ID: 963071977

View in Genome Browser
Species Human (GRCh38)
Location 3:141311918-141311940
Sequence GACCCCTGGAGGTAGACACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963071977_963071980 0 Left 963071977 3:141311918-141311940 CCGGGTGTCTACCTCCAGGGGTC No data
Right 963071980 3:141311941-141311963 GTTCGTGAGCCAGAGAAACCCGG No data
963071977_963071985 16 Left 963071977 3:141311918-141311940 CCGGGTGTCTACCTCCAGGGGTC No data
Right 963071985 3:141311957-141311979 AACCCGGACTTAGGAAGGAAGGG No data
963071977_963071989 22 Left 963071977 3:141311918-141311940 CCGGGTGTCTACCTCCAGGGGTC No data
Right 963071989 3:141311963-141311985 GACTTAGGAAGGAAGGGGCCTGG No data
963071977_963071981 7 Left 963071977 3:141311918-141311940 CCGGGTGTCTACCTCCAGGGGTC No data
Right 963071981 3:141311948-141311970 AGCCAGAGAAACCCGGACTTAGG No data
963071977_963071984 15 Left 963071977 3:141311918-141311940 CCGGGTGTCTACCTCCAGGGGTC No data
Right 963071984 3:141311956-141311978 AAACCCGGACTTAGGAAGGAAGG No data
963071977_963071983 11 Left 963071977 3:141311918-141311940 CCGGGTGTCTACCTCCAGGGGTC No data
Right 963071983 3:141311952-141311974 AGAGAAACCCGGACTTAGGAAGG No data
963071977_963071986 17 Left 963071977 3:141311918-141311940 CCGGGTGTCTACCTCCAGGGGTC No data
Right 963071986 3:141311958-141311980 ACCCGGACTTAGGAAGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963071977 Original CRISPR GACCCCTGGAGGTAGACACC CGG (reversed) Intergenic