ID: 963080006

View in Genome Browser
Species Human (GRCh38)
Location 3:141382739-141382761
Sequence GAACCTAGGATGCCACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963080006_963080009 -8 Left 963080006 3:141382739-141382761 CCAGCTGGTGGCATCCTAGGTTC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 963080009 3:141382754-141382776 CTAGGTTCCCACAGTTCCCAGGG 0: 1
1: 0
2: 2
3: 11
4: 147
963080006_963080019 27 Left 963080006 3:141382739-141382761 CCAGCTGGTGGCATCCTAGGTTC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 963080019 3:141382789-141382811 AGGCTGATTCATATGAACAGAGG 0: 1
1: 0
2: 1
3: 6
4: 142
963080006_963080013 0 Left 963080006 3:141382739-141382761 CCAGCTGGTGGCATCCTAGGTTC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 963080013 3:141382762-141382784 CCACAGTTCCCAGGGCCTGGAGG 0: 1
1: 0
2: 4
3: 50
4: 418
963080006_963080010 -3 Left 963080006 3:141382739-141382761 CCAGCTGGTGGCATCCTAGGTTC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 433
963080006_963080014 1 Left 963080006 3:141382739-141382761 CCAGCTGGTGGCATCCTAGGTTC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 963080014 3:141382763-141382785 CACAGTTCCCAGGGCCTGGAGGG 0: 1
1: 0
2: 6
3: 46
4: 426
963080006_963080008 -9 Left 963080006 3:141382739-141382761 CCAGCTGGTGGCATCCTAGGTTC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 963080008 3:141382753-141382775 CCTAGGTTCCCACAGTTCCCAGG 0: 1
1: 0
2: 2
3: 22
4: 183
963080006_963080015 7 Left 963080006 3:141382739-141382761 CCAGCTGGTGGCATCCTAGGTTC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 963080015 3:141382769-141382791 TCCCAGGGCCTGGAGGGTAGAGG 0: 1
1: 0
2: 10
3: 100
4: 817

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963080006 Original CRISPR GAACCTAGGATGCCACCAGC TGG (reversed) Intronic
906831573 1:49037352-49037374 GAAGGTAAGCTGCCACCAGCAGG + Intronic
910826315 1:91411209-91411231 GAATCTAGGATTCCAACAACTGG + Intergenic
915160810 1:153919236-153919258 TTACCTAGGTTGCCATCAGCTGG - Intronic
1063135268 10:3210707-3210729 GAACATAGCATGCCACTGGCTGG - Intergenic
1065833966 10:29640439-29640461 GAAGGTAGGATGATACCAGCAGG - Intronic
1069543920 10:69315897-69315919 GAACCTGGGATGCCACAGGTGGG - Intronic
1069892871 10:71662787-71662809 TTTCCTAGGGTGCCACCAGCTGG + Intronic
1072022087 10:91411829-91411851 AAACCTAGGGTACCAGCAGCAGG - Intronic
1076599514 10:131647826-131647848 GCACCTAGGATGAGACCTGCCGG - Intergenic
1076739803 10:132477584-132477606 GAAGCTCGGACGGCACCAGCAGG - Intergenic
1078485902 11:11723017-11723039 GAACCTAGGTCGCCACCAGAGGG + Intergenic
1080707211 11:34707633-34707655 TGACCTAGGAAGACACCAGCTGG - Intergenic
1085980450 11:81718174-81718196 CAACCTAGTAAGACACCAGCTGG + Intergenic
1088067096 11:105732630-105732652 GAAGCTAGGATTCTACCAGCTGG + Intronic
1088778970 11:113115092-113115114 GCTCCCAGGATGCTACCAGCTGG - Intronic
1090570379 11:128038439-128038461 GAAACGGGGATGCCACCAGGTGG - Intergenic
