ID: 963078788

View in Genome Browser
Species Human (GRCh38)
Location 3:141372199-141372221
Sequence ACATTAGGATGGAGCTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963078778_963078788 0 Left 963078778 3:141372176-141372198 CCTAGCCTCTGCCCAGTCCCCTT 0: 1
1: 1
2: 6
3: 101
4: 731
Right 963078788 3:141372199-141372221 ACATTAGGATGGAGCTGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 198
963078777_963078788 13 Left 963078777 3:141372163-141372185 CCTGTTATGGCTGCCTAGCCTCT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 963078788 3:141372199-141372221 ACATTAGGATGGAGCTGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 198
963078776_963078788 21 Left 963078776 3:141372155-141372177 CCTACTCTCCTGTTATGGCTGCC 0: 1
1: 0
2: 0
3: 14
4: 121
Right 963078788 3:141372199-141372221 ACATTAGGATGGAGCTGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 198
963078774_963078788 26 Left 963078774 3:141372150-141372172 CCTGGCCTACTCTCCTGTTATGG 0: 1
1: 0
2: 0
3: 12
4: 144
Right 963078788 3:141372199-141372221 ACATTAGGATGGAGCTGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 198
963078779_963078788 -5 Left 963078779 3:141372181-141372203 CCTCTGCCCAGTCCCCTTACATT 0: 1
1: 0
2: 4
3: 37
4: 302
Right 963078788 3:141372199-141372221 ACATTAGGATGGAGCTGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963078788 Original CRISPR ACATTAGGATGGAGCTGAGG AGG Intronic
900074769 1:804604-804626 AGAGTAGGATGGAGCACAGGAGG - Intergenic
901527709 1:9834563-9834585 ACACTGGGATGGAGCAGTGGCGG + Intergenic
903283651 1:22264144-22264166 ACAGGAGGATGGTGCTGCGGGGG + Intergenic
903297094 1:22350792-22350814 ACAGAAGGATGGAGCTGAGCAGG + Intergenic
903356298 1:22749859-22749881 ACAAAAGGATGGGGATGAGGAGG + Intronic
903463404 1:23534922-23534944 ACATGGGGATGGAGGGGAGGAGG - Intergenic
905453582 1:38072738-38072760 TGATTAGGTTGGAGCTGAGGTGG - Intergenic
906119891 1:43382409-43382431 GCATTAGGATTGAGCTGGAGGGG - Intergenic
906711369 1:47932466-47932488 AAATAAGGCAGGAGCTGAGGAGG + Intronic
907804484 1:57804579-57804601 ACATAAGGGTGCAGCTTAGGAGG - Intronic
909988285 1:82189579-82189601 CCATTAGGCTGGTGATGAGGAGG - Intergenic
912699859 1:111869346-111869368 AAATTTGGATGAAGGTGAGGAGG - Intronic
914829519 1:151160536-151160558 AGATGAGGAAGAAGCTGAGGGGG + Exonic
916066294 1:161138590-161138612 GCATCAGGATAGAGCTGAAGGGG - Intergenic
916500275 1:165380979-165381001 ACAGCAGGATGGTGCTGTGGGGG + Intergenic
916588108 1:166165895-166165917 GCAGTAGGAAGGAGCTGGGGAGG + Intronic
917716066 1:177739334-177739356 ACTTTAGGATGAAGATGATGTGG + Intergenic
918045913 1:180941017-180941039 ACACAAGGGTGGAGGTGAGGGGG - Intronic
918628326 1:186684257-186684279 ATACTCTGATGGAGCTGAGGGGG - Intergenic
919735819 1:200949795-200949817 ACCTGATGATGGAGCTGAAGAGG - Intergenic
