ID: 963068907

View in Genome Browser
Species Human (GRCh38)
Location 3:141286494-141286516
Sequence GGGTAGATTTTCTAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963068904_963068907 -8 Left 963068904 3:141286479-141286501 CCTTGATAAAGGATAGGGTAGAT 0: 1
1: 0
2: 0
3: 6
4: 118
Right 963068907 3:141286494-141286516 GGGTAGATTTTCTAGGAGGAAGG 0: 1
1: 0
2: 3
3: 22
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963068907 Original CRISPR GGGTAGATTTTCTAGGAGGA AGG Intronic
901525524 1:9820174-9820196 GGGTAAATTTTCAAGGATCATGG - Intronic
901636784 1:10674243-10674265 GGGAAGACCTTCTAAGAGGAGGG + Intronic
903229107 1:21911253-21911275 GGGAAGATGTACTGGGAGGAGGG + Intronic
905178014 1:36150095-36150117 GTGTAGCTGTTCTAGGGGGAGGG - Intronic
906319920 1:44809422-44809444 GGGTAGAGTTTACAGGAGGCCGG + Intronic
908817931 1:68052604-68052626 CGGTACATTTTGGAGGAGGAGGG - Intergenic
910131456 1:83912177-83912199 GGGTAAATTTTCATGGAGGAAGG + Intronic
910199057 1:84679330-84679352 GAGTAGATTTTCTAAGAGGTTGG - Intronic
910814626 1:91278431-91278453 GGGAAGATATTCCAGGTGGAGGG + Intronic
912268358 1:108183183-108183205 GGATAGACTTTCTTGGAGAAAGG + Intronic
914289427 1:146259301-146259323 GGATTGTTTTTCTAAGAGGAGGG - Intergenic
914550463 1:148710054-148710076 GGATTGTTTTTCTAAGAGGAGGG - Intergenic
916062994 1:161114464-161114486 TGGAAGATTTTCTAGGTAGAGGG - Intronic
916261263 1:162844650-162844672 GAGTAGATGCTCCAGGAGGAGGG + Intronic
917882542 1:179352227-179352249 GGGTACAGATTTTAGGAGGATGG + Intronic
919085991 1:192920390-192920412 GCCTAGATTTTTGAGGAGGAGGG - Intergenic
922135384 1:222820147-222820169 GGGCAGATTTTCTGTAAGGAGGG + Intergenic
923235495 1:232029207-232029229 GTGTAGATTTTATTGGAGGGAGG - Intronic
1064303117 10:14140566-14140588 GGGAAGAGTTTCAAGGAGAAGGG - Intronic
1065118228 10:22502770-22502792 GGGTACATTTTTTAGGAGTCTGG + Intergenic
1065392030 10:25192446-25192468 GGGAATAGTGTCTAGGAGGAGGG + Intronic
1066978975 10:42393566-42393588 TGGTAGATTTTTTAGGAGAGCGG - Intergenic
1068488323 10:57688420-57688442 GGGCAGATTTTATGGCAGGACGG + Intergenic
1068569164 10:58609268-58609290 GGGAACATTTTGCAGGAGGAAGG - Intronic
1069375284 10:67787050-67787072 GGGCAGATTTTATAGGCAGAGGG - Intergenic
1071930672 10:90466179-90466201 GGGAAGAATTCCCAGGAGGAAGG - Intergenic
1072176869 10:92933834-92933856 GGGGAGACTATGTAGGAGGATGG + Intronic
1072613023 10:97031566-97031588 GGGTGGATTTTCTGGCAGGATGG + Intronic
1076460569 10:130642319-130642341 GGGCAGGTTTTTTGGGAGGAGGG - Intergenic
1076578438 10:131489710-131489732 GGGCAAATTTTTTGGGAGGAGGG - Intergenic
1077702612 11:4455870-4455892 GGGAAGTTCCTCTAGGAGGAGGG + Intergenic
1079224825 11:18596052-18596074 GGGAAGATTTTCAAAGAGAAAGG - Intergenic
1079497652 11:21063967-21063989 GTGTAGATCTTCTAGGAGAGTGG + Intronic
1080428600 11:32178418-32178440 GGGAAAATTTTGGAGGAGGAAGG - Intergenic
1083129681 11:60613440-60613462 GGGTTGATTAGCTAGGAGGAAGG - Intergenic
