ID: 963068679

View in Genome Browser
Species Human (GRCh38)
Location 3:141284213-141284235
Sequence ACCTGGGGCCCTGAATGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963068679_963068688 16 Left 963068679 3:141284213-141284235 CCTGGTCATTCAGGGCCCCAGGT 0: 1
1: 0
2: 4
3: 32
4: 221
Right 963068688 3:141284252-141284274 TTTCTACCATCCCCTGGGGATGG 0: 1
1: 0
2: 1
3: 13
4: 201
963068679_963068685 10 Left 963068679 3:141284213-141284235 CCTGGTCATTCAGGGCCCCAGGT 0: 1
1: 0
2: 4
3: 32
4: 221
Right 963068685 3:141284246-141284268 TTGTTGTTTCTACCATCCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 174
963068679_963068687 12 Left 963068679 3:141284213-141284235 CCTGGTCATTCAGGGCCCCAGGT 0: 1
1: 0
2: 4
3: 32
4: 221
Right 963068687 3:141284248-141284270 GTTGTTTCTACCATCCCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 161
963068679_963068686 11 Left 963068679 3:141284213-141284235 CCTGGTCATTCAGGGCCCCAGGT 0: 1
1: 0
2: 4
3: 32
4: 221
Right 963068686 3:141284247-141284269 TGTTGTTTCTACCATCCCCTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
963068679_963068690 24 Left 963068679 3:141284213-141284235 CCTGGTCATTCAGGGCCCCAGGT 0: 1
1: 0
2: 4
3: 32
4: 221
Right 963068690 3:141284260-141284282 ATCCCCTGGGGATGGCTACATGG 0: 1
1: 0
2: 0
3: 18
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963068679 Original CRISPR ACCTGGGGCCCTGAATGACC AGG (reversed) Intronic
900270015 1:1782253-1782275 ACCTGGGAGCCTGAGTGACTGGG - Intergenic
900418321 1:2545121-2545143 GCCTGAGGCCATGAATGGCCGGG - Intergenic
901591265 1:10345363-10345385 ACCTGGGGACCTTAAAGTCCAGG - Intronic
901786771 1:11629952-11629974 ACCACGGGCCCTGAATAATCAGG - Intergenic
901857397 1:12053111-12053133 ACCTGGTGCCCAGCAAGACCTGG - Intergenic
902512676 1:16974853-16974875 CCCTCGGGCCCTGCCTGACCTGG - Exonic
904830733 1:33305044-33305066 AACTGGGGCCCTGAGAGACTGGG - Intergenic
905314968 1:37076570-37076592 GCCTGGGGCCCAAAATGATCAGG + Intergenic
905789048 1:40780706-40780728 ACCTGAGCCCTTGATTGACCTGG + Intergenic
905862345 1:41360042-41360064 AACTGAGGCCCAGAATGAGCAGG - Intergenic
906303136 1:44698259-44698281 CCCTAGGGGCCTGAATGACATGG + Intronic
907475146 1:54700431-54700453 ACCTGCGGGCCAGGATGACCAGG - Exonic
907606678 1:55825197-55825219 AACTGAGGCACTGCATGACCAGG - Intergenic
908171269 1:61507198-61507220 GCCTGTGGCCCAGAATGAGCTGG - Intergenic
913122495 1:115754690-115754712 ACCTGGGCCTCTGAGGGACCTGG + Intronic
915471731 1:156129837-156129859 AGCTGGGGCCCAGATGGACCTGG + Intronic
918159979 1:181889400-181889422 ACCTGGGGCCCTGATTGTGTAGG - Intergenic
919654370 1:200182994-200183016 CCTTGGGTCCCTGAATGGCCTGG + Intergenic
920259925 1:204682272-204682294 AACTGGGACCCTGAATGAGGAGG - Intronic
921808889 1:219489111-219489133 ACCTGGGCCCCTGAAAGTACTGG - Intergenic
