ID: 963075577

View in Genome Browser
Species Human (GRCh38)
Location 3:141343436-141343458
Sequence ACAAGGACCCTTGGAGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963075571_963075577 8 Left 963075571 3:141343405-141343427 CCAGGGAGGTGGGGATTGTCAAC 0: 1
1: 0
2: 1
3: 22
4: 250
Right 963075577 3:141343436-141343458 ACAAGGACCCTTGGAGGTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963075577 Original CRISPR ACAAGGACCCTTGGAGGTTG GGG Intronic
900192424 1:1357071-1357093 CCAAGGACCCTCGGGGGCTGGGG - Intronic
900543696 1:3216889-3216911 ACCAGGAGCCTGGGAGGCTGAGG - Intronic
900805369 1:4763925-4763947 ACCAGGAACCTTGGAAGGTGTGG - Intronic
903189098 1:21646583-21646605 ACTAGGAGCCTGGGAGGTGGAGG - Intronic
903287681 1:22286816-22286838 ACCAAGACCCTGGGAGGTTAGGG - Intergenic
903440462 1:23384254-23384276 ACAAGGCCCCTTCTGGGTTGTGG + Intronic
904160214 1:28517741-28517763 ACGAGAACCCAGGGAGGTTGTGG - Intronic
905807064 1:40884657-40884679 ACAAAGCCCCTTGGTGGCTGGGG - Intergenic
910031846 1:82735371-82735393 GGAAGGAGCCTGGGAGGTTGAGG + Intergenic
911625184 1:100115734-100115756 AGAAGGATCGCTGGAGGTTGAGG + Intronic
912124080 1:106511189-106511211 ACATTTACCCTTGGAGATTGTGG - Intergenic
912665472 1:111575588-111575610 ATAAGGACACTTGGAGGTATTGG - Intronic
913148468 1:116016270-116016292 ACAGTGAGCCTGGGAGGTTGGGG - Intronic
918334836 1:183498432-183498454 AGAAGGAGCCTAGGAGGTTGAGG + Intronic
919780209 1:201216470-201216492 ACAAGGCCCCATGGAGGTTCAGG + Exonic
920050768 1:203163500-203163522 TCAAGGCCCCTTGGTGGTGGTGG + Intronic
920180068 1:204127113-204127135 ACAAAGCCCCTTGGAGGCCGAGG - Exonic
920449524 1:206048764-206048786 ACAAGGAGGCTCTGAGGTTGGGG - Intronic
921848179 1:219905942-219905964 ATAAGGGCCCTTGGAATTTGGGG + Intronic
921966650 1:221097633-221097655 GAAGGGACACTTGGAGGTTGTGG - Intergenic
923446694 1:234077868-234077890 ATGAAGACCCTTGGAGGTGGAGG - Intronic
1062982081 10:1733206-1733228 ACAAGGTACATTGGAGGCTGGGG - Intronic
1063070167 10:2653753-2653775 AGAAGGACCATGGGAGGTAGGGG - Intergenic
1063210885 10:3880355-3880377 ACAAGGGCGGTTGGAGGATGAGG - Intergenic
1064218475 10:13419750-13419772 ACCAGGGCCATGGGAGGTTGAGG + Intergenic
1064889730 10:20157033-20157055 ACAAGCTACCTTGGAGGCTGAGG - Intronic
1065705822 10:28470844-28470866 ACAAGTACCCCTGAAGGTCGAGG - Intergenic
1067281755 10:44878738-44878760 AAAAGGCCGCTTGGAGGTGGAGG + Intergenic
1068226603 10:54114760-54114782 ACAAGGAGCCTTTCAGGTAGTGG + Intronic
1068839137 10:61590665-61590687 AAAATGACCCTGGGAGGTTAGGG + Intergenic
1069930485 10:71878414-71878436 ACAGGGTCCTTTGGAGGATGGGG + Intergenic
