ID: 963071981

View in Genome Browser
Species Human (GRCh38)
Location 3:141311948-141311970
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963071978_963071981 -4 Left 963071978 3:141311929-141311951 CCTCCAGGGGTCGTTCGTGAGCC No data
Right 963071981 3:141311948-141311970 AGCCAGAGAAACCCGGACTTAGG No data
963071973_963071981 23 Left 963071973 3:141311902-141311924 CCGGTGGGCGGTGTCGCCGGGTG No data
Right 963071981 3:141311948-141311970 AGCCAGAGAAACCCGGACTTAGG No data
963071979_963071981 -7 Left 963071979 3:141311932-141311954 CCAGGGGTCGTTCGTGAGCCAGA No data
Right 963071981 3:141311948-141311970 AGCCAGAGAAACCCGGACTTAGG No data
963071977_963071981 7 Left 963071977 3:141311918-141311940 CCGGGTGTCTACCTCCAGGGGTC No data
Right 963071981 3:141311948-141311970 AGCCAGAGAAACCCGGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type