920440904 1:205979775-205979797 ACATTGGCATGGACCTGAGCAGG + Intronic
922079696 1:222283823-222283845 ACAGGAGGATGGAGCTGGAGAGG + Intergenic
922270613 1:224029509-224029531 AGAGTAGGATGGAGCACAGGAGG - Intergenic
1063105739 10:2989989-2990011 AAAGTAGGCTGGTGCTGAGGAGG + Intergenic
1066653415 10:37680031-37680053 AGATTAGGATGGAGCTGGCGGGG - Intergenic
1067037783 10:42932570-42932592 AGATTAGGATGGAGCTGGTGGGG - Intergenic
1067429059 10:46230951-46230973 ACATAAGGATGGAAATAAGGTGG + Intergenic
1067707894 10:48624545-48624567 ACATTGGGATGGAGCTTAAATGG - Intronic
1068569252 10:58610459-58610481 AGATTATGATGGAGGTTAGGGGG - Intronic
1070545935 10:77452448-77452470 ACATTTGGGTGGTGATGAGGAGG + Intronic
1070805242 10:79266968-79266990 ACAGTGGAATGGGGCTGAGGAGG + Intronic
1071398245 10:85244193-85244215 ACTTTATGCTGGTGCTGAGGAGG - Intergenic
1073193081 10:101666096-101666118 GCATTAGGAAGAAACTGAGGAGG + Intronic
1073266554 10:102231320-102231342 ACAGTAGGATGGGGTTGAGGAGG + Intronic
1075382890 10:122033185-122033207 ACGTTAGGAAGGGGCTGAGAGGG - Intronic
1076210509 10:128639885-128639907 AGAATAAGATGGAGGTGAGGTGG + Intergenic
1087286176 11:96267212-96267234 ACATTATAATGGAGATGAGCTGG + Intronic
1087522377 11:99256959-99256981 ACATTATGATGGTGCTAAGGAGG + Intronic
1087645162 11:100800414-100800436 AGATTAGGATGTAGCTGAGCTGG + Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1099670758 12:85688939-85688961 ACCTGAGGATGGAGTAGAGGAGG + Intergenic
1101708449 12:107242667-107242689 ATAGTAGGATGGGGATGAGGTGG - Intergenic
1106853560 13:33821342-33821364 ACATTAGGAAGCAACTGAGTTGG - Intronic
1107373073 13:39773130-39773152 GCATTAGGATGGAGGGAAGGTGG - Intronic
1107962906 13:45574793-45574815 ACATTTGGAGGAAGCTGGGGGGG + Intronic
1108609717 13:52072342-52072364 ACTGTAGAATGGAGCTGAAGTGG - Intronic
1110149950 13:72239137-72239159 AGAATAGGATGGACCTGAGGAGG - Intergenic
1114548778 14:23521726-23521748 ACATCTGCAAGGAGCTGAGGAGG + Exonic
1116131143 14:40856538-40856560 ATATTAGGAGGAAGCTGAAGTGG + Intergenic
1116877214 14:50123997-50124019 TAATTAGAATGGAGATGAGGAGG + Intronic
1125764160 15:42121916-42121938 AGATCAGGGTGGAGCTGAGGGGG + Intergenic
1126026137 15:44448010-44448032 ACATCCGGATGGAACTGGGGTGG - Intronic
1126289956 15:47063331-47063353 ATTGTAGGATGCAGCTGAGGTGG + Intergenic
1126950633 15:53876725-53876747 ACAATAAGATGGAGATGAGTGGG - Intergenic
1127299076 15:57634858-57634880 ACATTAGTATTGACCAGAGGGGG + Intronic
1127859053 15:62978028-62978050 AAATTCTGATGGAGCAGAGGAGG + Intergenic
1128152903 15:65374513-65374535 ACATTAGCATGAAGGTGAGTAGG + Intronic
1129834311 15:78692331-78692353 CCATTAGGGTGGGGGTGAGGGGG + Intronic
1130085666 15:80777044-80777066 GCACAAGGATGTAGCTGAGGGGG + Intergenic
1131426268 15:92347740-92347762 ACAGTAGAATGGTGCTGAGAAGG + Intergenic