1070527183 10:77305357-77305379 ATAATCACCCTTTGAGGTTGAGG + Intronic
1070695273 10:78558562-78558584 CCAAGGTCCCTTGGAGCTTCAGG - Intergenic
1071134015 10:82432618-82432640 ACAAGGCCTATTGGAGGGTGTGG - Intronic
1072153399 10:92701491-92701513 TCAAGGACCCTATGAGGTAGAGG + Intergenic
1072569360 10:96645161-96645183 AAAAGGACCCCTGGAGACTGAGG + Intronic
1073235560 10:102012361-102012383 ACAGGGACTCTGGGAAGTTGAGG + Intronic
1073490663 10:103851077-103851099 AAAAAGACCCTTGCAGGCTGTGG + Intronic
1074544553 10:114392536-114392558 ACAAGCACCCTTGAGAGTTGGGG - Intronic
1075566191 10:123506127-123506149 AGAAGGGCCTCTGGAGGTTGCGG + Intergenic
1075836007 10:125453370-125453392 ACCAGGACCCCAGGAGGCTGTGG - Intergenic
1075999216 10:126902397-126902419 TCCAGGAGCCCTGGAGGTTGTGG - Intergenic
1076550692 10:131276159-131276181 AGGAGGACCCTTGGAAGTTGAGG - Intronic
1077564080 11:3285263-3285285 ACAATGCCCCGTGGAGGCTGTGG - Intergenic
1077569970 11:3331080-3331102 ACAATGCCCCGTGGAGGCTGTGG - Intergenic
1077699542 11:4428471-4428493 ACTTGGAGCCTGGGAGGTTGAGG + Intergenic
1080415460 11:32065905-32065927 ACAAGTCACCTTGGAGGATGGGG + Intronic
1081646812 11:44795842-44795864 CCAAGGACCTTTGGAGGCTTTGG + Intronic
1081846887 11:46247126-46247148 AGAAGGAGCCATTGAGGTTGGGG + Intergenic
1082751884 11:57028281-57028303 ACAAGGAATCTTGGTGGTTTGGG + Intergenic
1082988763 11:59189387-59189409 GCTATGACCCTTGGAGGTTGAGG - Intronic
1083943694 11:65912201-65912223 ACAAGGACTCTTGGGAGTTGTGG + Intergenic
1088694660 11:112356364-112356386 ACCTGAACCCTGGGAGGTTGAGG - Intergenic
1089678999 11:120109105-120109127 ACAGGGAGCCTTGGAGATTTGGG + Intergenic
1091912280 12:4242300-4242322 GCAAGGCCCCGTGGAGGTAGAGG + Intergenic
1092055879 12:5507536-5507558 AAAAGGATCCCTGGAGGATGGGG - Intronic
1092094740 12:5832238-5832260 ACAAGCACCCTTGGCTGTTTGGG + Intronic
1092204435 12:6606797-6606819 ACAAGGTCACTTGGGGGTGGGGG + Intronic
1093013469 12:14132516-14132538 ACAAAGACCCTTGAAGCTGGTGG - Intergenic
1094484555 12:30914321-30914343 ACAAGGAGACTTGGTGGTGGTGG + Intergenic
1095690323 12:45081153-45081175 ACAAGGGCACTTGGAAGGTGAGG + Intergenic
1101777943 12:107810687-107810709 AAAAGGAGCCTTGGGGGATGTGG + Intergenic
1102019232 12:109670228-109670250 AAAAGCACCCTTGGAGGTTTTGG - Intergenic
1104197109 12:126551357-126551379 ACGAGGATCCTGGGAGGTGGAGG - Intergenic
1109323621 13:60839693-60839715 ACAAAGACCCATAAAGGTTGGGG - Intergenic
1121444309 14:93969015-93969037 CCAAGAACCCTTGAAGGCTGAGG - Intronic
1121951528 14:98175119-98175141 ACATGGCCCCTGGGAGCTTGGGG + Intergenic
1123476140 15:20593550-20593572 ACAAGCTCCCTGGGAGGTGGGGG + Intergenic
