ID: 963070910

View in Genome Browser
Species Human (GRCh38)
Location 3:141304444-141304466
Sequence GGCCCCTCAGGGTTGTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963070910_963070918 14 Left 963070910 3:141304444-141304466 CCCAGGGACAACCCTGAGGGGCC No data
Right 963070918 3:141304481-141304503 GCGCCTTTGGGGTCAAGCCAAGG No data
963070910_963070915 1 Left 963070910 3:141304444-141304466 CCCAGGGACAACCCTGAGGGGCC No data
Right 963070915 3:141304468-141304490 TCTCAGCTTCAGAGCGCCTTTGG No data
963070910_963070916 2 Left 963070910 3:141304444-141304466 CCCAGGGACAACCCTGAGGGGCC No data
Right 963070916 3:141304469-141304491 CTCAGCTTCAGAGCGCCTTTGGG No data
963070910_963070917 3 Left 963070910 3:141304444-141304466 CCCAGGGACAACCCTGAGGGGCC No data
Right 963070917 3:141304470-141304492 TCAGCTTCAGAGCGCCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963070910 Original CRISPR GGCCCCTCAGGGTTGTCCCT GGG (reversed) Intergenic
No off target data available for this crispr