ID: 963071980

View in Genome Browser
Species Human (GRCh38)
Location 3:141311941-141311963
Sequence GTTCGTGAGCCAGAGAAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963071973_963071980 16 Left 963071973 3:141311902-141311924 CCGGTGGGCGGTGTCGCCGGGTG No data
Right 963071980 3:141311941-141311963 GTTCGTGAGCCAGAGAAACCCGG No data
963071977_963071980 0 Left 963071977 3:141311918-141311940 CCGGGTGTCTACCTCCAGGGGTC No data
Right 963071980 3:141311941-141311963 GTTCGTGAGCCAGAGAAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963071980 Original CRISPR GTTCGTGAGCCAGAGAAACC CGG Intergenic
No off target data available for this crispr