1094323109 12:29206921-29206943 CCAAATAGGATGCCACCAGCCGG + Intronic
1096639233 12:52980994-52981016 GCACCTAGAAGGCCACCAGGGGG - Intergenic
1099703769 12:86123716-86123738 GAACCAAGGATGCCACGTCCAGG - Intronic
1103928140 12:124435054-124435076 GAACCTGGCAGGCCAGCAGCAGG - Intronic
1105510236 13:21045681-21045703 GAACGCAGGATGCGACCAGGTGG - Exonic
1105842338 13:24265635-24265657 GAACCAAGGCTGCCACGGGCTGG - Intronic
1113777835 13:112958789-112958811 GAACCTGGAATCCCACCAGGAGG - Intronic
1115078710 14:29423308-29423330 GAACCTATGTTGACAACAGCAGG - Intergenic
1117340968 14:54790858-54790880 CAGCCTTGGATGCCACCACCAGG + Exonic
1118813192 14:69290399-69290421 GAACCCAGGCTGCCTGCAGCTGG + Intronic
1121407108 14:93725790-93725812 GAACCTTGGCTGCTGCCAGCCGG - Intronic
1123032047 14:105456522-105456544 GGACCAGGGATCCCACCAGCTGG + Intronic
1129189674 15:73930077-73930099 GCACCTAGGATGCTACCTTCAGG - Intronic
1134806463 16:17130121-17130143 GAGCCTAGGATGGCTTCAGCTGG - Intronic
1148491254 17:48025249-48025271 GATCCTATGGTGCCACCTGCAGG - Intergenic
1148664890 17:49367043-49367065 GAACCTAGGAGGCCATGACCAGG - Intergenic
1154170421 18:12047082-12047104 CAACCTTTGCTGCCACCAGCAGG + Intergenic
1161606570 19:5218380-5218402 GTACCAGGGATGCCACCAACAGG - Intronic
1166955954 19:46464973-46464995 GAGCTGTGGATGCCACCAGCAGG - Intergenic
1167744591 19:51343006-51343028 GAACCTTGGATGTCTCCAGAGGG - Intergenic
930723868 2:54664054-54664076 CAACCAAGGATGCCACCAGAAGG - Intronic
937111652 2:119371240-119371262 GAGCCTACGATGCCAGCGGCAGG - Intronic
942838931 2:180336542-180336564 GAACCTAGGATCCAAGCTGCTGG + Intergenic
945239248 2:207661115-207661137 GAGCCTAGGAGGCCAGCTGCAGG + Intergenic
1171354685 20:24534696-24534718 GGACCTAGGTGACCACCAGCAGG - Intronic
1172632023 20:36385060-36385082 CAACTTAGCATGCCCCCAGCAGG - Intronic
1183746655 22:39695619-39695641 GAACCGAAGATGCCACCCTCTGG + Intergenic
1184216273 22:43069443-43069465 GAAACTAGGATGCCACACTCAGG + Intronic
1184495682 22:44839924-44839946 GATCCTAGCCAGCCACCAGCTGG - Intronic
951193783 3:19802270-19802292 GAACCTGGGATTCAATCAGCTGG - Intergenic
954573751 3:51663295-51663317 GACCGTAGGAGGCCACCAGCTGG - Exonic
955973255 3:64456912-64456934 GAACCAATGATGCCAAGAGCTGG + Intergenic
956285340 3:67602956-67602978 GAACCAAAGAGGCCAACAGCAGG + Intronic
956354177 3:68372574-68372596 TAGCCTAGCATGCAACCAGCAGG + Intronic
957163263 3:76637210-76637232 CAACCTAAGAGGCAACCAGCAGG + Intronic
957450585 3:80377074-80377096 GAACCCAGGATGCCAGAAGGCGG - Intergenic
957992538 3:87645413-87645435 GTTCCTTGGATCCCACCAGCAGG - Intergenic
959705144 3:109332535-109332557 CAACCTCCGATGCCACCACCTGG - Intronic
960592750 3:119381257-119381279 GAACCAAGAATGCCACCAAGAGG - Intronic
963080006 3:141382739-141382761 GAACCTAGGATGCCACCAGCTGG - Intronic
968953549 4:3706946-3706968 GAGGCTTGGATGGCACCAGCCGG + Intergenic
969857752 4:10013932-10013954 GAACAAAGGCTGCCACCAGGGGG - Intronic
972710429 4:41589598-41589620 GAACCTGGGAAGCCAGCAACAGG - Intronic