1083160198 11:60849838-60849860 GGGCAGAATTCCCAGGAGGAAGG - Intronic
1085224362 11:74906205-74906227 GGGTAGAATTTCTGGGACAAGGG + Intronic
1085969668 11:81572412-81572434 GAGTAGTTTTTCTAGAAGTATGG - Intergenic
1087071163 11:94082187-94082209 GGGCTGATTTCCTTGGAGGACGG + Intronic
1088378096 11:109163487-109163509 GGGAAGATATTCTAGGAAGCTGG + Intergenic
1089196810 11:116698345-116698367 GGGTAGAGTCTGGAGGAGGAAGG + Intergenic
1092914166 12:13174542-13174564 AGGTAGATTTTCCAGTTGGAAGG + Intergenic
1094444693 12:30516832-30516854 GAGGAGACTTTCTAGGATGATGG + Intergenic
1097036008 12:56124114-56124136 GGGTAGCTTGTCTAGAAGAAGGG + Exonic
1097488232 12:60232953-60232975 GGATAGCTTTTCTATGGGGAGGG - Intergenic
1098066678 12:66626005-66626027 GGGGAGATTCTCTAGGCAGAGGG + Intronic
1101022470 12:100567174-100567196 TGGAAGAATTTTTAGGAGGAAGG + Intergenic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1104577155 12:129977935-129977957 AAATAGATTTTCTAGGATGATGG - Intergenic
1108032935 13:46255839-46255861 GGGTAAACTTTCTAGGATAATGG - Intronic
1113149048 13:107241883-107241905 GGGTATGTCTTCCAGGAGGAAGG - Intronic
1114302609 14:21391939-21391961 GGGTTGTCTTCCTAGGAGGAAGG - Exonic
1115881695 14:37926801-37926823 GGGAAGATATTTTAGGAAGAGGG + Intronic
1118571656 14:67200339-67200361 GGGAAGATGTAATAGGAGGAAGG - Intronic
1119181532 14:72608583-72608605 CCCTAGATTTTCTAGGAGAAGGG - Intergenic
1119570549 14:75667506-75667528 GGGTACCTTTTTTAGCAGGAAGG - Intronic
1119846364 14:77833195-77833217 GGGTAGCTTTTCTTGGGAGATGG + Intronic
1122446883 14:101776045-101776067 AGCTGCATTTTCTAGGAGGAAGG - Intronic
1123457624 15:20440331-20440353 GGGTAGATTTTCTGGAGGCAAGG - Intergenic
1123660447 15:22560091-22560113 GGGTAGATTTTCTGGAGGCAAGG + Intergenic
1124263773 15:28215478-28215500 GGGTAGATTTTCTGGAGGCAAGG - Intronic
1124314301 15:28654576-28654598 GGGTAGATTTTCTGGAGGCAAGG + Intergenic
1124710395 15:32005417-32005439 GGTTAGAATCTCTAGGAGGCTGG + Intergenic
1126955635 15:53930474-53930496 GAGTAGATTTTCTGGGAAGAGGG + Intergenic
1128534329 15:68479293-68479315 GGGTGCATTTTCTAGGAAGGAGG + Intergenic
1130660858 15:85830646-85830668 GGGAACAGTTTCTAGGAGGCAGG + Intergenic
1135347877 16:21704797-21704819 GGGCAGGTTTTATAGGCGGAGGG + Intronic
1136702092 16:32153674-32153696 GGGTAGATTTTCTGGAGGCAAGG - Intergenic
1136765573 16:32773782-32773804 GGGTAGATTTTCTGGAGGCAAGG + Intergenic
1136802526 16:33096597-33096619 GGGTAGATTTTCTGGAGGCAAGG - Intergenic
1137484017 16:48876702-48876724 GGGTAGAGCTTATAGGAGGATGG + Intergenic
1139655837 16:68386883-68386905 TGACAGATTTTCAAGGAGGAGGG + Intronic
1140682588 16:77400102-77400124 GGGTAGATTTTCAAGTATGCAGG - Intronic
1140732159 16:77866113-77866135 GGGTAGGTTTGCTAGGACGGAGG - Intronic
1141718347 16:85740245-85740267 GTGTATATTTTCTAAGAGCAAGG - Intronic
1141918804 16:87120977-87120999 GGGAAGACTTTCAAGAAGGAGGG + Intronic