922568638 1:226618643-226618665 ACCTGGAGACCTGAGTGGCCAGG + Intergenic
922717569 1:227885274-227885296 ACCTGGGCCCCTGAACTTCCAGG - Intergenic
924202020 1:241670435-241670457 AGCTGGGGCCCTGCATGATGAGG + Intronic
924744304 1:246818225-246818247 CCCTCGGGCCCTGCCTGACCTGG + Intergenic
1064295536 10:14076066-14076088 ACCTGGGCCTCTGAATAACCGGG + Intronic
1067052226 10:43028323-43028345 ACCTGGGGCCATGGAAGGCCAGG + Intergenic
1068512927 10:57989198-57989220 ACCCGAGTCCCTGAATGACTGGG + Intergenic
1069544006 10:69316352-69316374 ACCTGGTGCTCAGAATGACTTGG + Intronic
1069728271 10:70595091-70595113 TACTGGGGCCCTGGATGACAGGG - Intergenic
1069838384 10:71323923-71323945 GCCTGGGGCCTTGAATGTCCAGG + Intronic
1070935178 10:80288457-80288479 ACTTGAGGCTCTGAATGTCCTGG + Intronic
1072190424 10:93073164-93073186 ACCTGGGGACCTGAGGGACCTGG + Intergenic
1072426638 10:95335955-95335977 TCCTGGGGCCCTGACTGACATGG - Intronic
1073266403 10:102230768-102230790 GCCTGGGGCCCTGCAGGGCCTGG - Exonic
1075213585 10:120512378-120512400 AGCTGTGGCCCTGAATGACTTGG - Intronic
1076595487 10:131622518-131622540 ACCTGGGGCCCTGGGTTCCCGGG - Intergenic
1076687309 10:132203969-132203991 ACCTGAGGCCCTGGATGCTCCGG - Intronic
1077089880 11:773573-773595 TCCTGGGGCCCTGACCGACCTGG - Exonic
1077296812 11:1830234-1830256 AGCTGGGGCCCGGGATGGCCGGG - Intronic
1077489151 11:2852568-2852590 GCCTGGGACCCTGGCTGACCTGG - Intergenic
1077498828 11:2899772-2899794 ACCTGAGGCCCTGCTTCACCTGG + Exonic
1079280518 11:19083106-19083128 ACCTGGGGCCCTCAGTCACTGGG - Intergenic
1084437935 11:69155051-69155073 TCCTGTGGCCCAGAATGCCCTGG + Intergenic
1085372311 11:76020407-76020429 CCCTTGGGCCCTGAAGAACCAGG - Intronic
1088598844 11:111458265-111458287 ATCTCGGGCCCAGAATGACCTGG + Intergenic
1088692501 11:112339648-112339670 CCCTTGGGCTCTGTATGACCAGG + Intergenic
1091271632 11:134316995-134317017 ACCTGAGGCACTGGATGTCCTGG + Intronic
1092505564 12:9095640-9095662 CCCTGGGCCTTTGAATGACCAGG - Exonic
1092898952 12:13040580-13040602 GCCTGGGTCCCTGAATGGCTGGG + Intergenic
1094817568 12:34203210-34203232 CCTTTGGGCCCTGAATAACCAGG + Intergenic
1096502472 12:52073157-52073179 TCCTGGGACCTTGAATGAACAGG - Intronic
1099601301 12:84741745-84741767 GCCTGGGGCCCTGTATGGCAAGG - Intergenic
1100890456 12:99120054-99120076 ACCTGGTGCCCTGAGTTGCCGGG - Intronic
1101115725 12:101529583-101529605 CCATGGGGCCTTGCATGACCTGG + Intergenic
1101328813 12:103740701-103740723 ACCTGGGGATCTGTATCACCAGG - Exonic
1101402649 12:104401794-104401816 ACCTGAGTCCCTGAGTGACTTGG + Intergenic
1102220006 12:111187880-111187902 ACCTGGGGCTCTGTTGGACCTGG - Intronic
1107083975 13:36405687-36405709 TCCTTGGTCCCTGAATAACCAGG - Intergenic
1110166835 13:72452466-72452488 ACCTGGAGCCCTCAAAGACATGG - Intergenic
