ID: 963080010

View in Genome Browser
Species Human (GRCh38)
Location 3:141382759-141382781
Sequence TTCCCACAGTTCCCAGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 433}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963080006_963080010 -3 Left 963080006 3:141382739-141382761 CCAGCTGGTGGCATCCTAGGTTC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 433
963080003_963080010 8 Left 963080003 3:141382728-141382750 CCAGCCTGTCTCCAGCTGGTGGC 0: 1
1: 0
2: 5
3: 25
4: 369
Right 963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 433
963080004_963080010 4 Left 963080004 3:141382732-141382754 CCTGTCTCCAGCTGGTGGCATCC 0: 1
1: 0
2: 2
3: 19
4: 217
Right 963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 433
963079998_963080010 21 Left 963079998 3:141382715-141382737 CCACCTGCTGGGCCCAGCCTGTC 0: 1
1: 0
2: 8
3: 56
4: 465
Right 963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 433
963079999_963080010 18 Left 963079999 3:141382718-141382740 CCTGCTGGGCCCAGCCTGTCTCC 0: 1
1: 0
2: 6
3: 53
4: 526
Right 963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 433
963080001_963080010 9 Left 963080001 3:141382727-141382749 CCCAGCCTGTCTCCAGCTGGTGG 0: 1
1: 0
2: 2
3: 52
4: 405
Right 963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963080010 Original CRISPR TTCCCACAGTTCCCAGGGCC TGG Intronic
900519808 1:3100104-3100126 TTCCCACAGATGCCAGGGGACGG - Intronic
900610249 1:3541676-3541698 TTCCCACTGTCCCCAGGGAGAGG - Intronic
900672702 1:3865704-3865726 TTCCCCCATTCCCCAGGGCCTGG - Intronic
901701373 1:11046443-11046465 TCCCCACCTTTCCCAGGGCAGGG - Intronic
901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG + Intronic
901841543 1:11957026-11957048 CTCCCACACTCCCCAGGGGCTGG - Intronic
901922156 1:12545074-12545096 TTCCCACAGTTCCCCAGCCAGGG - Intergenic
902376043 1:16030325-16030347 TTCCCACAGTGCCCAGGCTGTGG + Intronic
902380980 1:16052069-16052091 TTCCCACAGTGCCCAGGCTGTGG + Intronic
902384775 1:16070155-16070177 TTCCCTCAGGTCACATGGCCAGG - Intronic
902541993 1:17162460-17162482 TTGCCTCAGGTCCCAGGGCTGGG + Intergenic
902611239 1:17598414-17598436 TTCTCACAGTTCACAAGGCTGGG + Intronic
902613439 1:17610325-17610347 CCCCCAGAGGTCCCAGGGCCAGG - Intronic
903191105 1:21656604-21656626 TTCCCTCCCTTCCCAGGGGCTGG - Intronic
903739021 1:25547561-25547583 CTCCCACAGTTCCCACAGCGGGG - Intronic
903951036 1:26996089-26996111 CTCCCACAGTACCCTGGGCAGGG + Intronic
904430346 1:30460176-30460198 TTCCATCAGTCCCTAGGGCCTGG - Intergenic
904724934 1:32539806-32539828 TTCCCGCCTTTCCCCGGGCCGGG - Intronic
904869886 1:33610105-33610127 TTCTCACAGTTCTGAGGGCTAGG - Intronic
905352899 1:37359818-37359840 TTCCCACAGTCCTCAGGGAAGGG - Intergenic
905527587 1:38650736-38650758 AAACCACAGTTACCAGGGCCTGG + Intergenic
905791564 1:40792316-40792338 TCCCCACTGTGCCCAGGGGCTGG - Intronic
906240021 1:44237069-44237091 TTCTCACAAGTCCCCGGGCCAGG - Intronic
906717080 1:47978302-47978324 TTCTCACAGTTCTGGGGGCCAGG - Intronic
907241583 1:53084108-53084130 CTTCCCCAGCTCCCAGGGCCCGG + Intronic
907491520 1:54811803-54811825 TCCCCATAATTTCCAGGGCCTGG - Exonic
907499142 1:54865804-54865826 TTCCCACCTTCCCCAAGGCCAGG + Intronic
909377206 1:74953044-74953066 TTCCCACAGTCAGCAGAGCCTGG + Intergenic
909714519 1:78691945-78691967 TTCCCACAGTTCTGAGGACTGGG + Intergenic
910079464 1:83324030-83324052 TTCCCAGACTTCTTAGGGCCTGG - Intergenic
911764878 1:101661916-101661938 TTCCCACAGACCCCAGCACCAGG - Intergenic
912062292 1:105687536-105687558 TACCCCCTGTTCCCAGGTCCGGG + Intergenic
913348097 1:117828218-117828240 CTCCCAGAGTCCCCAGGGGCTGG - Intergenic
913692705 1:121294341-121294363 TTCCCACAATTCACAGGGATGGG - Intronic
914144851 1:144985749-144985771 TTCCCACAATTCACAGGGATGGG + Intronic
914751234 1:150536494-150536516 TTTCTAAAGTTCCTAGGGCCAGG + Intergenic
915282041 1:154829410-154829432 TTACCACAGGTCCCAGGGGCTGG + Intronic
915850211 1:159313846-159313868 GTCCCAGAGTTCCCTGGGACAGG - Exonic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916475031 1:165161225-165161247 TTCCCCCAGTTCTCAGTGCTTGG - Intergenic
917454058 1:175170699-175170721 TTCCCACCATTTCCATGGCCAGG + Intronic