1123641872 15:22406814-22406836 ACAAGCTCCCTGGGAGGTGGGGG - Intergenic
1123818053 15:23999489-23999511 CCAGAGACCCTTGGATGTTGAGG + Intergenic
1125919333 15:43516291-43516313 ACTAGTACTCTTGGGGGTTGAGG - Intronic
1127537438 15:59903450-59903472 CCAAGGACTTTTGGAGGCTGAGG - Intergenic
1128540226 15:68523276-68523298 ACATTGAGCCTGGGAGGTTGAGG - Intergenic
1128978146 15:72168000-72168022 AGAAGGACCCTTCGACGCTGGGG - Intronic
1129935015 15:79440126-79440148 ATAAGGTCCCCTGGAGGTTCTGG - Intronic
1130138422 15:81200976-81200998 ACAACCATCCTTGGAGGATGAGG - Intronic
1130557764 15:84934964-84934986 ATAGGGACCCTTGCTGGTTGTGG + Intronic
1132252429 15:100343569-100343591 ACAAGAAACCTTGGTGATTGAGG + Intergenic
1132547378 16:539580-539602 ACAAGGACCCTGTGAGGCTATGG - Intronic
1132698704 16:1213165-1213187 CCATGGCCCCTTGGAGGATGGGG + Intronic
1133819103 16:9220880-9220902 ACAAGAATCCTGGGAGGTGGAGG + Intergenic
1134252441 16:12583743-12583765 ACCTGGGCCCTGGGAGGTTGAGG + Intergenic
1137744548 16:50810955-50810977 AGAAGGAGCCTTGGAGGTGCTGG - Intergenic
1140471951 16:75220544-75220566 TCCAGCACCCTGGGAGGTTGAGG - Intronic
1140510424 16:75503553-75503575 CCCAGTACCCTTGGAGGCTGAGG + Intergenic
1140655712 16:77137171-77137193 AGAAGGAACATTGGAGGGTGGGG - Intergenic
1141996627 16:87640076-87640098 ACAAGCACTTTGGGAGGTTGAGG + Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142122283 16:88392860-88392882 ACAAGGAGCAAGGGAGGTTGGGG - Intergenic
1142716488 17:1749792-1749814 ACAAGGGCCCATGGACTTTGGGG + Intronic
1143254243 17:5543962-5543984 AGAAGGACCCTTCTAGATTGGGG + Intronic
1144647637 17:16986562-16986584 CCCAGGGCCCTTGGAGCTTGAGG + Intergenic
1148759896 17:49994225-49994247 AGAAGGACCCACGGAAGTTGCGG - Intronic
1149595923 17:57864668-57864690 TCAAGGACCCTTGGTGTTTAAGG + Intronic
1150159194 17:62880536-62880558 ACAGGGACCCTAAGAGGATGGGG + Intergenic
1150331801 17:64300338-64300360 ACAAGCACCCTCGGAGGCTCCGG - Intergenic
1151328674 17:73394137-73394159 ACAAGGCCCCTTGGATGGAGAGG + Intronic
1153983806 18:10335280-10335302 ACAAGCCACCTTGCAGGTTGGGG - Intergenic
1154104528 18:11509840-11509862 AGATGGAGCCTGGGAGGTTGAGG + Intergenic
1156718072 18:40036351-40036373 AAAAGGACCCTGGGGGATTGGGG + Intergenic
1157591504 18:48838922-48838944 ACTAGGACACTTAGAGATTGAGG - Intronic
1157634572 18:49138438-49138460 TCAAGGCCCCTAGGAGGTGGAGG - Intronic
1157861709 18:51147081-51147103 CCTAGCACCCTTGGAGGCTGAGG - Intergenic
1158526289 18:58217312-58217334 ACTAGGACACTTGGAGGGGGAGG - Intronic
1158611749 18:58946757-58946779 ACAAGTACCCTTGGGGGAGGGGG - Intronic
1159694196 18:71533555-71533577 AAAAGGACCCATGGAGATTTTGG + Intergenic