1111482569 13:88850610-88850632 ACCTGGGGTGCTGACAGACCTGG + Intergenic
1112491344 13:99867023-99867045 TCATGGGGACCTGAGTGACCAGG - Intronic
1112507501 13:99983779-99983801 ACCTGGGGCTCTAGCTGACCTGG - Intronic
1116983551 14:51195897-51195919 ACATGGAGCCTTGAATGACCAGG - Intergenic
1117893251 14:60449999-60450021 CCCTTGGGCCCTGAATAACCAGG + Intronic
1118380510 14:65214081-65214103 TCCATGGCCCCTGAATGACCAGG - Intergenic
1119583395 14:75808709-75808731 CCATGGGGCTCTGAATGATCTGG - Intronic
1119837186 14:77761000-77761022 ACCCGGGGCACAGAATGACGTGG - Exonic
1121662472 14:95645810-95645832 ACCTGAGGCTCTGATTGGCCAGG - Intergenic
1122004227 14:98688740-98688762 GGCTGGGGCCTTGAATGAACAGG + Intergenic
1122078123 14:99248450-99248472 ACCTCGGGCCCTGCAAGATCTGG - Intronic
1122112860 14:99514138-99514160 CCCTGTGGCGCTGGATGACCTGG + Exonic
1122851807 14:104537482-104537504 GCCTGGGGCCCTGCATGAGAAGG + Intronic
1123143496 14:106105907-106105929 ACCTGGGATCCTGAAAGTCCAGG - Intergenic
1124372498 15:29111595-29111617 ACCTGGGGGCCTGAAGGGCCCGG - Intronic
1124542793 15:30603337-30603359 ACCTGGGGCTCTCAAAGTCCTGG + Intergenic
1126709466 15:51441297-51441319 CCCTTGGGCCCTGAATTACTAGG - Intergenic
1127161485 15:56191724-56191746 ATCTGTGGAACTGAATGACCAGG + Intronic
1127995211 15:64149972-64149994 AGCTGGGTCCCTGAATGATGGGG + Intergenic
1129125343 15:73435653-73435675 ACCTGGAGCCCAGCATGCCCTGG + Intergenic
1129184773 15:73899398-73899420 GCCTGGGGCCTTGAATGACCCGG - Intergenic
1129671335 15:77609483-77609505 CCCTGGGGCCCTGGAGGACAAGG - Intergenic
1129868307 15:78925315-78925337 TCCTGGGACCCTGACTCACCTGG + Exonic
1132279759 15:100602680-100602702 ACTTCGGGCCCCGTATGACCTGG + Exonic
1132550283 16:551221-551243 ACCGGGGACCCTCACTGACCGGG - Intronic
1132650311 16:1018549-1018571 ACCTGGAGCCCTGACTACCCAGG - Intergenic
1133056067 16:3145995-3146017 GCCTGGGGCCCAGCATGACGTGG + Exonic
1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG + Intergenic
1135503183 16:23014674-23014696 ACCTGGGACCCTGAGTGACACGG - Intergenic
1137896674 16:52220073-52220095 ACCCTGGGCCTTGAGTGACCTGG + Intergenic
1138206652 16:55130489-55130511 ACCGGGGGCCCAGTCTGACCTGG - Intergenic
1138955297 16:61964309-61964331 ACCTGGTGCCCTGAACTGCCAGG - Intronic
1140056491 16:71530360-71530382 ACCTGGGGTCCTTCATGGCCTGG - Intronic
1140473957 16:75229372-75229394 TCCTGGTGCCCTGGATGCCCAGG - Exonic
1141636927 16:85318900-85318922 ACCTGGGTCCCTTAATAACATGG + Intergenic
1144345940 17:14349748-14349770 ACCTGTGGCACTGAAAGACCGGG - Intergenic
1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG + Intronic
1145883759 17:28369178-28369200 ACCCAGGGCCCTGCAGGACCTGG - Intronic
1147860607 17:43520219-43520241 ACTGGGGGCCCTGGATGACGAGG + Exonic
1148770492 17:50063369-50063391 ACCTGGGCCCCTAAGCGACCTGG - Intronic