917626780 1:176854305-176854327 TTCCCACAGAACCTGGGGCCAGG - Intergenic
918015990 1:180632535-180632557 CTCCCACCGTTCCCCGGCCCCGG - Intronic
918056605 1:181026767-181026789 TTCCCGCAGCTTCCAGGGGCAGG - Intergenic
918553583 1:185772766-185772788 TTCTCACAGTTCTCAAGGCTGGG + Intronic
919466132 1:197922853-197922875 CTCTTCCAGTTCCCAGGGCCTGG + Intronic
920033558 1:203051370-203051392 TTCCAACATCTCCCAGTGCCTGG + Exonic
920341754 1:205279557-205279579 TTCCCACAGCCCCCAGGGCTTGG - Intergenic
920480026 1:206312702-206312724 TTCCCACAATTCACAGGGATGGG - Intronic
921779232 1:219141843-219141865 TTTCCTCTCTTCCCAGGGCCTGG + Intergenic
921821617 1:219623239-219623261 TTCCCACAGTTCTGGGGGCCGGG - Intergenic
922034514 1:221835437-221835459 CTCCCACAGATTCCAGGGCTTGG + Intergenic
922425187 1:225485659-225485681 TGCCCACACTGCCCAGGGCTAGG + Intergenic
922455278 1:225769223-225769245 CTCCCACAGTTCCCAGCTCAGGG + Intergenic
922789962 1:228306003-228306025 GTCCCCCAGATCCCAGGGCGAGG - Intronic
922936377 1:229426167-229426189 TTCTCACAGTTCTGGGGGCCAGG - Intergenic
923226537 1:231943247-231943269 TACTCACAGTTCCCAAGGGCTGG + Intronic
923328874 1:232904304-232904326 TTGCCACTGTCCCCAGGGCGGGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924658032 1:245991430-245991452 TTCACACAGTTCTGAGGGTCAGG + Intronic
924832463 1:247612108-247612130 TCCCCACAGTCCCCAGCTCCAGG - Intergenic
1064431916 10:15278736-15278758 TTCCCACACCTCCCAGCCCCTGG - Intronic
1065547550 10:26837192-26837214 TTCTCACAGTTCTGAAGGCCAGG + Intronic
1066184708 10:32998032-32998054 TTCTCACAGTTCCAGGGGCTAGG + Intronic
1066579733 10:36867102-36867124 ATCTCACAGTTCCCTGGGTCAGG - Intergenic
1067481069 10:46597961-46597983 TCCCCACAGTGCCCAGACCCCGG - Intergenic
1067613683 10:47743861-47743883 TCCCCACAGTGCCCAGACCCCGG + Intergenic
1069650792 10:70046460-70046482 TTCCCTCAGTTCCCAGCCCCTGG - Intergenic
1069706659 10:70462902-70462924 GTCTCCCAGTTCCCAGGGCTGGG - Intergenic
1069836947 10:71315167-71315189 ATCCTCCAGTTCCCTGGGCCTGG + Intergenic
1069958035 10:72063500-72063522 CTCCCACAGTTCCGCCGGCCTGG + Intronic
1069980037 10:72246055-72246077 TTCCCAGGGTTCCCAGTGCCTGG - Intergenic
1070484396 10:76915473-76915495 TTCTCACAGTTGCCATGGCCTGG - Intronic
1070569646 10:77631402-77631424 TCCCCACACGGCCCAGGGCCTGG + Intronic
1072488171 10:95875887-95875909 TTCCCACAGGACCCAGGGGGAGG - Exonic
1072608572 10:97002311-97002333 TTCCTACAGCTGCCAGTGCCAGG - Exonic
1072912112 10:99511711-99511733 TTCCCCCAGTCCCCAGCTCCTGG - Intergenic
1073349881 10:102812181-102812203 GTCCCACAGGCCTCAGGGCCAGG - Intronic
1073674827 10:105633880-105633902 TTCTCACAGTTCTGGGGGCCAGG - Intergenic
1074360090 10:112818850-112818872 TTCCAACAGTACCCAGAGCTCGG - Intergenic
1074443110 10:113496272-113496294 TTCCCACATGGGCCAGGGCCAGG + Intergenic
1075450677 10:122549916-122549938 TTACTTCTGTTCCCAGGGCCTGG - Intergenic
1075538358 10:123290652-123290674 TTCCCTCATCTCCCTGGGCCTGG - Intergenic
1076164734 10:128272673-128272695 TTCCCTCCCTTCCCAGGCCCGGG - Intergenic
1076334159 10:129693945-129693967 TTTCCACAGTTCCCATGGGCAGG + Intronic
1076350884 10:129814463-129814485 TTCTCACAGTTCCTAAGGCCGGG - Intergenic
1076620167 10:131781968-131781990 AACTCACAGCTCCCAGGGCCAGG - Intergenic
1076838093 10:133031467-133031489 TTCCTGCAGTTCCCAGGGAGCGG - Intergenic
1077394027 11:2312418-2312440 TCCCCGCAGTGCCCAGGGGCGGG - Intronic
1078447507 11:11415559-11415581 TGCCCACATTTCCCAGCTCCAGG - Intronic
1078569516 11:12445245-12445267 TCCCCACAGTTCCCAGCCCCAGG - Intronic
1078578150 11:12518368-12518390 CTCCTTCACTTCCCAGGGCCAGG + Intronic
1079604237 11:22344452-22344474 TTCTCAGAGTCCTCAGGGCCTGG + Intronic
1080459383 11:32439655-32439677 CTCCCCCAGTTCGCAGTGCCTGG + Intergenic
1080559116 11:33445942-33445964 TTCTCACAGTTCCACAGGCCAGG - Intergenic
1080644471 11:34178272-34178294 TTCCCACAGATCCCAGGCTGGGG - Intronic
1081418281 11:42841401-42841423 TTCTCACAGTTCTCAAGGCTGGG - Intergenic
1081792847 11:45801229-45801251 TTCCCACAGTCCACAGTGGCAGG + Intergenic
1081866054 11:46361386-46361408 TTCCCAAGGTTCCCAGAGCCAGG - Intronic
1084721192 11:70906720-70906742 TGCCCAAAGACCCCAGGGCCTGG + Intronic
1085053318 11:73390746-73390768 CTCCCACAGGACCCAGGGCAGGG + Exonic