1203067963 16_KI270728v1_random:1036033-1036055 GGGTAGATTTTCTGGAGGCAAGG + Intergenic
1147251095 17:39152682-39152704 GGAGAAATTTTCCAGGAGGAGGG + Intronic
1147715752 17:42507104-42507126 GATTAGACTTTCTAAGAGGAAGG - Intronic
1149309621 17:55381507-55381529 GGGAAGGTGTTCTAGGAAGAGGG + Intergenic
1149532249 17:57404855-57404877 GGGTGTGTTTTCTGGGAGGAAGG - Intronic
1151446312 17:74166725-74166747 GGGTAATTATTCTAGGAGGTTGG - Intergenic
1152637998 17:81438028-81438050 GGGGAGGTTTTGTGGGAGGAGGG - Intronic
1158429354 18:57370656-57370678 GGTTGGATCTTCTATGAGGAGGG - Intronic
1161227173 19:3152057-3152079 GGGAATATCTTCTTGGAGGAGGG + Intronic
1162238275 19:9325061-9325083 GGGCTGATTTACTAGCAGGAGGG + Intronic
1162364874 19:10242550-10242572 GGGCAGATTTTCCGAGAGGAAGG - Intergenic
1164421175 19:28094223-28094245 GAGTAGATTTTCTAGGAAAAAGG - Intergenic
1164660811 19:29965307-29965329 GGGCAGGGTTTCTACGAGGAAGG + Intronic
928969799 2:37016039-37016061 GGGAAGAGTTTCAAGAAGGAAGG + Intronic
930437064 2:51358472-51358494 AGGCAGATTTTGTAGGGGGATGG - Intergenic
933393391 2:81701270-81701292 GGGGAGATTTTCTAGGTGGGTGG + Intergenic
937739006 2:125326880-125326902 GTGAAGATTTTCCAGGAGTATGG + Intergenic
942604239 2:177673658-177673680 GGGTTGTCTTTCTTGGAGGAAGG + Intronic
942911957 2:181254506-181254528 GGGGTGATTTTCTAGGTAGATGG - Intergenic
943437792 2:187888192-187888214 GGAGAGATTTTCTAGCAGGATGG + Intergenic
943522382 2:188968991-188969013 TGGTATATGTTCTTGGAGGAAGG - Intergenic
945077367 2:206053577-206053599 GGGTATATTTTATAGGAGTTGGG - Intronic
945103152 2:206282283-206282305 GGAAAGATTTTCTAGGTAGAGGG + Intronic
947389541 2:229625074-229625096 GAGAAGATTTTATAGGATGATGG + Intronic
948404111 2:237704697-237704719 GGGTAGATGTTCTAGAAGGCAGG + Intronic
1169330757 20:4714315-4714337 GGAAAGATGTTCTAGGTGGAGGG - Intergenic
1169442576 20:5644931-5644953 GGGAAGAGCTTCTAGGATGAAGG - Intergenic
1171476538 20:25413775-25413797 GTTTATATGTTCTAGGAGGATGG + Exonic
1172924096 20:38514587-38514609 TGGCAGATTTCCTAGGATGAAGG + Intronic
1176992097 21:15509238-15509260 TGGAGGATTTGCTAGGAGGATGG + Intergenic
1178407241 21:32334942-32334964 GGAGTCATTTTCTAGGAGGAAGG - Intronic
1180142947 21:45903353-45903375 TGGTTGCTTTTCTAGGAGAAAGG + Intronic
1180613377 22:17111794-17111816 GGTAAGAGTTTCTAGCAGGAAGG + Exonic
1181895474 22:26103898-26103920 GGGTAGATTTGCTAGGGGACTGG - Intergenic
1181978448 22:26749287-26749309 GGGTGGCTTTTCAAGGAAGATGG - Intergenic
1182990465 22:34762769-34762791 GGGAAGATTTCCCAGAAGGAAGG - Intergenic
1183192532 22:36330993-36331015 GGGAAGATTTTATCTGAGGAAGG - Intronic
1183588650 22:38767571-38767593 GGGTTGTTTTTTGAGGAGGAGGG + Intronic
1183685681 22:39360118-39360140 GGGGAGATAGTCTAGGATGAGGG - Intronic
1183956663 22:41384459-41384481 AGGCAGGTTTTCTGGGAGGAAGG - Intronic
950183664 3:10932165-10932187 GGGAAGGTTTTCTAGGAGGGAGG - Intronic
951089704 3:18558035-18558057 GGGAATATTTTGTAGGAAGAGGG + Intergenic