1135498019 16:22969589-22969611 ACATTAAGCTGAAGCTGAAGTGG - Intergenic
1141894019 16:86947057-86947079 ACAGCAGGATGGAGATGATGAGG - Intergenic
1141928086 16:87182343-87182365 ACATGGGGATGGTGATGAGGAGG - Intronic
1142964390 17:3571730-3571752 CCATCAGGATGGAGATGTGGTGG + Intronic
1144416592 17:15053600-15053622 AGTTTAGGATGGAGGAGAGGAGG - Intergenic
1144503427 17:15808850-15808872 ACTTTAGGAAGTAGCTGAGCTGG - Intergenic
1145166473 17:20616563-20616585 ACTTTAGGAAGTAGCTGAGCTGG - Intergenic
1146495762 17:33320536-33320558 AGGTTAGTATGGAGTTGAGGTGG + Intronic
1147309195 17:39584278-39584300 ACTTTGGGAGGGGGCTGAGGGGG + Intergenic
1150051210 17:61965015-61965037 ACATCAGGATGCGGCTGAGTGGG + Exonic
1150213254 17:63453151-63453173 GCATAAGGATGGAGTAGAGGAGG - Intergenic
1151186998 17:72371878-72371900 ACATTAGAAAGGAGGTGATGTGG + Intergenic
1153039490 18:798555-798577 AAATTAGGGTGGAGCTAAAGCGG - Intronic
1153040205 18:805678-805700 ACATTTGGAAGGAGCAGAGAAGG - Intronic
1153938994 18:9960654-9960676 ACAGTAGTATGGAGATGAGGTGG + Intergenic
1156354140 18:36327094-36327116 AATTTAGGAAGCAGCTGAGGAGG + Intronic
1157491692 18:48127999-48128021 ACATAAAGATGGAGCTTACGGGG - Intronic
1157663896 18:49469337-49469359 TCATCAGAATGGAGCAGAGGAGG + Intergenic
1158090807 18:53710874-53710896 ATATTTAGCTGGAGCTGAGGGGG + Intergenic
1158783209 18:60677036-60677058 AGATTAGGAGGGGGCTTAGGTGG + Intergenic
1160688756 19:450509-450531 AAAGTAGGATGGGGCTGGGGAGG - Intronic
1162202202 19:9028651-9028673 AGGTGAGGATGGAGCTGAGCTGG + Intergenic
1166373575 19:42315213-42315235 AGATGAGGATGAAGATGAGGAGG - Exonic
1168018959 19:53594972-53594994 ACACTAGGATCGCACTGAGGAGG - Intergenic
925494569 2:4432528-4432550 ACATTATAATGGCGATGAGGGGG - Intergenic
927491722 2:23525562-23525584 GCAGTGGGATGGAGCTAAGGGGG + Intronic
929666968 2:43840776-43840798 GGAGTGGGATGGAGCTGAGGGGG - Intronic
931088299 2:58859093-58859115 ACATTTGGAAAGAGGTGAGGAGG + Intergenic
932129204 2:69172334-69172356 ACATTAGGAAGGAGATTAGGTGG - Intronic
932239777 2:70147481-70147503 ACACTGGGCTGGAGCTGATGTGG - Intergenic
933758812 2:85660945-85660967 ACCTTAGGATGGAGGGGTGGAGG - Intronic
938303076 2:130229732-130229754 GGATGAGGATGGAGCAGAGGAGG + Intergenic
938453595 2:131444494-131444516 GGATGAGGATGGAGCGGAGGAGG - Intergenic
938931758 2:136092781-136092803 ACTTTAGGAGGAAGATGAGGAGG + Intergenic
941278186 2:163517134-163517156 ACAGTAGCCTGGAGGTGAGGAGG + Intergenic
942023201 2:171887091-171887113 ACAGTAGCCTGGAGCTGAGAAGG - Intronic
944352702 2:198747687-198747709 ACAGTTGGTTGGAGCTGAGTAGG + Intergenic
945103832 2:206289425-206289447 CCATCAGGCTGGAGCTGAAGTGG - Intronic
946607369 2:221420455-221420477 ACATTTAGACGGAACTGAGGAGG + Exonic
