ID: 963078457

View in Genome Browser
Species Human (GRCh38)
Location 3:141369201-141369223
Sequence GACACGTATTTGCCTAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963078457_963078461 13 Left 963078457 3:141369201-141369223 CCTGTTCTAGGCAAATACGTGTC 0: 1
1: 0
2: 0
3: 8
4: 51
Right 963078461 3:141369237-141369259 TGGTATTTTCACACTTAACCTGG 0: 1
1: 0
2: 1
3: 4
4: 105
963078457_963078458 -7 Left 963078457 3:141369201-141369223 CCTGTTCTAGGCAAATACGTGTC 0: 1
1: 0
2: 0
3: 8
4: 51
Right 963078458 3:141369217-141369239 ACGTGTCCTGTGCCATCAAATGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963078457 Original CRISPR GACACGTATTTGCCTAGAAC AGG (reversed) Intronic
905438306 1:37975159-37975181 GGAAAGTATTTGGCTAGAACTGG + Intronic
913184287 1:116354481-116354503 GACAAGTGTTTGCCTAGGGCTGG - Intergenic
916435785 1:164776566-164776588 GACAAGTATTTCCCTAGAAAAGG - Intronic
922529063 1:226329192-226329214 GACCAGTGTTTGCCTAGTACTGG - Intergenic
1065825190 10:29564273-29564295 GACTCGTATTTGACAAGAAGAGG + Intronic
1068225853 10:54106102-54106124 GACTGGTAGTTGCCTAGGACTGG + Intronic
1071224357 10:83510140-83510162 TACAGGTAGTTGCCTAAAACAGG + Intergenic
1075978804 10:126719674-126719696 GACACGTGTTTGCCAAGTAAGGG + Intergenic
1095529814 12:43173673-43173695 GACATGTGTTTGCCTAGAATGGG + Intergenic
1100803213 12:98254733-98254755 GACACGTCTTTGCTTTGAATGGG + Intergenic
1110372441 13:74755017-74755039 AACACGTATGTGCGTAGAAGAGG + Intergenic
1115513914 14:34166343-34166365 GACAAGTATTTGCCTTGTGCTGG - Intronic
1122488380 14:102096511-102096533 GACACGTATTTGCCTGGAGAAGG - Intronic
1127175812 15:56355125-56355147 GATAGATGTTTGCCTAGAACTGG - Intronic
1127596903 15:60493896-60493918 GACACTTAGTAGCCTAGAAGCGG + Intronic
1157446796 18:47752405-47752427 AACAGGCAATTGCCTAGAACAGG + Intergenic
1157788791 18:50511134-50511156 GTCATGTGTTTGCCTAGAAGGGG + Intergenic
1165228104 19:34368338-34368360 GACCCATATATGCCTAGGACAGG - Intronic
930716476 2:54598138-54598160 TAGACATATTTGCCCAGAACTGG - Intronic
931165453 2:59742328-59742350 GACAAGGATTTGCTTAGAAAGGG + Intergenic
948152785 2:235757502-235757524 GACATGGATCTGCCTAGACCAGG - Intronic
1169262204 20:4147514-4147536 GACACCTAGTTGCCTTGGACTGG - Intronic
1175502141 20:59458164-59458186 GACATGTAGTTGCCTGGGACTGG + Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1179167839 21:38948410-38948432 GTCAAGTACTTGCCTAGCACGGG - Intergenic
1183233575 22:36598676-36598698 GACACCTATTTGACTATATCTGG + Intronic
1184618252 22:45652934-45652956 GATTTGTATTTGCCTAGAGCTGG - Intergenic
953586846 3:44209276-44209298 GACTGGTAGTTGCCTAGAGCTGG + Intergenic
959907709 3:111729103-111729125 CACTCATTTTTGCCTAGAACTGG + Intronic
962445910 3:135464901-135464923 AAGACGTATTTGCCTAGCTCAGG - Intergenic
963078457 3:141369201-141369223 GACACGTATTTGCCTAGAACAGG - Intronic
973066185 4:45796051-45796073 GAGGCATATTTGCCTAAAACAGG + Intergenic
980846372 4:138330008-138330030 GACATGCATTTGCCTACAGCTGG + Intergenic
986662662 5:10073320-10073342 TACTCGTATTTGCCTCTAACGGG - Intergenic
991471457 5:66973481-66973503 TAAACATATTTGCCAAGAACAGG + Intronic
996949866 5:129112585-129112607 GACATATATGTGCCCAGAACAGG - Intronic
1004620941 6:17329752-17329774 GATACGTATTTTTCTAAAACAGG - Intergenic
1010619568 6:78057534-78057556 AAAAGGTATTTGCCTAAAACAGG - Intergenic
1011153099 6:84297525-84297547 GACATTTTTTTTCCTAGAACAGG + Intergenic
1013900787 6:115154173-115154195 AACACGTATGTGCCTAACACTGG - Intergenic
1018259903 6:161959723-161959745 GACATATATTTCCCGAGAACAGG + Intronic
1019315029 7:380350-380372 GACACGAATTGGCCTATAACAGG + Intergenic
1028725020 7:94076808-94076830 GACACCTATTTGCCTATGTCAGG + Intergenic
1028865842 7:95710579-95710601 GAGATGAATTTACCTAGAACAGG + Intergenic
1030410838 7:109178253-109178275 GACACATATTTGGCAAGAGCAGG - Intergenic
1032508733 7:132455272-132455294 AACACGTATTTGCAGAGAACAGG + Intronic
1034687327 7:152984307-152984329 GACACATATTTGTCACGAACTGG - Intergenic
1037325992 8:17691482-17691504 GACAAGCATTTGCTAAGAACTGG - Intronic
1044118067 8:88358889-88358911 GACTGGTGTTTGCCTAGAGCTGG - Intergenic
1047063506 8:121253913-121253935 GTCAAGTATTTGCCTAGAATAGG - Intergenic
1048410861 8:134170903-134170925 CACATGTATTTGCCTTTAACTGG + Intergenic
1051666465 9:19471233-19471255 GACACAAATTTGGCTTGAACTGG - Intergenic
1059058951 9:111014853-111014875 GACACAGTTTAGCCTAGAACAGG - Intronic
1186719890 X:12291990-12292012 AACACGTATTTGCCAAGCACAGG - Intronic
1187329983 X:18328970-18328992 GACCTGTGTTTGCCTAGAGCTGG + Intronic
1187788565 X:22921758-22921780 GTCACGACTTTGCATAGAACAGG + Intergenic
1187973251 X:24679600-24679622 GACATTTATTTGCTTGGAACTGG - Intergenic
1192093292 X:68183519-68183541 GACACTTATTGGCCTAGAAATGG + Intronic
1194107948 X:89794336-89794358 GAAATGTATTTGGCTAGAGCTGG - Intergenic
1200459898 Y:3442121-3442143 GAAATGTATTTGGCTAGAGCTGG - Intergenic