1085770548 11:79321866-79321888 TTCCCACAATGCACAGGGACAGG - Intronic
1086406559 11:86503902-86503924 TTCCCACAGTGGCCATTGCCTGG - Intronic
1089188097 11:116634728-116634750 TTCCCACAGTTCCAGAGGCTGGG + Intergenic
1089284518 11:117396914-117396936 TACCCACAGTGCGCAGTGCCTGG - Intronic
1089628707 11:119770141-119770163 TATGCACAGTTCCCAGGGCCCGG - Intergenic
1090052138 11:123388842-123388864 TTCTCACAGTTCCGGAGGCCAGG - Intergenic
1091035377 11:132228242-132228264 TTCACAGAATTCCCAGGGCATGG - Intronic
1091369150 11:135044371-135044393 TTCTCACAGGTCACAGGGTCAGG - Intergenic
1091600905 12:1917150-1917172 TTCCCCAAGTTCACAAGGCCAGG - Intronic
1092158296 12:6299542-6299564 CTCACACAGAGCCCAGGGCCAGG + Intergenic
1092191343 12:6523253-6523275 TTCCCACAGAGCCAAGGCCCAGG + Exonic
1092932938 12:13334238-13334260 TTCCCATAGTTCTGAGGGCTGGG - Intergenic
1094126935 12:27033225-27033247 TTCCCACAGTTCTGAAGCCCGGG + Intronic
1097000979 12:55876373-55876395 TTGCCACAGTTTGCAGAGCCAGG + Intergenic
1097198432 12:57258004-57258026 CTCACACAGTTCCCCCGGCCTGG - Exonic
1097269562 12:57765775-57765797 TTCCCCCAGTTCCCAGGATTCGG + Intronic
1097484578 12:60179623-60179645 TTCTTACAGTTCTCAGGGCTGGG - Intergenic
1099758835 12:86892719-86892741 TTCCCACAGAGCCCAGGTCGGGG - Intergenic
1102592795 12:113969672-113969694 TCCCCACTGTTGCCAGGCCCTGG - Intergenic
1102766012 12:115433610-115433632 TTCCAACAGTTCAGCGGGCCAGG + Intergenic
1102772091 12:115486813-115486835 GTCACACAGTTACCAGTGCCAGG - Intergenic
1103219310 12:119230503-119230525 TTCTCCAACTTCCCAGGGCCTGG + Intergenic
1103309207 12:119990351-119990373 TTCCCTAACTGCCCAGGGCCGGG - Intronic
1103736283 12:123062937-123062959 TTCCCCAAGGTCACAGGGCCTGG - Intronic
1104338828 12:127928213-127928235 TTCCCACTGTTGCTAGGACCTGG - Intergenic
1104418260 12:128613656-128613678 TTCCTTAAGTTCACAGGGCCGGG - Intronic
1104448684 12:128853039-128853061 TTCCCACAGTGACCAGGACCAGG - Intergenic
1104785053 12:131443918-131443940 TCCCCACCCTTCCCAGGCCCAGG + Intergenic
1105029779 12:132874486-132874508 TTCCCACCTGTTCCAGGGCCTGG - Intronic
1105049636 12:133037227-133037249 TTCCCACAGTGCCCCGCGTCCGG - Intergenic
1105747558 13:23392060-23392082 TTCCCTCAGCTCCCAGCTCCGGG - Intronic
1105801163 13:23903971-23903993 TTCCCACGGACCCCAGGCCCCGG - Intergenic
1105847714 13:24307965-24307987 TTCCCACGGACCCCAGGCCCCGG + Intronic
1105863973 13:24442470-24442492 AACCCACACTTCCCAGGCCCAGG + Intronic
1106484212 13:30158363-30158385 TTCCCACAGTTCCAGAGGCTGGG + Intergenic
1106617071 13:31339917-31339939 GTCCCCCATTGCCCAGGGCCAGG + Intergenic
1110721727 13:78769257-78769279 ATCATACAGTTCCAAGGGCCAGG - Intergenic
1110731994 13:78889420-78889442 TTGCCAGATTTCCCAGGGGCTGG - Intergenic
1111874707 13:93878792-93878814 TTCTCACAGTTCTAAGGGCTGGG - Intronic
1112423706 13:99276960-99276982 TTCCCAAAGGTTGCAGGGCCAGG - Intronic
1112440755 13:99423126-99423148 TTTCTACAGTTCCCATGGCAGGG + Intergenic
1112504892 13:99969728-99969750 CTCCCAGACTTCCCAGGGCCGGG + Intronic
1112904048 13:104395359-104395381 TTCCCACACTTCCCCTGGGCAGG + Intergenic
1113665527 13:112138554-112138576 TTCCTTCAGTTCTCTGGGCCTGG - Intergenic
1115469454 14:33753896-33753918 CTCCCACAGTTCCCAGTGCCAGG + Intronic
1117377270 14:55128371-55128393 TTCCCACAGTTCTGAAGGTCGGG + Intronic
1117736381 14:58773082-58773104 TACCCACGGTTCCCACGGACTGG - Intergenic
1118320223 14:64748572-64748594 CTCCCACGGTTGGCAGGGCCTGG - Exonic
1119745420 14:77040364-77040386 TTCCCACAATTCTCCGGGCCTGG - Intergenic
1121317628 14:92971617-92971639 ATGCCACAATGCCCAGGGCCAGG + Intronic
1122050049 14:99051490-99051512 TTCCCTCATTTCCCAGGCCCTGG - Intergenic
1122244742 14:100394544-100394566 TCCCCTCTGATCCCAGGGCCTGG - Intronic
1122270189 14:100565522-100565544 CTCCCACACCCCCCAGGGCCTGG - Intronic
1122322109 14:100861392-100861414 TTCTCACATTCCCCAGGGCTGGG + Intergenic
1122413178 14:101536300-101536322 TGGCCACATTCCCCAGGGCCAGG + Intergenic
1122776110 14:104117631-104117653 GCCCCGCAGTCCCCAGGGCCTGG + Intergenic
1122999795 14:105287199-105287221 TTTCCAGAGGTACCAGGGCCAGG - Intronic
1123062793 14:105601854-105601876 TCCCCACAATCCCCAGGCCCAGG + Intergenic