1148859384 17:50596203-50596225 ACCTGGGGACCTGAGTGAAGTGG - Intronic
1149542275 17:57476614-57476636 ACCTGGATCCCTGAATCAACCGG - Intronic
1149655765 17:58308894-58308916 TCCTGGGGCCCTCAATTACGGGG + Exonic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151163319 17:72184008-72184030 ACCTGGTGCCCTAAATGTCCTGG + Intergenic
1152322881 17:79618103-79618125 ACGTGGGACCCTGAACTACCTGG - Intergenic
1152576568 17:81143797-81143819 ACCTTGGGCCCTGCCTGCCCGGG + Intronic
1158570273 18:58592122-58592144 ACCTGTGGCCCCCAATGAGCAGG + Intronic
1158632966 18:59132160-59132182 CCCTGGGGCCATGAATGGCAGGG + Intergenic
1160018867 18:75165124-75165146 ACCTGGTACCCTGTATGAGCTGG + Intergenic
1160299397 18:77666613-77666635 GCCTGGGGCCCTGAATGACTGGG + Intergenic
1160983192 19:1826161-1826183 AGCTGGGGCCCTGGGTGCCCAGG - Intronic
1163321594 19:16577876-16577898 ACCTGGGACCCTGAAGGTCTGGG - Intronic
1163427335 19:17246551-17246573 ACCTGGTGCCCGGAATCTCCAGG + Intronic
1167094513 19:47367174-47367196 TCCTGGGGCCCTGAGTGATCAGG - Intronic
1167605619 19:50480158-50480180 ACCCGGGGCCCTGGATGGCCTGG + Exonic
1167645053 19:50701122-50701144 ACCTGGGCCCCTGAATAAGCAGG - Intronic
1168413624 19:56155466-56155488 ACCTGGGGCCCTGGGCCACCCGG - Intronic
925673903 2:6339926-6339948 ACCTGTAGCCCAGAATGACTTGG + Intergenic
926048680 2:9729172-9729194 GCCTGGGGCACAGCATGACCAGG - Intergenic
926192376 2:10738522-10738544 CCGTGGGTCCCTGAAGGACCGGG - Intronic
928206421 2:29287827-29287849 GCCTGGATCCCTGAATGATCAGG + Intronic
929032397 2:37661488-37661510 AACTGGGGTCCAGAATTACCTGG + Intronic
929484657 2:42342779-42342801 ACGGGGGGCGCTGAATGGCCAGG - Intronic
929543678 2:42841724-42841746 ACCTGGGGCCATGATATACCTGG + Intergenic
930972100 2:57408472-57408494 CCCTTGGGCCCTGAATAACCAGG + Intergenic
932274415 2:70441393-70441415 ACCTGGGGTACAGAATGGCCAGG + Intergenic
932421741 2:71605436-71605458 TCGTGGGTCCCTGAATGCCCAGG + Intronic
933691536 2:85182767-85182789 ATCTGGGTTCCTGAATGAACAGG - Intronic
934660252 2:96139329-96139351 AGGTGGGGCCCTGAGTGACCTGG - Intergenic
935720035 2:105971836-105971858 AGCTGGGGACTTGAATGAGCTGG + Intergenic
938163591 2:129007901-129007923 ACCTGCAGCCCTCAATGCCCTGG - Intergenic
939851108 2:147306052-147306074 ATTTGGGGCCCTGAATTACCAGG - Intergenic
940299696 2:152164119-152164141 ACCTACGGCCCGTAATGACCTGG + Intronic
940365657 2:152845985-152846007 GCCTCGGGCCCTGAATGGGCTGG - Intergenic
940366367 2:152852642-152852664 ACCAGGGACCCTGAAAGTCCAGG - Intergenic
943685564 2:190814110-190814132 CCCTGGTGTCTTGAATGACCTGG + Intergenic
944338658 2:198568436-198568458 ACCTGGGGCTCTGAAAGTACTGG + Intronic
944601649 2:201309395-201309417 ACCTGGGGCCCTCACTGAGTGGG + Intronic
946291736 2:218750560-218750582 AGCTGGGACCCTGACTGCCCAGG - Intronic
947733732 2:232444442-232444464 GCCTGTGGCCATGTATGACCGGG - Intergenic