947979493 2:234396955-234396977 ACACTAGGTTGGAGCTGGGATGG + Intergenic
948670253 2:239563950-239563972 ACAGTAGGAGAGAGCTGAGAGGG - Intergenic
948853755 2:240720707-240720729 ACACTAGGATGGAGCTGGCGGGG + Intronic
1168898584 20:1340996-1341018 ACTTTAAGATGGTGCTGATGGGG + Intronic
1170352161 20:15453657-15453679 AGCTTAGGAAGGGGCTGAGGTGG + Intronic
1170740463 20:19051522-19051544 ACACTGGGAAGGAGCTGAGAGGG - Intergenic
1171153513 20:22849112-22849134 ACATTATAATGGACCAGAGGAGG + Intergenic
1171539729 20:25938763-25938785 ATGGTAGGATGCAGCTGAGGTGG - Intergenic
1171801315 20:29621502-29621524 ATTGTAGGATGCAGCTGAGGTGG + Intergenic
1171842656 20:30233991-30234013 ATTATAGGATGCAGCTGAGGTGG - Intergenic
1172023754 20:31934313-31934335 ACTGTGGGATGGAGCTGGGGAGG - Intronic
1173040543 20:39458392-39458414 AGATGAGGATGGAGGAGAGGAGG + Intergenic
1174846519 20:53948484-53948506 ACATGTGGCTGGTGCTGAGGAGG + Intronic
1177557886 21:22715360-22715382 GCATTAGTATGGCGCTGGGGGGG + Intergenic
1178145231 21:29731877-29731899 AATTTATGATGGAGCTTAGGTGG - Intronic
1179489621 21:41732613-41732635 ACTCTAGGATGGAGCTGGAGAGG - Intergenic
1180783730 22:18535594-18535616 ACCTTAGGGTGGAGGTGGGGTGG + Intergenic
1181746992 22:24962388-24962410 GGATTGGCATGGAGCTGAGGGGG + Intronic
1182575588 22:31270853-31270875 ACATTAGGAGAGAGCTGTGAGGG + Intronic
1182850052 22:33466055-33466077 AAATTAGGATGGAAATGAGCGGG - Intronic
1183723130 22:39573748-39573770 ACCTGAGGATGGAGGTGAGAGGG - Intronic
1183758412 22:39792393-39792415 ACAATAGCATGTAACTGAGGAGG - Intronic
1184093798 22:42305815-42305837 GCATGAGGATGGAGATGGGGTGG - Intronic
949834229 3:8250644-8250666 AGATTGAGATGGAGGTGAGGTGG + Intergenic
949834240 3:8250721-8250743 AGATTGAGATGGAGGTGAGGTGG + Intergenic
949834250 3:8250798-8250820 AGATTGAGATGGAGGTGAGGTGG + Intergenic
949917207 3:8974423-8974445 CCATGTGGCTGGAGCTGAGGGGG - Intergenic
950400128 3:12763427-12763449 ACCTCAGGATGGAGTTGAGCTGG - Intronic
952192089 3:31034632-31034654 ACATGAGGGTGGAGTAGAGGTGG - Intergenic
953055960 3:39387415-39387437 TCATTAGGATGGATCAGTGGAGG + Intronic
954063402 3:48088169-48088191 ACATTAGGGTGGGGGTGGGGAGG - Intronic
959360733 3:105387842-105387864 ACATTAGGCTACAGCTGAGTGGG + Intronic
961210810 3:125124068-125124090 ACATTAGGATGCTGCTCAGTGGG + Intronic
962386291 3:134935150-134935172 GCACTGGGATGGAGCTGAGGAGG + Intronic
962885766 3:139625584-139625606 ACACTAGAATAAAGCTGAGGGGG - Intronic
963078788 3:141372199-141372221 ACATTAGGATGGAGCTGAGGAGG + Intronic
963187337 3:142433660-142433682 ACATTAAGATGGAACTGAAATGG + Intronic
963303003 3:143619941-143619963 ACATTAGGAAGTGGCAGAGGTGG + Intronic
963416159 3:144998591-144998613 ACCTTTGGATGGAGCTTTGGTGG + Intergenic
966090005 3:176122266-176122288 GCATTAGCAGGGAGTTGAGGAGG - Intergenic