1123063831 14:105606395-105606417 TTCCCCCACTTCCCGGGCCCCGG + Intergenic
1123172568 14:106388532-106388554 TTCCCTCACCTCCCAGGTCCTGG - Intergenic
1124165058 15:27318880-27318902 TTTCCTCTGTTCCCAGGTCCTGG - Intronic
1126035907 15:44545124-44545146 TTCCCAGAGTTCCCAGGAGAGGG + Intronic
1126181038 15:45785241-45785263 TCCCAAATGTTCCCAGGGCCAGG + Intergenic
1128081804 15:64861423-64861445 TTCCCACACTCCCCAAGGCTTGG + Intronic
1128162654 15:65434461-65434483 TTCCCACAGCTTCTAGGGGCTGG + Intergenic
1128783407 15:70377597-70377619 TTCCCACAACTCCCAGGCTCTGG - Intergenic
1128888611 15:71311060-71311082 TCCACACAGTCCTCAGGGCCTGG + Intronic
1129379664 15:75157035-75157057 CTGCCACCTTTCCCAGGGCCGGG + Intergenic
1129766361 15:78171562-78171584 TTCTCAGAGTTCTCAGAGCCTGG - Exonic
1130397291 15:83513708-83513730 TTCCCACTCTACCCAGGGCATGG + Intronic
1132321256 15:100927200-100927222 TTCTTACAGGTCCCAGGGACCGG + Intronic
1132852512 16:2031199-2031221 GTCCCACAGGTCCCACGGGCAGG - Intronic
1133131597 16:3679586-3679608 TTCCCACAGTACCCACTGCGTGG + Intronic
1133238726 16:4402550-4402572 TCCTCACAGTTCACAGGGCTGGG - Intronic
1133462091 16:5995888-5995910 TTCTCACAGTTCTGAGGGCTGGG + Intergenic
1134626269 16:15724896-15724918 GTCCCTCAGTTCCCAGCTCCAGG - Exonic
1134686906 16:16165486-16165508 TTCCTAGAATTCCCAGGGACAGG - Intronic
1137399020 16:48138144-48138166 TTCTTACGGTTCCCAGGGCCAGG - Intronic
1137669616 16:50271716-50271738 CCCCCACAGTTCCCACTGCCTGG + Intronic
1138532278 16:57640915-57640937 TTCCCACGTTGCCCAAGGCCAGG - Intronic
1139432309 16:66917802-66917824 TTCCGCCCCTTCCCAGGGCCTGG + Intronic
1141094487 16:81153409-81153431 TTCCCTCTGTTCCCAGGTGCTGG + Intergenic
1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG + Intronic
1142119778 16:88381539-88381561 TTCCTAAAGTTTCAAGGGCCAGG - Intergenic
1142240426 16:88942046-88942068 TTCCCGCGGGTCCCGGGGCCAGG + Intronic
1142262408 16:89049148-89049170 CTCACACAGTTCCCAGGCCCTGG + Intergenic
1142547494 17:714875-714897 ATCCCACAGTTCCCCGGTCCCGG - Intronic
1142714018 17:1738215-1738237 GTCCCACACTGGCCAGGGCCTGG - Exonic
1143010831 17:3865433-3865455 AGCCAACAGTCCCCAGGGCCAGG + Exonic
1143401880 17:6651617-6651639 ATCCCACAGTGCCCCGGGACCGG - Exonic
1146412233 17:32596380-32596402 CTCCCAAAGGTCCCAGCGCCTGG - Intronic
1146679639 17:34797829-34797851 CTCGCACAGTTCCCAAGGTCTGG + Intergenic
1148777850 17:50105631-50105653 TTCTCACTGTTCCCTGAGCCCGG + Intronic
1148898298 17:50853959-50853981 TTTCCACCTTTCCCAGGCCCTGG + Intergenic
1149992177 17:61389414-61389436 TCCTAACAGTTCCCAGGGCAAGG - Intronic
1150477678 17:65487334-65487356 TGCTCACAGTTCTGAGGGCCGGG + Intergenic
1151177514 17:72300956-72300978 TTACCACAGTGCCCAGGGTGGGG + Intergenic
1152261447 17:79269475-79269497 TTCCCACAGCTCTCAGAGGCAGG - Intronic
1152608809 17:81305804-81305826 CTCCTACAGCTCCCAGGGCCGGG - Intergenic
1152938667 17:83154493-83154515 CTCCCACAGAGCCCTGGGCCTGG + Intergenic
1153856781 18:9156963-9156985 TTCCCACTTTTCCCAGCTCCTGG - Intronic
1155188241 18:23406275-23406297 TTCACACATTTCCCTGGGCTGGG + Intronic
1156563535 18:38157237-38157259 TTCACACTGTTCCCAGGCTCTGG + Intergenic
1157223325 18:45842097-45842119 TGTCCACAGGTCCCAGGCCCAGG + Exonic
1157749276 18:50163583-50163605 TTCCCACAGTATCCAGCACCTGG - Intronic
1158116186 18:53998641-53998663 TCCCCACTGTTCCAAGTGCCAGG + Intergenic
1160069357 18:75611796-75611818 TTCCCCATGTTCCAAGGGCCTGG - Intergenic
1160533230 18:79577423-79577445 TTCCCACTGTTAGCGGGGCCTGG + Intergenic
1160768744 19:821254-821276 TGCCCACAGTTCCCACGGCCTGG + Intronic
1160939762 19:1614752-1614774 CACCCCCATTTCCCAGGGCCAGG - Intronic
1161319611 19:3634832-3634854 TGCCCTCGGTGCCCAGGGCCCGG - Intronic
1161436694 19:4267780-4267802 GTCACAGAGTTCCCAGAGCCGGG + Intronic
1161581430 19:5083002-5083024 GTCCCCCAGCTCCCAGTGCCTGG + Intronic
1161719315 19:5894425-5894447 TTCCCCCAGTTCCCAGGGCAGGG - Intronic
1161737888 19:6002689-6002711 TCCACACCGTCCCCAGGGCCCGG - Intronic
1161805274 19:6439954-6439976 CACCCACAGTTCCAAGAGCCAGG - Intronic
1161954555 19:7486013-7486035 TTCCCACAGATCCGAGTGCTGGG - Exonic
1163102869 19:15108309-15108331 TTCCCAATGTTCCCAGGGAAGGG + Intronic