1159715699 18:71820082-71820104 CAAAGCACCCTTGGAGGGTGGGG + Intergenic
1160949508 19:1658682-1658704 ACAAGGATCCTAGGAGGGCGGGG + Intergenic
1161031106 19:2058119-2058141 GCCAGGGCCCTGGGAGGTTGAGG - Intergenic
1161107414 19:2451517-2451539 ACAAAGACCCTTTGAGCCTGCGG + Intronic
1163210753 19:15838453-15838475 ACAAGGACCTCTGGGGATTGGGG + Intergenic
1163970193 19:20786010-20786032 ACTAGGACTCTGGGAGGCTGAGG - Intronic
1164027831 19:21369183-21369205 ACCTTGAGCCTTGGAGGTTGAGG - Intronic
1164280039 19:23761169-23761191 AGAAGGATCACTGGAGGTTGAGG - Intergenic
1164585991 19:29476360-29476382 ACAAGGACCCCTGTGGGCTGAGG - Intergenic
1165154445 19:33778483-33778505 ACAAGCCCCCGGGGAGGTTGTGG - Intergenic
1165763988 19:38338783-38338805 ATAATGAGCCTAGGAGGTTGAGG + Intronic
1166861288 19:45813001-45813023 GCCAGGAGCCTTGAAGGTTGTGG + Intronic
925324569 2:3007822-3007844 ATAAGGACCCATGGAGGCTGGGG - Intergenic
926786039 2:16519356-16519378 ACAAGGACCCTGGATGGTTGGGG + Intergenic
926791526 2:16576177-16576199 TCAAGGACCTTAGGAGGGTGAGG + Intronic
928454315 2:31405401-31405423 ACAGGGAGCCCTGGAGGGTGGGG - Intronic
929156485 2:38793096-38793118 ACCCGGAGCCTAGGAGGTTGAGG - Intergenic
930087990 2:47511656-47511678 ACAAGGCCACTTGGAGGCAGAGG + Intronic
931922652 2:67037866-67037888 GCAAGCACCCTTTCAGGTTGTGG + Intergenic
931984681 2:67730322-67730344 TCAAGGGACGTTGGAGGTTGGGG - Intergenic
932582206 2:72999308-72999330 ACATGGACCATTGAAGGCTGGGG + Intronic
934863394 2:97783344-97783366 AGAAGGAACCTTGGAGGATTAGG + Intronic
936285783 2:111180258-111180280 ACAAGCACTCTGGGAGGTTGAGG - Intergenic
937258525 2:120571118-120571140 ACAAGGAGCCCTGGAAGTGGAGG + Intergenic
937549048 2:123063949-123063971 ACATGGACCCTTGTATGATGTGG - Intergenic
938133033 2:128733505-128733527 ACAAGAACTCTGGGAGGTAGGGG - Intergenic
938734885 2:134176878-134176900 ACCAAGACCCTTGGAGGTCAAGG - Intronic
940541949 2:155031325-155031347 CCAAGCACCCTGGGAGGCTGAGG - Intergenic
941838409 2:170052165-170052187 TCATGGACCTTTGGAGGTAGAGG - Intronic
946301722 2:218828135-218828157 ACAAGGACACTGGCAGGGTGGGG - Intronic
947445387 2:230158821-230158843 ACATGCACACTTGGAGGATGGGG + Intergenic
948306828 2:236954657-236954679 ACATGGACCCTGAGGGGTTGGGG - Intergenic
948484451 2:238271604-238271626 ACCAGGAGCGTTGGAGGTGGGGG + Intronic
1171382879 20:24746493-24746515 AAAAGGAACCTGGGAGGCTGGGG - Intergenic
1171472476 20:25383128-25383150 ACAGGGACACTTAGAGGGTGAGG + Intronic
1172423380 20:34836683-34836705 TCAAGCACCTTTGGAGGCTGAGG + Intergenic
1173892324 20:46522544-46522566 ACAGGTGCCCTTGGATGTTGTGG + Intergenic
1174405345 20:50299194-50299216 ACACTGAACCTTCGAGGTTGAGG - Intergenic