966103859 3:176311205-176311227 ACATTAGGCTAGAAATGAGGAGG + Intergenic
968700871 4:2057875-2057897 ACATGAAGATGACGCTGAGGCGG - Intergenic
976471443 4:85433824-85433846 ACAGTGGGATGGGGCTGAGAGGG + Intergenic
977001916 4:91515353-91515375 ACTTGAGGATGGAGGTTAGGAGG - Intronic
977578625 4:98700984-98701006 ACATAAGGATGGAGGAGATGAGG - Intergenic
980514958 4:133844924-133844946 ACATTATGATGGTACTGAAGAGG - Intergenic
985133357 4:186760819-186760841 ATACTGGGATGGAGCGGAGGAGG + Intergenic
986264452 5:6180656-6180678 CCATCAGGATGGAGGGGAGGAGG - Intergenic
986264583 5:6181148-6181170 TCCTCAGGATGGAGGTGAGGAGG - Intergenic
986903332 5:12463945-12463967 ACATGAGGATGGAGGCCAGGAGG + Intergenic
989237292 5:39163397-39163419 AAATTAGAATGGAGGTGAAGAGG + Intronic
992175518 5:74145753-74145775 AAATTAGGAGGAATCTGAGGGGG + Intergenic
997664659 5:135620315-135620337 TCATGGGGATGGAGCTGAGCTGG + Intergenic
997991311 5:138546545-138546567 ACATAATGTTTGAGCTGAGGAGG - Intergenic
998062810 5:139132533-139132555 ACAAGAACATGGAGCTGAGGTGG + Intronic
999112821 5:149136967-149136989 GCAGAAGGAAGGAGCTGAGGTGG - Intergenic
999229402 5:150052747-150052769 ACATTTGGGGGAAGCTGAGGAGG + Exonic
999262507 5:150246387-150246409 ACAGTAGGCTGGAGCTGAGAGGG - Intronic
999587473 5:153106930-153106952 ACATTACGATGGTGCTGAAGGGG - Intergenic
1000216462 5:159161947-159161969 AAATTAAGATGGAGTTGATGAGG - Intronic
1000407110 5:160899899-160899921 TCTTGAGGGTGGAGCTGAGGAGG - Intergenic
1001701830 5:173712396-173712418 TCATCAGGATGGAGTTGGGGAGG - Intergenic
1002166887 5:177353303-177353325 ACAATAGGCTGGAGCTGAATGGG + Intergenic
1003486889 6:6587836-6587858 ACATTAAGGTGAAGCTGGGGCGG + Intergenic
1004985116 6:21072860-21072882 ACATTAGGATTGATCCTAGGTGG + Intronic
1005715923 6:28548339-28548361 ACATCAGGAACAAGCTGAGGAGG - Intergenic
1005954716 6:30655933-30655955 ACATTTAGATGTAGCTGTGGAGG - Intronic
1011777441 6:90747822-90747844 AGAATAGGATGGAGGTTAGGTGG + Intergenic
1012942472 6:105429817-105429839 ACATTAGGATGGAGCCTCTGTGG - Intergenic
1013023782 6:106248689-106248711 ACTTTAGGAGGAGGCTGAGGCGG + Intronic
1015973890 6:138769801-138769823 ACAGTAGGTGGGAGCTCAGGTGG + Intronic
1016801328 6:148172152-148172174 ACAGTGGGATGGTGCTGAGTGGG - Intergenic
1016986591 6:149900167-149900189 AGCTGTGGATGGAGCTGAGGTGG - Intergenic
1017034070 6:150251320-150251342 AGTATAGGCTGGAGCTGAGGGGG - Intergenic
1019608996 7:1926848-1926870 ACCTTAGTATGGTGCTGAGTAGG - Intronic
1019920618 7:4161105-4161127 AGATTTGGAGGGAGCAGAGGAGG + Intronic
1020555890 7:9669877-9669899 GCATGGGGGTGGAGCTGAGGTGG - Intergenic
1020783310 7:12542614-12542636 ACATTAGGAGGAGGCTGAGGTGG - Intergenic
1022098186 7:27153791-27153813 ACCCCAGGATGGAGCTGAGCAGG + Exonic
1023703815 7:42918582-42918604 AGATTAGGAAGGAGCTAGGGAGG - Intronic