1163680244 19:18677306-18677328 TTCCCAAAGAGGCCAGGGCCAGG - Intergenic
1163727651 19:18931921-18931943 TCTCCACAGTTGCCCGGGCCAGG + Intronic
1163848487 19:19650622-19650644 TGCCCACAATCCCCAGGCCCTGG + Intronic
1164436752 19:28237021-28237043 ATCGAATAGTTCCCAGGGCCTGG + Intergenic
1165161892 19:33821170-33821192 CTCCCCCAGTTCCCATGCCCAGG + Intergenic
1165390179 19:35534276-35534298 TTCCCTCACTTCCCAAGGGCGGG + Intronic
1165908980 19:39212316-39212338 TTCCCTGAGTTCTCTGGGCCTGG - Intergenic
1166798299 19:45441093-45441115 TTCTGACTGTTCCCAAGGCCTGG - Intronic
1167644437 19:50698037-50698059 TTCCCACAGTTACCAGCTCCTGG + Intronic
1168147870 19:54429806-54429828 CTCCCACAGCACCCAGTGCCTGG - Intronic
1168585344 19:57587185-57587207 TTCCCACAATTCCCATGTCATGG - Intronic
925001280 2:404715-404737 GTTCCACAGATCCCAGGGCAGGG + Intergenic
926628530 2:15116309-15116331 TTCTTACAGTTCCCAAGGCTGGG + Intergenic
927809981 2:26175379-26175401 TTCCCCCAGGCCCCAGGGCTGGG + Intronic
928403659 2:30997451-30997473 TTCCCACACTTCCCTGGTACAGG + Intronic
929040354 2:37738502-37738524 TCCTCACAATTCGCAGGGCCTGG + Intergenic
930570891 2:53085543-53085565 TTCCCACACCTCCCAGTCCCTGG - Intergenic
931066753 2:58596363-58596385 TTCCCACTGCTCCTAGGGCTAGG - Intergenic
931267661 2:60674764-60674786 TTCCCACAGTCCCCAGGCATTGG + Intergenic
931818744 2:65930736-65930758 TTCCCTGAGTTCCTAGAGCCTGG + Intergenic
931897057 2:66744093-66744115 ATCCCACAGTTCTAAGTGCCTGG - Intergenic
933078183 2:77955102-77955124 GTCACCCAGTCCCCAGGGCCAGG + Intergenic
933558189 2:83857891-83857913 TTCCCACAGTTCTGAAGGCTGGG - Intergenic
933637074 2:84720178-84720200 TTCCCACACCACCCATGGCCAGG - Intronic
933917878 2:87014729-87014751 TTCCCAAATGTGCCAGGGCCCGG - Intronic
933974434 2:87497082-87497104 TTCCCACAGTTGGTAGTGCCAGG + Intergenic
934005117 2:87755185-87755207 TTCCCAAATGTGCCAGGGCCCGG + Intronic
934718127 2:96554890-96554912 TTCCCAGAGGCCCCAGGGCATGG - Intergenic
935620809 2:105128047-105128069 TCCTCACAGTTCCCAGGACGAGG + Intergenic
935759914 2:106311030-106311052 TTCCTACAGTTCCTAGCCCCTGG + Intergenic
935768074 2:106389277-106389299 TTCCCAAATGTGCCAGGGCCCGG + Intergenic
936319390 2:111453737-111453759 TTCCCACAGTTGGTAGTGCCAGG - Intergenic
936786375 2:116098477-116098499 TCCCCACACTTCCCAGAGCTGGG - Intergenic
937194079 2:120134291-120134313 TTCCTACAGTTCCCAACTCCAGG + Intronic
937224386 2:120359910-120359932 GTCCCTCACTGCCCAGGGCCTGG + Intergenic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
937578473 2:123454454-123454476 TTCCCACAGTTCCAAAGGCCAGG - Intergenic
938080388 2:128367044-128367066 ATCTCACAGCCCCCAGGGCCAGG + Intergenic
940302499 2:152189872-152189894 TTCCCACAGCTCCAAAGGCCTGG + Intergenic
940428461 2:153557862-153557884 TTCCCACAGTCCCCTCGGCCTGG + Intergenic
940902357 2:159137397-159137419 TGCCCAGAGTGCCCAGTGCCTGG - Intronic
942664589 2:178304060-178304082 TTCTCACAGTTCCGAAGGCTGGG + Intronic
944302780 2:198143388-198143410 TTCTCACAGGTCACAGGGACTGG + Intronic
946156192 2:217808239-217808261 TTCCCCCATTCCCCAGGGACAGG + Intronic
946249004 2:218401853-218401875 TCCCCACAGTGGGCAGGGCCTGG - Intronic
947544327 2:231000567-231000589 GGCACACAGTCCCCAGGGCCAGG + Intronic
947781137 2:232764476-232764498 TTCACACAGTTCCCATCGCAAGG - Intronic
948687322 2:239677430-239677452 TCTCCTCAGTTCCCAGGGCTGGG + Intergenic
948726917 2:239939795-239939817 TTCTGACCGTCCCCAGGGCCAGG - Intronic
949035893 2:241815626-241815648 TTCTCACCCTGCCCAGGGCCTGG + Intronic
1168781633 20:496563-496585 TTCCTACAGTTCCCAGGGCTGGG + Intronic
1169636549 20:7698468-7698490 TTCTCACAGTTCTCAAGGCTGGG - Intergenic
1169817803 20:9676483-9676505 TTCACACAGTTCCCAGGAATAGG - Intronic
1170219107 20:13922985-13923007 TTCCCACAGGTAACAGGGCTGGG + Intronic
1170322168 20:15112004-15112026 ACCCCAGAGTTCACAGGGCCAGG + Intronic
1171199356 20:23228557-23228579 TTCCCACAGTTCCAGAGGCTGGG - Intergenic
1171353849 20:24528445-24528467 TTCACACAGTTCTGAAGGCCGGG + Intronic
1172276893 20:33684989-33685011 GCCCCACAGTTCCCAGCTCCAGG + Intronic
1172513577 20:35517019-35517041 TTCCCACTTTTCTCAGTGCCCGG - Exonic
1172952209 20:38729419-38729441 TTCCCACGCCTCCCAGCGCCAGG - Intergenic
