ID: 963071976

View in Genome Browser
Species Human (GRCh38)
Location 3:141311916-141311938
Sequence CGCCGGGTGTCTACCTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963071973_963071976 -9 Left 963071973 3:141311902-141311924 CCGGTGGGCGGTGTCGCCGGGTG No data
Right 963071976 3:141311916-141311938 CGCCGGGTGTCTACCTCCAGGGG No data
963071964_963071976 24 Left 963071964 3:141311869-141311891 CCGGGCAGGGAACAGGGTTTCTG No data
Right 963071976 3:141311916-141311938 CGCCGGGTGTCTACCTCCAGGGG No data
963071963_963071976 28 Left 963071963 3:141311865-141311887 CCAACCGGGCAGGGAACAGGGTT No data
Right 963071976 3:141311916-141311938 CGCCGGGTGTCTACCTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963071976 Original CRISPR CGCCGGGTGTCTACCTCCAG GGG Intergenic