Intronic
1048287967 8:133157043-133157065 AAGACTTGGGCTTTTTCTTTAGG + Intergenic
1049549416 8:143250003-143250025 AAGACGTGCTCTTCGTCTTCAGG - Exonic
1051036858 9:12757505-12757527 AAGAGATGCTTTTTTATTTTAGG - Intergenic
1052729668 9:32270591-32270613 AAGAGGTGCTGCTGTGCTTTAGG + Intergenic
1054813293 9:69451695-69451717 AAGAGGTGCTGTGCTTCTCTGGG - Intronic
1055492829 9:76823917-76823939 AAGAGGTGCATTTTTCCTATTGG - Intronic
1055586863 9:77763890-77763912 AAGAGCTTTTCTTGTTCTTTCGG + Intronic
1056346221 9:85698081-85698103 AAAAGGTCATCTTTTTTTTTTGG + Intronic
1056608024 9:88103409-88103431 CAGAGGTTCTTTTTTTTTTTTGG + Intergenic
1057112346 9:92485177-92485199 AAGAGGTACACTGTTTCATTTGG - Intronic
1057303335 9:93898947-93898969 CAGAGGTGCTCTCTTGCTTGGGG + Intergenic
1058430007 9:104909872-104909894 AGGAGTTCCTGTTTTTCTTTTGG - Intronic
1058506504 9:105671624-105671646 AACAGGAGCATTTTTTCTTTTGG + Intergenic
1060455324 9:123787770-123787792 AAAAGGTGCCCTTTCTCTTAAGG - Intronic
1062466541 9:136684083-136684105 AAGGGGTGCTCTTCCTCTTAAGG - Intronic
1062584541 9:137243217-137243239 AATAGCTGCTGTTTTTGTTTTGG - Exonic
1185942108 X:4333372-4333394 AACATGTGCTCTTTCCCTTTTGG - Intergenic
1186246818 X:7623604-7623626 AATAGGTGCTCTTTATTTCTAGG - Intergenic
1186431676 X:9510392-9510414 AGGAGGGGGGCTTTTTCTTTAGG + Intronic
1188835127 X:34945904-34945926 CTGAAGTGCACTTTTTCTTTCGG + Intergenic
1188910173 X:35837686-35837708 AATAGTTCCTATTTTTCTTTAGG + Intergenic
1189691423 X:43620981-43621003 AAGAGGTTTTTTTTTTCCTTTGG - Intergenic
1191759986 X:64636243-64636265 AAGAGAGGCTCTGTTTCTTTGGG - Intergenic
1192368909 X:70497557-70497579 TAGAGGAGCCATTTTTCTTTTGG - Intronic
1192569377 X:72190200-72190222 AGGAGGTCCAGTTTTTCTTTTGG + Intronic
1194633574 X:96316499-96316521 AAGATTTTCTCTTTTTCTGTGGG + Intergenic
1195693878 X:107652292-107652314 TAAGGGTGCTCTTTTACTTTGGG + Intergenic
1196276529 X:113772592-113772614 AAGACTGGCTCTTTTTCTCTAGG - Intergenic
1197549855 X:127877462-127877484 AACAGCTGCTCTATTTGTTTAGG - Intergenic
1197634088 X:128894917-128894939 AATAGCTGCTTTTTTTCTTTTGG + Intergenic
1198059176 X:133026793-133026815 AGGATGTGCTTTTATTCTTTGGG + Exonic
1198585917 X:138122123-138122145 AAGATGTGATGTTTGTCTTTCGG + Intergenic
1198767418 X:140093302-140093324 CAGTGGTGCTCTTTTTTTTTAGG + Intergenic
1200697772 Y:6376185-6376207 AAGAGTGGCTTTTTTTTTTTTGG + Intergenic
1201036340 Y:9788514-9788536 AAGAGTGGCTTTTTTTTTTTTGG - Intergenic