1173416501 20:42861231-42861253 TTCCCAAAGTTGCCAGTCCCTGG + Intronic
1174151521 20:48489466-48489488 ATCCCACACAGCCCAGGGCCAGG + Intergenic
1174384133 20:50176607-50176629 TTCATCCAGTTCTCAGGGCCAGG - Intergenic
1176184231 20:63769377-63769399 TTTCCTGTGTTCCCAGGGCCTGG - Intronic
1177512016 21:22099648-22099670 TTCCCCCTGTTCCCAGCCCCTGG - Intergenic
1178304855 21:31482903-31482925 TATACACAGTGCCCAGGGCCTGG - Intronic
1178690594 21:34746642-34746664 TACCAACACTGCCCAGGGCCTGG + Intergenic
1178907819 21:36650916-36650938 TTCTCACAGTTCTGGGGGCCGGG - Intergenic
1179788719 21:43743517-43743539 TCCCCACAGTGCTCAGGGGCTGG - Intronic
1179788737 21:43743568-43743590 TCCCCACAGTGCTCAGGGGCAGG - Intronic
1179907600 21:44432189-44432211 ATCTCACAGTTCTGAGGGCCAGG + Intronic
1180064127 21:45404574-45404596 GTCCCCCTGTTCCCAGGGCGCGG - Intergenic
1180141572 21:45896430-45896452 TTCCTACAGTGCCAATGGCCCGG - Intronic
1180141614 21:45896666-45896688 TTCCTACAGTGCCAATGGCCCGG - Intronic
1180942000 22:19665753-19665775 TACCTGCAGGTCCCAGGGCCAGG - Intergenic
1181465749 22:23109764-23109786 CTCCCACAGCTTCCAGGGCTGGG - Intronic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1181624551 22:24114381-24114403 TTCCCACTCTGGCCAGGGCCAGG + Intronic
1182555741 22:31127486-31127508 CTCCAGCAGTTCCAAGGGCCGGG + Exonic
1183293555 22:37017367-37017389 TACCCCTACTTCCCAGGGCCAGG - Intronic
1183365051 22:37402581-37402603 TGCCCACAGTTCCCAAGGAAGGG + Intronic
1183476538 22:38038911-38038933 TTCCCAGGGTTCTCGGGGCCGGG + Intronic
1183483577 22:38077730-38077752 GACTCACAGTTCCCAGGGTCAGG - Intergenic
1183541034 22:38429582-38429604 TTCCCACACTTCCCAGGAGCTGG + Intronic
1183646241 22:39128616-39128638 TTCTCACAGTTCTGGGGGCCGGG - Intronic
1184167011 22:42735661-42735683 GTCCAACAGTGCCCAGTGCCAGG - Intergenic
1184259957 22:43309091-43309113 TTCCCACACGGCCCAGGCCCAGG + Intronic
1184424011 22:44398508-44398530 TCTCAACAGTCCCCAGGGCCGGG + Intergenic
1184608987 22:45590557-45590579 TTCCCACTGTGCTCAGAGCCAGG - Intronic
1184644803 22:45889974-45889996 TTCCCACAGGTCCCACAGGCAGG + Intergenic
1184686620 22:46099241-46099263 TCCCCACCGTTGCCATGGCCAGG + Intronic
1185105562 22:48867580-48867602 CACCCACCGTTCCCAGGCCCCGG - Intergenic
1185139440 22:49092169-49092191 CTGCCACAGTTCCAAAGGCCAGG - Intergenic
1185171506 22:49297257-49297279 TCCCCACCGATGCCAGGGCCAGG - Intergenic
949704810 3:6804137-6804159 TTTCCACAATTCCCAGTTCCTGG + Intronic
949708793 3:6850347-6850369 TTCCCACTGTTGCCTGGGGCTGG - Intronic
949894974 3:8762031-8762053 TTCCAAAAGTTGCCAGGGCAAGG + Intronic
950190251 3:10971670-10971692 TTCCCAAACTTCCCAGGACGTGG + Intergenic
950448037 3:13049307-13049329 AGCCCACTGTTCCCAGGCCCAGG + Intronic
952008830 3:28875644-28875666 TTCCTACAGTTCCCAACTCCAGG - Intergenic
953812465 3:46125198-46125220 TTCCCAAAATTTCCTGGGCCAGG - Intergenic
954677834 3:52325403-52325425 TGGCCACATTTCCCAGGGCCTGG - Intronic
954692314 3:52402152-52402174 TTCCTCCCATTCCCAGGGCCTGG + Exonic
954864068 3:53713952-53713974 TTCCCAGAGATCCCAATGCCTGG + Intronic
957520124 3:81308602-81308624 TTCTCACAGTTCTGAGGGCTAGG - Intergenic
959065670 3:101654458-101654480 TTCCCACAGTCCCCACTTCCAGG + Intronic
960008396 3:112805779-112805801 TTCTCACAGTTCTGAGGGCTGGG - Intronic
960026777 3:113019426-113019448 TTCCCAGCGTCCCCCGGGCCGGG + Intronic
960844468 3:121993651-121993673 CTCCCTCAGATCCCAGGGCCTGG + Exonic
961325854 3:126108926-126108948 TTCACACAGCTGCCAGGGTCTGG - Intronic
961345940 3:126263475-126263497 TTCTCCCAGTACCCAGGGTCTGG - Intergenic
962956478 3:140271456-140271478 TTCCCACAGTTCTGGAGGCCAGG + Intronic
963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG + Intronic
963907197 3:150782546-150782568 TTCCCTGGGTTCCCATGGCCTGG - Intergenic
964295826 3:155232127-155232149 TTCCAATATTTCCTAGGGCCAGG - Intergenic
966063982 3:175794882-175794904 TTCTCACAGTTCTCAGGACTGGG + Intronic
967328243 3:188264006-188264028 CTTCCACAGTTCCCAGAGCTAGG + Intronic
967557807 3:190878126-190878148 GTCACCCAGTCCCCAGGGCCAGG + Intronic
968286719 3:197513203-197513225 ACCCCTCTGTTCCCAGGGCCAGG - Intronic
968289278 3:197526253-197526275 TTCCCACAGCCCTCAGGGCTGGG - Intronic