951141656 3:19169188-19169210 GGGTGGAGTTTCTAAGAGGCAGG - Intronic
953095826 3:39775946-39775968 GAGTAGATTTTCGAGGTGGGCGG - Intergenic
956272378 3:67461830-67461852 GGGAAGATTTCCAAGGAGAAAGG + Intronic
957282302 3:78169440-78169462 GTGAAGACATTCTAGGAGGAGGG - Intergenic
960436890 3:117637126-117637148 GGGTACATTTTCTAGGATGATGG - Intergenic
960908619 3:122626124-122626146 GGGTATCTTATCTAGAAGGAAGG + Intronic
962958077 3:140284930-140284952 GGGTAGGTTTTCTTGGAGTAGGG - Intronic
963068907 3:141286494-141286516 GGGTAGATTTTCTAGGAGGAAGG + Intronic
964335908 3:155654149-155654171 GGGAAGAGTTTCAAGGAGAAGGG - Intronic
965301096 3:167005892-167005914 GGGAAGACTTTCTAAGAAGAAGG - Intergenic
965564095 3:170093050-170093072 AGGAAGGTTTTCTAGGGGGAAGG - Exonic
966926282 3:184646630-184646652 AGGTAGAATCTCTAGAAGGAAGG + Intronic
967060249 3:185865947-185865969 GTGTAGAGTTTCCAGGAGGAGGG + Intergenic
972813551 4:42618157-42618179 GGGAAGAGTTTCCAGAAGGAGGG - Intronic
974256397 4:59460608-59460630 GGGAAGATTTTATAGAAGCAAGG + Intergenic
974632625 4:64513592-64513614 GGGTAGATTTTCTAGGAAGCTGG - Intergenic
980220289 4:129904092-129904114 GCGTAGTTTTCCTGGGAGGAGGG + Intergenic
981259028 4:142697307-142697329 AGGTAGCTTTTCTGGGAGCAAGG - Intronic
983606161 4:169587443-169587465 GAGGAGAATTTCTAGGATGAGGG + Intronic
984978097 4:185248801-185248823 AGGCAGATTTTCTAGAATGATGG - Intronic
985931727 5:3063719-3063741 GAGAAGATTTTCTAGAATGAGGG + Intergenic
986905371 5:12488769-12488791 GTGTAGATTTTCTAGGGGAAGGG - Intergenic
987278249 5:16385494-16385516 GGGCAGATTTTCCAGTAGTAAGG + Intergenic
987762309 5:22181306-22181328 GGGAAGACTTTCTAGGTGAAGGG - Intronic
987831548 5:23102150-23102172 GCTTAGATTTCCGAGGAGGATGG + Intergenic
988400892 5:30759020-30759042 GTGTAGAATTTCTATAAGGAAGG + Intergenic
988448572 5:31315895-31315917 AGGTAGATTTTCAAGGAAGCAGG - Intronic
989165372 5:38428656-38428678 GGGTAGTCTGTCCAGGAGGAGGG - Intronic
989263189 5:39442268-39442290 GGGTAAATTTTCTTGGGGCAGGG - Intronic
990429804 5:55723393-55723415 AGGTAGATTTTGTTAGAGGAAGG - Intronic
990522609 5:56594575-56594597 GGATAGTTTTTTCAGGAGGAAGG - Intronic
991060004 5:62364461-62364483 AGTCATATTTTCTAGGAGGAGGG + Intronic
991897097 5:71414762-71414784 GGGAAGACTTTCTAGGTGAAGGG - Intergenic
991958785 5:72021360-72021382 GTGTTGATTTTCTGGCAGGAAGG - Intergenic
996013357 5:118504846-118504868 GGGTAGGGTTTCCTGGAGGAAGG - Intergenic
999784649 5:154880131-154880153 GGGAAGTGCTTCTAGGAGGAGGG + Intergenic
1001731816 5:173965800-173965822 GGGTATATATTTTAGGAGTAGGG + Intergenic
1002311398 5:178316619-178316641 GAATACATTTTCTAGGAAGAGGG + Intronic
1002863430 6:1100271-1100293 GAGCAGATTTTCCAGGGGGAAGG + Intergenic
1002939732 6:1705579-1705601 GGCCAGATTTTGTAGGAGAATGG + Intronic
1003414944 6:5899040-5899062 GTGTAGATATACTATGAGGATGG - Intergenic
1006050091 6:31335695-31335717 GGGAAGTGTCTCTAGGAGGAGGG - Intronic