1174565810 20:51463715-51463737 AAAAGCACCCTTGCAGGGTGTGG - Intronic
1174915500 20:54649185-54649207 ACAGAGACCTTTGGAGGTTAAGG + Intronic
1178294456 21:31397360-31397382 ACATGGACCCTTAGAGCTTTTGG - Intronic
1180800298 22:18628554-18628576 TCAAGGACCCCTGTAGGTTGGGG + Intergenic
1180851532 22:19024118-19024140 CCAAGGACCCCTGTATGTTGGGG + Intergenic
1181221418 22:21366712-21366734 TCAAGGACCCCTGTAGGTTGGGG - Intergenic
1181310253 22:21940790-21940812 ACAAGGTCCCTGGGCGGATGGGG + Intronic
1181798774 22:25330013-25330035 ACTAGGAGCCTTGGGGGATGTGG - Intergenic
1182311152 22:29408429-29408451 ACAAGGAGCCTTGGGGGATATGG - Intronic
1182311269 22:29409502-29409524 ACAAGGAGCCTTGGGGGATGTGG - Intronic
1182689004 22:32143239-32143261 ACGAGGAGCCTTGGGGGATGTGG - Intergenic
1182689707 22:32150529-32150551 ACAAGGAGCCTTGGGGGATGTGG + Intronic
1182689823 22:32151603-32151625 ACAAGGAGCCCTGGGGGATGTGG + Intronic
1182689949 22:32152678-32152700 ACAAGGAGCCCTGGGGGATGTGG + Intronic
1183395394 22:37568432-37568454 AGCAGGACCCGTGGGGGTTGCGG - Exonic
1185006045 22:48277587-48277609 ACAAGGACGCTTTCAGGCTGAGG - Intergenic
950540378 3:13608967-13608989 ACTGGGACCCCTGGAGTTTGGGG + Intronic
952959956 3:38583008-38583030 CCCAGGACTCCTGGAGGTTGGGG - Intronic
953668103 3:44940435-44940457 AGAAGGACCCTTAGAGGATAGGG - Intronic
954199741 3:49017166-49017188 TCAAGGGCCCTCTGAGGTTGGGG + Intronic
954803106 3:53198822-53198844 GGAAGGACCCTTGGAGATTATGG + Intergenic
955353790 3:58213959-58213981 TCAATGACTCTTGGAGGTAGGGG - Intronic
955505242 3:59626225-59626247 TAAAGGACCACTGGAGGTTGTGG + Intergenic
957314019 3:78554220-78554242 ACAAGAAACCCTGGAGTTTGTGG - Intergenic
957314038 3:78554736-78554758 ACAAGAAACCCTGGAGTTTGTGG + Intergenic
959453250 3:106528725-106528747 ACCAGGGCCTTTGGGGGTTGGGG + Intergenic
960315316 3:116168948-116168970 ACCAGTACCCTGGGAGGCTGAGG + Intronic
961479834 3:127172531-127172553 ACCAAGACACTTGGAGGTCGTGG - Intergenic
961666975 3:128498633-128498655 ACCAGGATCCTTGGAGGTGAGGG + Intergenic
962510819 3:136098801-136098823 ACTAGGAACCTTGGAAGTGGGGG + Intronic
963075577 3:141343436-141343458 ACAAGGACCCTTGGAGGTTGGGG + Intronic
963362042 3:144286900-144286922 ATAAGGACCATTGAGGGTTGAGG + Intergenic
967126523 3:186429466-186429488 ACAAGTCTCCTTGGAGGTAGAGG + Intergenic
969232029 4:5838762-5838784 AGAAGGAACCTTGGAGGAGGGGG - Intronic
969382628 4:6814678-6814700 ACAATGACCCTGGGAAGCTGTGG + Intronic
970902391 4:21174820-21174842 ACTTGAACCCGTGGAGGTTGCGG + Intronic
972590546 4:40481933-40481955 ACAAGTACTTTGGGAGGTTGAGG - Intronic
977482148 4:97592827-97592849 TCAAGTGCCCTTGGGGGTTGTGG - Intronic