969142859 4:5094958-5094980 AGCCCACAGTGCCCAGGGCAGGG - Intronic
969418197 4:7074744-7074766 TTTCCACCATGCCCAGGGCCAGG + Intergenic
969706006 4:8791933-8791955 TTCTCAAAGTTCCCAGGGGTTGG + Intergenic
969712461 4:8851845-8851867 TCCCCACAGTGCCCAGGCCTGGG - Intronic
969931705 4:10637178-10637200 TTCCCACATTTCCCAGCCTCAGG + Intronic
972021036 4:34314608-34314630 TTTAAACAGTTCCGAGGGCCAGG - Intergenic
972463382 4:39328203-39328225 TCCCCACATTTACCAGTGCCAGG + Intronic
972548781 4:40108123-40108145 TTGCCACATTGGCCAGGGCCAGG + Intronic
973612127 4:52645782-52645804 TTCCCACAATTCTAGGGGCCTGG + Intronic
974160749 4:58135008-58135030 TTCCCACAATTCACACGGACAGG + Intergenic
975912072 4:79278873-79278895 TTCCCACAGTTCTGAGGTCTGGG + Intronic
976011195 4:80491540-80491562 TTCCCAAAGTTACCAGAGCTGGG - Intronic
978414235 4:108458744-108458766 CTCCCAAAGTTCACAGGGGCTGG - Intergenic
979009218 4:115345463-115345485 TTCCTCCATTTCCCAGGGCAGGG + Intergenic
979824260 4:125214187-125214209 CTCCTACAGAACCCAGGGCCAGG - Intergenic
980158519 4:129133775-129133797 CTCCCACTGTGCCCAGGACCAGG - Intergenic
980351480 4:131690767-131690789 TTCCCTCACCTCTCAGGGCCAGG - Intergenic
982317161 4:154043639-154043661 AAACCACAGTTCCCATGGCCGGG - Intergenic
983670795 4:170235621-170235643 GTCACAGAGTACCCAGGGCCGGG + Intergenic
983977496 4:173953173-173953195 TTCCCACAGGTCCCTGGGTGGGG + Intergenic
984130929 4:175875204-175875226 TTCCCACAGCTCCCAGTTTCTGG + Intronic
984529166 4:180894998-180895020 TTCTCACAGTTCTCAGGGGTGGG + Intergenic
984990180 4:185372756-185372778 TTCTCACAGTTCCAGAGGCCAGG - Intronic
985135820 4:186785127-186785149 TTCCCCCACTTCCCAGTCCCTGG + Intergenic
988361973 5:30247907-30247929 TTCTCACAGTTCCAAAGGCCAGG - Intergenic
990634926 5:57713997-57714019 TTCCCACAGTTCTGAAGGCTGGG - Intergenic
990874060 5:60464615-60464637 TTCCCACAGATCTCAGGGATGGG + Intronic
991062054 5:62386897-62386919 TTCCCTCAGTTCCCAGGATGGGG + Intronic
992070602 5:73145124-73145146 TCACTACAGTTCCCAAGGCCAGG + Intergenic
992739539 5:79759429-79759451 TGTTCACAGTTCCCAGGGCGTGG + Intronic
994090420 5:95805161-95805183 TTCCCATAGTTCCGAAGGCTGGG + Intronic
994189833 5:96857211-96857233 TTCCCTGATCTCCCAGGGCCAGG + Intronic
995058599 5:107789424-107789446 TTCTCACAGTTCTCGAGGCCGGG - Intergenic
995686217 5:114775364-114775386 TTCCCCCAGTCCTCAGGCCCTGG + Intergenic
995727928 5:115202367-115202389 TTCCCACACTTTCCAGGGGTGGG - Intergenic
998805328 5:145912753-145912775 TTCCTACAGTTGACAAGGCCAGG - Intergenic
999256450 5:150212268-150212290 TTCCCACTGTAATCAGGGCCAGG - Intronic
999305155 5:150514859-150514881 CTCCCACTTTTCCCAGGGTCAGG - Intronic
1001753017 5:174145893-174145915 TCCCACCAGTTCCCAGAGCCTGG + Intronic
1002046088 5:176542639-176542661 TTCCCTCACTTCCCAGCCCCCGG + Exonic
1002472769 5:179447045-179447067 TTCCTGGAGTTCACAGGGCCTGG - Intergenic
1003646606 6:7917802-7917824 TTCCCAGAGTCCCCAGGTGCGGG + Intronic
1003748002 6:9024377-9024399 TCCCCTCACTGCCCAGGGCCCGG - Intergenic
1004371969 6:15060532-15060554 TTCCCACAGTTCAGGAGGCCAGG + Intergenic
1005121687 6:22396949-22396971 TTCCCACAGTTCCGGGGGCTGGG - Intergenic
1005234978 6:23749730-23749752 TTCCCACAATCTCAAGGGCCTGG + Intergenic
1006836208 6:37000229-37000251 TTCCACCATTTCCCAGGCCCTGG + Intergenic
1007281288 6:40714199-40714221 TTCCCACAGATCACAGAGCCAGG + Intergenic
1007434305 6:41797593-41797615 TCCCCACACTTCCCATGGCAGGG + Intronic
1007693210 6:43716147-43716169 TTGGCCCAGCTCCCAGGGCCTGG + Intergenic
1007805827 6:44445179-44445201 ATCCCTCAGCTCCCAGAGCCAGG + Intronic
1008025362 6:46629852-46629874 TGCCAACAGTTTCCTGGGCCAGG - Intronic
1008876458 6:56334958-56334980 TTCTCACAGTTCTGAAGGCCTGG - Intronic
1010815841 6:80357199-80357221 TTCCCACAGTTGCTAGTTCCTGG - Intergenic
1013007525 6:106087819-106087841 TTTCCACAGTGCCGAGGGTCTGG + Intronic
1015089235 6:129334675-129334697 TTCCCACAGTTCTGAAGGCTGGG + Intronic
1015128423 6:129781928-129781950 TTTCCAGAGTTCACAGAGCCAGG + Intergenic
1015526176 6:134176568-134176590 TTACCACTATTCGCAGGGCCAGG + Intronic
1015954107 6:138582674-138582696 GTCACCCAGTTCCCAGGGCATGG - Intronic
1016868415 6:148792421-148792443 TTTACACAGTTCACAGGCCCAGG - Intronic