948674020 2:239586717-239586739 ACCTGGTGCCTTGAAAGTCCAGG + Intergenic
948752021 2:240138429-240138451 ACCTGGGGCACTGGAAGACTGGG - Intergenic
1168940998 20:1711531-1711553 ACCAGGGACCCTGAAAGTCCAGG + Intergenic
1171179798 20:23084234-23084256 AAAGGGGGCCCTGAGTGACCGGG - Intronic
1171395284 20:24829184-24829206 CTCTGGGGCCCTGCATCACCTGG - Intergenic
1172669923 20:36627843-36627865 GCCTGGGGCCCTGAGCTACCAGG - Intronic
1173898441 20:46568813-46568835 AGCTGGGCCTCTGAGTGACCGGG + Intronic
1174194480 20:48763400-48763422 TCCTGGGGCCCCGAGTGACTTGG - Intronic
1180916533 22:19492826-19492848 ACCTGGGGCAGTGAAGGTCCAGG + Intronic
1181368351 22:22397298-22397320 ACCTGGTGCCAACAATGACCAGG + Intergenic
1181613619 22:24036579-24036601 ACCTGGCTCCCTCACTGACCTGG - Intronic
1183096740 22:35556629-35556651 ACCTGGGTGCCTGAGTGACCAGG - Intergenic
1184161728 22:42701094-42701116 ACCTTGGTCCCTGTCTGACCAGG - Intronic
1184424294 22:44400176-44400198 AACTGAGGCCCGGAATGCCCAGG - Intergenic
1184591042 22:45483471-45483493 ACCTGGAGCCCTCCCTGACCTGG - Intergenic
950763955 3:15259473-15259495 ACCTGGAGACCTGATAGACCAGG - Intronic
953187668 3:40653578-40653600 ACATGGGGACCTGGATGAGCCGG - Intergenic
954138199 3:48591967-48591989 ATGTGGGGCCCAGGATGACCGGG + Exonic
954488064 3:50873210-50873232 CCCTGGGGCCCTGAATAACCAGG - Intronic
954510954 3:51124475-51124497 ACCTGGTGGGCTGAATGATCTGG + Intronic
957072712 3:75579298-75579320 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
959751903 3:109847585-109847607 ACCTGTGTCCCTGAGTGACTAGG - Intergenic
961873007 3:130002126-130002148 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
962543223 3:136404457-136404479 ACTTCGGTCCCTGAATGACTGGG + Intronic
962751037 3:138434959-138434981 ACCTGGGGCTCAGCATAACCTGG + Exonic
963068679 3:141284213-141284235 ACCTGGGGCCCTGAATGACCAGG - Intronic
964758547 3:160111247-160111269 AACTGAGGCCCTGAATGAATGGG - Intergenic
965705639 3:171504638-171504660 GCCTGGGGCCCTAAGAGACCTGG - Intergenic
965873375 3:173286928-173286950 ACCTGGGTCCCTGGATGACATGG - Intergenic
966860306 3:184228062-184228084 ACCTGAGGCCCTGGATCACCTGG + Intronic
969016318 4:4106608-4106630 ACCTGGGCCCCTGAGCCACCGGG - Intergenic
969055688 4:4401314-4401336 TCCTGGGGTCCTGAAACACCCGG + Intronic
969255648 4:5999994-6000016 ACCGGGGGCCTTGAATGCCGTGG + Intergenic
969684615 4:8664160-8664182 TCCTGGGGCCGTGACTCACCAGG + Intergenic
969796835 4:9533277-9533299 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
969929234 4:10613964-10613986 ACCAAGGACCCTGAATGCCCAGG + Intronic
973642044 4:52913160-52913182 ACCTGGGTCCCTGAATGATTGGG - Intronic
978676712 4:111327169-111327191 CCCTTGGGCCCTTAATGACCAGG - Intergenic
979551810 4:121999469-121999491 GCCTAGGGCCCTGAATAACTGGG + Intergenic