1023918217 7:44606625-44606647 TCATTCGGGTGGAGCTGAGCCGG + Exonic
1023986344 7:45099361-45099383 ACAGTGGGGTGGAGCTGAGATGG - Intergenic
1027182383 7:75949969-75949991 ACAGGAGGAGGGAGGTGAGGTGG - Intronic
1027714959 7:81658786-81658808 AGATTAGCATGGAAGTGAGGAGG + Intergenic
1027744480 7:82056346-82056368 ACATGAGGATGGACCTATGGAGG + Intronic
1027982057 7:85237313-85237335 ACATTAGGATTTACTTGAGGTGG + Intergenic
1032773970 7:135090745-135090767 CCCTTAGGGTGGAGCTTAGGTGG - Intronic
1034473333 7:151268307-151268329 ACAATCGGGTGGAGCTGAGGAGG + Intronic
1035332577 7:158105911-158105933 ACAGTAGTATGGAGATGAGATGG - Intronic
1035540875 8:436880-436902 AGAGTAGGATGGAGCACAGGAGG + Intronic
1038847315 8:31242374-31242396 ACATGAGGAAGGAGTTGAGGTGG + Intergenic
1039221577 8:35337214-35337236 ATATTGGGAAGGAGGTGAGGGGG - Intronic
1040452303 8:47560361-47560383 ACACAAGGATGGAGCTGGTGAGG - Intronic
1041009665 8:53529522-53529544 ACATGTGGATGGAACTGCGGCGG - Intergenic
1041949269 8:63482253-63482275 AGCTAAGGATGGAGCTGAGTTGG + Intergenic
1042485364 8:69340857-69340879 ACACTAGGATGGAGCAGGTGCGG + Intergenic
1043130382 8:76453176-76453198 ACATTAGGATAGAGCATATGTGG + Intergenic
1044518919 8:93175387-93175409 AGAGAAGGATGGGGCTGAGGTGG + Intergenic
1044905338 8:96994993-96995015 CTATGAGGATGGAGCAGAGGAGG + Intronic
1046410444 8:113834999-113835021 AAATTAGGATGAAGCTTAAGTGG - Intergenic
1047571326 8:126101662-126101684 ACATTAGATGGAAGCTGAGGAGG - Intergenic
1048413913 8:134205097-134205119 GCATGAGGATGGAGCTCAAGTGG - Intergenic
1048977440 8:139680777-139680799 ACACTAGGATGGAACCCAGGCGG + Intronic
1051162599 9:14225088-14225110 AGAGTAGAATGGTGCTGAGGTGG - Intronic
1053580870 9:39403155-39403177 ACATTAGGGTGGAGGATAGGAGG + Intergenic
1054102456 9:60961959-60961981 ACATTAGGGTGGAGGATAGGAGG + Intergenic
1054165330 9:61720672-61720694 ATTATAGGATGCAGCTGAGGTGG + Intergenic
1054583902 9:66944910-66944932 ACATTAGGGTGGAGGATAGGAGG - Intergenic
1054769853 9:69073533-69073555 ACAAAATCATGGAGCTGAGGAGG + Exonic
1056203142 9:84295746-84295768 ACAGTAGGATGAGGCTGAGGAGG - Intronic
1058035575 9:100248985-100249007 ACTTTGGGAAGAAGCTGAGGTGG - Intronic
1058261300 9:102835895-102835917 ACATTAGAATGAGGCTGTGGAGG + Intergenic
1060611282 9:124967510-124967532 ACAAAATCATGGAGCTGAGGAGG - Intronic
1061890114 9:133614848-133614870 AGATTTGGATGGGGGTGAGGAGG + Intergenic
1062189512 9:135240617-135240639 ACATTGGGATGGAGCAGAGATGG - Intergenic
1192633317 X:72793375-72793397 ACATGAAGATGGAGCTGGTGGGG - Intronic
1192648392 X:72927426-72927448 ACATGAAGATGGAGCTGGTGGGG + Intronic
1196482554 X:116166455-116166477 ATATTGGGATGGAGATGAAGAGG + Intergenic
1196574826 X:117305344-117305366 ACTGTAGGATGGAGCAGAGCTGG - Intergenic
1196601567 X:117606797-117606819 AAATTATGATTGAGATGAGGAGG + Intergenic