1006832177 6:36975676-36975698 GGGAAGATTTTCAAAGAGGAAGG - Exonic
1006883466 6:37359640-37359662 GGATAGCATTTCTTGGAGGAGGG + Intronic
1007285720 6:40746086-40746108 GGGAAGACTTCCTAGAAGGAAGG + Intergenic
1007385519 6:41517889-41517911 GGTAAGAGTTGCTAGGAGGAAGG + Intergenic
1008373990 6:50770512-50770534 GGGTATATTTTCTGGGTAGAGGG - Intronic
1008505244 6:52223900-52223922 GGGGATATTTTCTTGGGGGAAGG - Intergenic
1008920369 6:56837633-56837655 GGTTAGAATTTGTAGGAAGATGG - Intronic
1009842977 6:69100776-69100798 GGGTAGATTTAATAGACGGAAGG + Intronic
1010491757 6:76485345-76485367 GGGTGGATTTTATGGGTGGAGGG + Intergenic
1012396556 6:98804313-98804335 GGGTATATTTTGAAGAAGGAAGG + Intergenic
1012929965 6:105306589-105306611 GAGAAGAGTTTCAAGGAGGATGG - Intronic
1015661418 6:135579084-135579106 GAGTATATTTTCTAGAAGAATGG - Intergenic
1015961181 6:138650592-138650614 GGGAAGCTTTTCAAAGAGGAAGG - Intronic
1016019218 6:139218388-139218410 GGTAAGATTTTCCAAGAGGAAGG + Intergenic
1016256719 6:142115396-142115418 GCATAGATTTTCTAGCAAGATGG + Intergenic
1016619317 6:146089634-146089656 GGATAGATTTTCTAGGAGTGTGG + Intronic
1016743975 6:147558602-147558624 GGGCAGAGTTTCTAGGAGGACGG - Intronic
1030621514 7:111795836-111795858 GGGTACCTTTTCCAGGAGGATGG - Intronic
1030836225 7:114290154-114290176 TAGTGGATTTTCTAGGGGGAAGG - Intronic
1032533733 7:132643493-132643515 GGCTGGAATTTCTAGGAGGAGGG - Intronic
1032840477 7:135709520-135709542 GGGTATATTTTCTACGAGTAGGG + Intronic
1036661816 8:10714054-10714076 GGGCAGAGTTCCTAGGAGGCGGG + Intergenic
1038336828 8:26652323-26652345 GGGAAGATTGTCCTGGAGGACGG + Exonic
1043347674 8:79318749-79318771 GGCTTGATTTTCTAGAAGGCTGG + Intergenic
1044328235 8:90885236-90885258 AGGTGGATATGCTAGGAGGATGG + Intronic
1048693958 8:137002757-137002779 GGGTATTTTTTGGAGGAGGAGGG + Intergenic
1055114521 9:72592515-72592537 GGGTAAATTCTGAAGGAGGAGGG - Intronic
1055434034 9:76274487-76274509 GGGTAAATTTTCAAGGAAAATGG - Intronic
1056270158 9:84939756-84939778 AGGTAGGTTTTCTAGTAGCATGG - Intronic
1056660948 9:88542859-88542881 GGGGAGATTTGCTAATAGGAGGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057550364 9:96047639-96047661 GGGTAAATTTTGCAGGGGGAAGG - Intergenic
1058324689 9:103680616-103680638 TGGGAGCTTTTCTAGGAGGGAGG - Intergenic
1059066134 9:111086539-111086561 GGGCACATTTACTTGGAGGAGGG + Intergenic
1059074852 9:111181947-111181969 GGGTAGATTTGCATGGAGAAAGG + Intergenic
1059125202 9:111678188-111678210 GGAGAGATATTCCAGGAGGAAGG + Intergenic
1061057463 9:128232184-128232206 GGGTAGAGTTTGGAGGAGCAGGG - Intronic
1188545666 X:31303513-31303535 GGATAGATATCATAGGAGGAAGG - Intronic
1189701331 X:43717993-43718015 GGGTAGATGTTTTAGGAAGAAGG + Intronic
1193615102 X:83677494-83677516 GGGTTGATTTGCTAGGATAATGG - Intergenic
1198936011 X:141903465-141903487 GGGGAGATTTTCTCTGAGGAGGG + Intergenic
1200111667 X:153743835-153743857 GGAAGGGTTTTCTAGGAGGAGGG - Exonic