ID: 963071978

View in Genome Browser
Species Human (GRCh38)
Location 3:141311929-141311951
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963071978_963071983 0 Left 963071978 3:141311929-141311951 CCTCCAGGGGTCGTTCGTGAGCC No data
Right 963071983 3:141311952-141311974 AGAGAAACCCGGACTTAGGAAGG No data
963071978_963071985 5 Left 963071978 3:141311929-141311951 CCTCCAGGGGTCGTTCGTGAGCC No data
Right 963071985 3:141311957-141311979 AACCCGGACTTAGGAAGGAAGGG No data
963071978_963071981 -4 Left 963071978 3:141311929-141311951 CCTCCAGGGGTCGTTCGTGAGCC No data
Right 963071981 3:141311948-141311970 AGCCAGAGAAACCCGGACTTAGG No data
963071978_963071984 4 Left 963071978 3:141311929-141311951 CCTCCAGGGGTCGTTCGTGAGCC No data
Right 963071984 3:141311956-141311978 AAACCCGGACTTAGGAAGGAAGG No data
963071978_963071986 6 Left 963071978 3:141311929-141311951 CCTCCAGGGGTCGTTCGTGAGCC No data
Right 963071986 3:141311958-141311980 ACCCGGACTTAGGAAGGAAGGGG No data
963071978_963071989 11 Left 963071978 3:141311929-141311951 CCTCCAGGGGTCGTTCGTGAGCC No data
Right 963071989 3:141311963-141311985 GACTTAGGAAGGAAGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963071978 Original CRISPR GGCTCACGAACGACCCCTGG AGG (reversed) Intergenic
No off target data available for this crispr