979687049 4:123522327-123522349 TCAGAGACCCTAGGAGGTTGCGG + Intergenic
980385810 4:132087175-132087197 ACAAGAACCAATGGTGGTTGAGG - Intergenic
983441811 4:167795710-167795732 ACAAGGACCCTTACTGGGTGCGG - Intergenic
984802147 4:183725229-183725251 AGAAGGACCCCTGAAGGCTGTGG - Intergenic
987218291 5:15762366-15762388 AGAAGCACCCTTGTAGGGTGGGG + Intronic
989977830 5:50607716-50607738 CCCAGCACCCTGGGAGGTTGAGG - Intergenic
991517285 5:67451521-67451543 CCAAGGACTTTTGGAGGCTGAGG + Intergenic
993814783 5:92529181-92529203 ACAAGTACCCTGGGAGTATGCGG - Intergenic
994247179 5:97490990-97491012 AAAAGGACACCTGCAGGTTGAGG - Intergenic
996309890 5:122092762-122092784 ACAATGACCCTGGGTGGGTGGGG + Intergenic
999739867 5:154541997-154542019 ACAACAGCCCTGGGAGGTTGGGG + Intergenic
999823712 5:155254136-155254158 ACAAGGAACCAAGGAGGCTGAGG - Intergenic
1000339678 5:160267287-160267309 GCAACGACCCTGGGAGGTTGGGG + Intronic
1000578923 5:163011291-163011313 ACAAGCACCCCTGAAGGGTGAGG + Intergenic
1001684224 5:173581236-173581258 ACAATGACCCTATGAGGTAGGGG - Intergenic
1001849659 5:174952327-174952349 AGGAGGACCCTTGGAGTTTTTGG + Intergenic
1002446171 5:179291352-179291374 ACACGGAACCTTTGAGGGTGTGG - Intronic
1002486990 5:179545659-179545681 ACTAGCACTCTGGGAGGTTGAGG + Intergenic
1002491958 5:179584676-179584698 ATCATGAGCCTTGGAGGTTGAGG + Intronic
1004230242 6:13826592-13826614 ACTAGAACCTTTGGAGGTAGAGG - Intergenic
1004729214 6:18341383-18341405 AAAAGGATTCTTGGAGGTGGTGG - Intergenic
1006749019 6:36365005-36365027 ATAAGGACTCTTGGACTTTGGGG - Intronic
1007335020 6:41149719-41149741 ACCAGGACCTTAGGAGGTAGAGG + Exonic
1014915937 6:127148270-127148292 ACTAGCACCCTGGGAGATTGGGG - Intronic
1017282049 6:152636434-152636456 ATAAGGAGACTAGGAGGTTGGGG - Intronic
1017430360 6:154364739-154364761 AGAAGGACCCTGAGAGGTCGGGG + Intronic
1017993036 6:159506618-159506640 ACAGGGAGCCTTGGAGAATGGGG + Intergenic
1018828555 6:167424547-167424569 AGGAGGACCCTGGGAGTTTGGGG - Intergenic
1020882790 7:13783345-13783367 ACAAGGAGCTGTGGAGGATGGGG - Intergenic
1021217576 7:17936014-17936036 AAAAGGACCCCTGGATGTTCAGG + Intronic
1022296799 7:29063137-29063159 AAAAGGAGCCCTGGAGGTTCAGG - Intronic
1022505977 7:30908813-30908835 ACAGGGCCCCTCGGAGGTGGTGG + Intergenic
1023512955 7:40972630-40972652 GCAAGCAACCTTGGAGGATGAGG - Intergenic
1023517046 7:41011495-41011517 ACAAGCTCCCCTAGAGGTTGGGG - Intergenic
1024851380 7:53721234-53721256 ACAATGACCATGGGAGGTGGAGG + Intergenic
1026148810 7:67771153-67771175 CCAAGCTCCTTTGGAGGTTGAGG - Intergenic
1029043955 7:97607606-97607628 ACCTGGACCCTGGGAGGTTAAGG + Intergenic