975314310 4:72933605-72933627 CAACCTAGGGAGACACCAGCTGG - Intergenic
975847196 4:78537191-78537213 GAACTTAGCATACCAACAGCAGG - Intronic
982225557 4:153162827-153162849 GAACCCAAGATGCCACCTGAGGG + Intronic
982797095 4:159659253-159659275 GACCCTGGGATGCCAATAGCAGG - Intergenic
983894843 4:173070863-173070885 GAACCTAGGATCCCAGGTGCTGG + Intergenic
984656461 4:182323970-182323992 GAGCCTAAGTTGTCACCAGCAGG + Exonic
986631255 5:9775953-9775975 CAACCTAGGGAGACACCAGCTGG - Intergenic
987005288 5:13704068-13704090 GACCCAAGGATGCACCCAGCTGG + Intronic
989745353 5:44822346-44822368 CAACCTAAGATGCGACCAGTTGG - Intergenic
992981165 5:82174801-82174823 AGGCCTAGCATGCCACCAGCAGG + Intronic
995672800 5:114625812-114625834 GCATTTAGGATGCCACCATCAGG + Intergenic
997242147 5:132315393-132315415 GAACCGGGGATGCCACCACCTGG - Intronic
1002484322 5:179524123-179524145 GGACCTAGGATGCCACCCCAGGG + Intergenic
1002501721 5:179651396-179651418 GGACCTAGGATGCCACCCCAGGG + Intergenic
1005025327 6:21457794-21457816 GAACCTGAGATTCCAACAGCTGG - Intergenic
1005578015 6:27208206-27208228 GAACCTGGGATTCCAACTGCTGG - Intergenic
1007279143 6:40697470-40697492 GAAGCTTGAATGCCACCAGGAGG - Intergenic
1007814217 6:44509076-44509098 GAAGTTAGCATGCCACCAGTTGG + Intergenic
1009039427 6:58158802-58158824 CAACCTAGTAAGACACCAGCTGG - Intergenic
1013410104 6:109876323-109876345 GAACCTGGGATTCAAGCAGCTGG + Intergenic
1014188277 6:118460210-118460232 GGACTTAGGATGCCATCCGCAGG + Intergenic
1016775271 6:147897991-147898013 GAATGTAGGATGCCAGCTGCAGG + Intergenic
1023668452 7:42551218-42551240 GATCCTGGGATGTCATCAGCTGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028524431 7:91767969-91767991 GAACCTGGGATTCCAACTGCTGG - Intronic
1031098414 7:117448498-117448520 TGACCTAGGAAGACACCAGCTGG + Intergenic
1033783903 7:144706817-144706839 GAGACTAGGAAGCCACCTGCCGG + Intronic
1034425504 7:151011925-151011947 GTTCCTAGGCTGCCATCAGCTGG + Intronic
1037254776 8:16941443-16941465 TGACCTAGGAAGACACCAGCTGG + Intergenic
1041948867 8:63477619-63477641 GCAGCTAGGAAGCCACCTGCTGG + Intergenic
1042898311 8:73695106-73695128 CAACCTAGGGAGACACCAGCTGG + Intronic
1044697385 8:94936793-94936815 GAACCCAGGATGGCACCTCCAGG - Intronic
1046384164 8:113487019-113487041 TGACCTAGGAAGACACCAGCTGG - Intergenic
1048507556 8:135034729-135034751 GCACCTCTGATGCCACCCGCCGG + Intergenic
1049555879 8:143281774-143281796 AAGCCTAGCATGGCACCAGCTGG + Intergenic
1054916048 9:70496334-70496356 GAACCTATGTTGCCACCACTTGG - Intergenic
1054916258 9:70497766-70497788 AAACATTGGATGCCACCAACAGG - Intergenic
1057282331 9:93721795-93721817 GAACCTTGCCTGGCACCAGCGGG - Intergenic
1062513775 9:136922001-136922023 GAACCTAAGATTCTATCAGCAGG - Intronic
1192169315 X:68844509-68844531 CAACCTAGGATGGCCCCAGTGGG - Intergenic
1194327749 X:92541044-92541066 TGACCTAGGAAGACACCAGCTGG - Intronic
1197174878 X:123474854-123474876 GAATCCAGGAGACCACCAGCTGG + Intronic
1202067890 Y:20959939-20959961 GAGCAAAGGCTGCCACCAGCTGG + Intergenic