980095076 4:128481386-128481408 ACCTGGATCCTTGAATGACCTGG + Intergenic
982845607 4:160247753-160247775 ACTGGGGACCCTGAAAGACCAGG - Intergenic
985393268 4:189514329-189514351 GCCTGGGGCTCTGAAGAACCTGG - Intergenic
985422601 4:189799676-189799698 ACTTGGGATCCTGAATAACCAGG - Intergenic
988727940 5:33942403-33942425 ACCAGGGGCCCTGGCTGCCCAGG - Intergenic
989215350 5:38899581-38899603 TACTTGGGCCCTGAATAACCAGG - Intronic
990487055 5:56269595-56269617 ACCTGTGGTCCTGAGAGACCTGG + Intergenic
991247463 5:64523173-64523195 ACCTGGGGCCCTGCTGGACCTGG - Intronic
992496749 5:77301159-77301181 ACCTGTGACCCTGAAGCACCTGG - Intronic
992662166 5:78972432-78972454 AGCTGGGACCCTGAATGATAAGG + Intronic
995803243 5:116022835-116022857 ACATGAGGCCCTTAATGATCTGG + Intronic
996543635 5:124654841-124654863 ATCTGGGACCCTGAATGACAAGG + Intronic
997077013 5:130690840-130690862 ACTTGGGTCCCTCAATGATCAGG - Intergenic
998138803 5:139688540-139688562 GCCTGGAGCCCTGGAGGACCCGG - Intergenic
1002427444 5:179184693-179184715 CCCTGGGACCCAGAATGGCCTGG + Intronic
1002620265 5:180483188-180483210 ACCTGGGTCCCTGAATCACACGG + Intergenic
1006106786 6:31721599-31721621 ACCTGGGGGCCCCAAAGACCTGG - Intronic
1007365519 6:41389194-41389216 TCCTGGGCCCCTGAAAGACTGGG - Intergenic
1007841493 6:44719830-44719852 AACTGGATCCCTGAATGACATGG + Intergenic
1009782912 6:68293278-68293300 CCCTTGGGCCCTGAATGAATAGG + Intergenic
1014787024 6:125630950-125630972 AGCTGGGGCCTGGAGTGACCTGG + Intergenic
1018628668 6:165804616-165804638 ACCTGGGGCCCTGGAAACCCGGG + Intronic
1019172097 6:170138349-170138371 TCCTGGGGCCCTGGAGCACCTGG - Intergenic
1019642660 7:2112694-2112716 CCCTGGGGCCCTGACACACCCGG + Intronic
1021434386 7:20597828-20597850 ACCTGTGGCCCTAGATGACCTGG + Intergenic
1021548347 7:21841663-21841685 ACCTGGTGCCCTGAGTTTCCAGG + Intronic
1021891292 7:25188465-25188487 ACCTGGGTCCCAGAGTCACCTGG - Intergenic
1022141804 7:27499460-27499482 ACCTGAGGCCTTGAAGGAGCAGG - Intergenic
1023315612 7:38932975-38932997 ACTTGGGTCCCTGAATGATTTGG + Intergenic
1025937705 7:66050500-66050522 ACCTTGGACCCTGAGTGAGCAGG - Intergenic
1026472144 7:70702786-70702808 ACCTGGAGCCCTCTCTGACCAGG + Intronic
1027595991 7:80174824-80174846 ACTTGGATCCCTGAATGACATGG - Intronic
1029144292 7:98434739-98434761 ACCTGGGACCCTTCATCACCCGG + Intergenic
1030106263 7:105989888-105989910 ACCAGGGGAGCTGAATGACTGGG - Intronic
1033269644 7:139919187-139919209 ACCTGGAGACGTGAAAGACCTGG - Intronic
1033509987 7:142050939-142050961 GCATGGGTCCCTGAAGGACCAGG + Intronic
1033660169 7:143397379-143397401 TCCTGGGGCCCTGAAGGAGCTGG - Intronic
1034428223 7:151026075-151026097 TCTTGAGGCCCTGAATCACCAGG + Intergenic
1034560798 7:151877974-151877996 ACCCGGGGCTCTAAAGGACCTGG - Intergenic
1035873127 8:3157218-3157240 AGCTGGGGGCCTGAATGATGGGG + Intronic