1029420511 7:100469558-100469580 AGAGGGAGCCTTGGAGGATGAGG - Intronic
1030351142 7:108489176-108489198 ACAAGGAGCCTTGGAGATACAGG + Intronic
1031607286 7:123784788-123784810 ACAAGGAGCCTTCCAGGATGTGG + Intergenic
1034284190 7:149873706-149873728 CCAAAGACCCCTGGAGCTTGGGG - Exonic
1037132742 8:15426196-15426218 ACAAGGAAACTGAGAGGTTGTGG - Intronic
1037274963 8:17168114-17168136 TCCAAGACCCTTGGAGTTTGAGG + Intronic
1037515992 8:19632837-19632859 TCAATGAGCCTGGGAGGTTGAGG - Intronic
1037824795 8:22154812-22154834 ACAGGGACCCTGGGAGCTTCTGG - Intronic
1037903599 8:22702690-22702712 ACAAGGAACCCTGGAGGGAGAGG + Intergenic
1038451895 8:27644938-27644960 ACAAGAACCCTTGGAGCTTCAGG + Intronic
1038927328 8:32154846-32154868 GCAAGGATACTTGGATGTTGGGG + Intronic
1039183040 8:34887803-34887825 ACTTGAACCCTGGGAGGTTGAGG + Intergenic
1040658095 8:49535677-49535699 AAAAGGACCCCTGGGGTTTGTGG - Intergenic
1041215512 8:55596286-55596308 AGAAGCAGCCTTGGAGGGTGGGG + Intergenic
1041231858 8:55760344-55760366 GCCAGGACCCGTGGAGGCTGTGG - Intronic
1042505870 8:69559747-69559769 ACAAAGTCCCTTGGTGGCTGGGG - Intronic
1047902892 8:129443024-129443046 CCAAGGTCCAGTGGAGGTTGTGG - Intergenic
1048254122 8:132892567-132892589 ACAAGGAACATTCCAGGTTGTGG + Intronic
1048676362 8:136786908-136786930 AAAGAGACACTTGGAGGTTGGGG + Intergenic
1049679789 8:143913046-143913068 ACAGGGACCCTCTGAGGCTGTGG - Intergenic
1051657100 9:19393484-19393506 TCCAGCACCCTGGGAGGTTGAGG - Intergenic
1052313675 9:27094682-27094704 ACAAAGTCCCTTGGAGGTTTAGG + Intergenic
1052818171 9:33117984-33118006 ACAAGGAGCCTGGCAGGTTTGGG - Intronic
1052857658 9:33417155-33417177 GCAAGGACCATTTGAGGGTGAGG + Intergenic
1053100053 9:35364082-35364104 ACCAGGGCCTTTGGAGTTTGAGG + Intronic
1053456294 9:38235452-38235474 ACCATGACCCTTGGAGGCTGGGG - Intergenic
1055293707 9:74812637-74812659 CCTAGCACCCTTGGAGGCTGAGG + Intronic
1056152079 9:83801017-83801039 TCAGGGACACTTGGAGGTTAGGG - Intronic
1056493023 9:87126493-87126515 ACAACAACATTTGGAGGTTGAGG - Intergenic
1058456658 9:105143835-105143857 TCAAGGTCCCTTGCAGCTTGAGG - Intergenic
1059239371 9:112790058-112790080 ACAAGCAACCTTGGAGTTTTTGG + Intronic
1062481565 9:136754883-136754905 GCAGGGACCCTGGGAGGCTGGGG - Intronic
1186068273 X:5789797-5789819 ATCAGGATCCTTTGAGGTTGAGG + Intergenic
1189877741 X:45454408-45454430 AAAAGCAGCCTTGGAGGCTGGGG + Intergenic
1190786170 X:53651278-53651300 ACAAGGAAACTTGGAGGTGATGG - Intronic
1192012192 X:67286675-67286697 AAAAGGATCCTTGGAGGAGGTGG - Intergenic
1193489361 X:82130698-82130720 CCCAGAACTCTTGGAGGTTGCGG + Intergenic
1197091073 X:122538494-122538516 ACAACCACCCATGGTGGTTGTGG + Intergenic