ID: 963071983

View in Genome Browser
Species Human (GRCh38)
Location 3:141311952-141311974
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963071973_963071983 27 Left 963071973 3:141311902-141311924 CCGGTGGGCGGTGTCGCCGGGTG No data
Right 963071983 3:141311952-141311974 AGAGAAACCCGGACTTAGGAAGG No data
963071977_963071983 11 Left 963071977 3:141311918-141311940 CCGGGTGTCTACCTCCAGGGGTC No data
Right 963071983 3:141311952-141311974 AGAGAAACCCGGACTTAGGAAGG No data
963071979_963071983 -3 Left 963071979 3:141311932-141311954 CCAGGGGTCGTTCGTGAGCCAGA No data
Right 963071983 3:141311952-141311974 AGAGAAACCCGGACTTAGGAAGG No data
963071978_963071983 0 Left 963071978 3:141311929-141311951 CCTCCAGGGGTCGTTCGTGAGCC No data
Right 963071983 3:141311952-141311974 AGAGAAACCCGGACTTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type