1036242731 8:7092976-7092998 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
1036258074 8:7221052-7221074 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036310124 8:7679648-7679670 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG + Intergenic
1036829998 8:12014168-12014190 ACGTGGGCCCCTGAGTCACCGGG - Intronic
1036850245 8:12195337-12195359 ACCTGAGCCCCTGAAGGGCCTGG - Intergenic
1036871607 8:12437610-12437632 ACCTGAGCCCCTGAAGGGCCTGG - Intergenic
1036891544 8:12600498-12600520 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036899086 8:12658462-12658484 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
1037144270 8:15554432-15554454 GCCAGGGTCTCTGAATGACCAGG + Intronic
1039811773 8:41055310-41055332 CACTGGGGCCCTGAAAGAGCAGG + Intergenic
1039893976 8:41703247-41703269 ACCTTGAGCCCTGAAAGATCAGG + Intronic
1041107139 8:54454539-54454561 CCGTGGGCCCCTGAGTGACCAGG - Intergenic
1041138652 8:54789525-54789547 ACCTGTGTCCCTGCCTGACCAGG + Intergenic
1041784934 8:61621138-61621160 GCCTGGGGCCTGGAATGATCTGG - Intronic
1042876371 8:73443980-73444002 GTCTGGGTCCCTGACTGACCAGG - Intronic
1043443882 8:80300581-80300603 CCCAGGGGCCATGAATGAACTGG + Intergenic
1044281762 8:90364789-90364811 GCCTGGGTTCCTGAATGACTGGG - Intergenic
1048543205 8:135361853-135361875 ACCTGGGTGCCTGAATGACCTGG + Intergenic
1048963385 8:139597936-139597958 CCCTGGGGCCCTGAAAAAGCGGG + Intergenic
1049298048 8:141854267-141854289 ACCTGGGAGCCTGAGTGATCAGG - Intergenic
1049790825 8:144472080-144472102 CCCAGGGGCCCTGCATGACTTGG + Intronic
1050122001 9:2317315-2317337 CCCTTGGGCCCTGAATAACCAGG - Intergenic
1053875529 9:42541036-42541058 CCCTGGGGCCTTGAATGGCAGGG + Intergenic
1053897116 9:42753597-42753619 CCCTGGGGCCTTGAATGGCAGGG - Intergenic
1054236170 9:62560688-62560710 CCCTGGGGCCTTGAATGGCAGGG - Intergenic
1055605551 9:77966936-77966958 ACCTAGGGCAATGAAAGACCTGG - Intronic
1056950753 9:91039218-91039240 AGCTGGGGCCCCCACTGACCAGG - Intergenic
1057195617 9:93114479-93114501 ACCTGAGGCCCTGACTCCCCAGG + Intergenic
1057242336 9:93422575-93422597 ACCTGGGTCCCTGAAAGTGCTGG - Intergenic
1060358305 9:122931354-122931376 CCCTGGGGCCCTGGATCAACCGG - Intronic
1060972952 9:127749192-127749214 AAATGGGGCCCTGGCTGACCTGG + Exonic
1062309546 9:135928646-135928668 TCCTGGGCTCCTGAATGACAAGG - Intergenic
1188009370 X:25040505-25040527 AGCTGGGGGCCAAAATGACCAGG + Intergenic
1188032058 X:25275172-25275194 GCCTGGGTCACTGAATGGCCTGG - Intergenic
1189870008 X:45371537-45371559 CCCTTGGGCCCTGAATAACAAGG + Intergenic
1197987179 X:132278812-132278834 CCCTTGGGCCCTGAACAACCAGG - Intergenic
1200258866 X:154601022-154601044 ACCTGAGGAACTGAGTGACCTGG + Intergenic
1200906285 Y:8485953-8485975 AACTGGGGCCCAGAATGTCATGG + Intergenic