1018585108 6:165349398-165349420 GTTCCACAGTTCCTAGGGCAGGG - Intronic
1019061213 6:169259508-169259530 GGCCCAGAATTCCCAGGGCCAGG + Intergenic
1019356212 7:580916-580938 TTCCCACGAACCCCAGGGCCGGG + Intronic
1019611175 7:1937426-1937448 TTCCCACGAAACCCAGGGCCGGG + Intronic
1019710859 7:2517607-2517629 TCCCCACAGTTCCCAGGCCAGGG - Intronic
1019729415 7:2622207-2622229 TTCCCACAGCTCTCAGGGCAAGG - Intergenic
1022639829 7:32171127-32171149 TACCCACAGTTCCCAGGAGAGGG - Intronic
1022789362 7:33671587-33671609 ATTCCACAGTTCCAAGTGCCTGG - Intergenic
1023187783 7:37549530-37549552 TTCCCTGAGTTCCCAGTTCCTGG - Intergenic
1024886725 7:54150551-54150573 TTCCCCCAGGCCCCAGGCCCTGG - Intergenic
1025231235 7:57204477-57204499 ATCCCACACAGCCCAGGGCCAGG - Intergenic
1026978876 7:74515225-74515247 ATCTCAGAGTTCCCAGGGCTGGG - Intronic
1027942005 7:84694620-84694642 TTCCCTCAGTTCCCAGACTCTGG - Intergenic
1028169912 7:87583796-87583818 TTCCCACAGTTCTGAAGGCTGGG + Intronic
1029729457 7:102429854-102429876 CTCCCATAGTTCCAAGGACCAGG - Intergenic
1029877466 7:103769474-103769496 TTCTCACAGTTCCGAAGGCTGGG - Intronic
1030114717 7:106054540-106054562 TTCCCAGAGTTCCCAAAGCTGGG + Intergenic
1032301238 7:130689277-130689299 TTCTCACAGTTCCAGAGGCCGGG - Intergenic
1032698118 7:134355292-134355314 TGACCACACTTCCCAGGGCTGGG + Intergenic
1033486476 7:141794160-141794182 TTCCCCCACGTCCCAGGCCCTGG - Intergenic
1034274889 7:149819708-149819730 TTCCCACAGTGCCCGGGGGCTGG + Intergenic
1034564775 7:151904390-151904412 TTCCCACAGGGCCCCGGGTCAGG - Intergenic
1034695416 7:153048872-153048894 ATCCCACAGTTCTCTGAGCCTGG + Intergenic
1034902043 7:154913946-154913968 TTCCTCCAGGTACCAGGGCCCGG - Intergenic
1034967461 7:155400128-155400150 TTCCCACGGTGCCCGGGGCCGGG + Intergenic
1036660273 8:10703281-10703303 TTCCCACTGACCCCAGAGCCTGG - Intronic
1036787690 8:11698778-11698800 TTCCTGCAGTCCCCAGGACCTGG + Intronic
1037892207 8:22629364-22629386 TTCCCTCGGTCCCCAGGGCGGGG - Intronic
1037914041 8:22761210-22761232 ACCCCACAGTTCCCCGGGGCAGG - Intronic
1040558551 8:48503047-48503069 TTCCCAGTGATCCCAAGGCCTGG + Intergenic
1041925446 8:63231219-63231241 TTCTCACAGTTCCGGGGGCTGGG + Intergenic
1042780877 8:72489863-72489885 TTCTCACAGTTCTGAAGGCCGGG - Intergenic
1042955511 8:74246002-74246024 CTCCTCGAGTTCCCAGGGCCTGG - Intronic
1045709620 8:104967764-104967786 GTGCCACAGTTTCTAGGGCCTGG - Intronic
1047053293 8:121137456-121137478 TTCCCACAGTTCCGGAGGCTGGG - Intergenic
1048967784 8:139626668-139626690 AGCCCACAGTTCCCTGGGACAGG + Intronic
1049303292 8:141883212-141883234 TTCCCAGAGCCCCCAGGGCAGGG - Intergenic
1049379702 8:142305817-142305839 TCCCCACAGGGCTCAGGGCCTGG + Intronic
1049862752 8:144911280-144911302 CTCCCACAGTTCCCACGTCATGG + Intergenic
1052397263 9:27954351-27954373 TGGCCACAGTTCCCAGTGTCTGG + Intronic
1053153018 9:35754747-35754769 TTCCCTCAGATCCTAGGGCAGGG + Exonic
1053369864 9:37551623-37551645 TTCCAAGAGTGCCCCGGGCCTGG + Intronic
1053625418 9:39865939-39865961 TTCCCCCAACTCCCAGGCCCTGG + Intergenic
1053879444 9:42577281-42577303 TTCCCCCAACTCCCAGGCCCTGG - Intergenic
1053893214 9:42717056-42717078 TTCCCCCAACTCCCAGGCCCTGG + Intergenic
1054218470 9:62384750-62384772 TTCCCCCAACTCCCAGGCCCTGG - Intergenic
1054232246 9:62524416-62524438 TTCCCCCAACTCCCAGGCCCTGG + Intergenic
1054915034 9:70487817-70487839 TTCCCACAGAGCCTGGGGCCTGG + Intergenic
1055343396 9:75309088-75309110 TTGCCAGAATTCCCAGGGCTTGG + Intergenic
1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG + Intronic
1056495372 9:87149949-87149971 TTCCCACAGTTCTGGGGGCTGGG - Intronic
1058653998 9:107203286-107203308 ATCCCACAGTTCTCTAGGCCAGG - Intergenic
1058899575 9:109430588-109430610 TTCCCTCTGTCCCCAGGGCCTGG - Intronic
1060023114 9:120149251-120149273 CAGCCACAGTTCCTAGGGCCAGG - Intergenic
1060187386 9:121572016-121572038 TTCACACAGCTCCAAGGGGCTGG - Intronic
1060777485 9:126386247-126386269 TGCACACAGGTCCCAGGACCAGG - Intronic
1061135248 9:128729965-128729987 TGCGCCCACTTCCCAGGGCCGGG + Exonic
1061407906 9:130402916-130402938 ACCCCAGAGTTCCTAGGGCCAGG + Intronic
1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG + Intronic
1062178145 9:135175772-135175794 TCCCCACAGCCCCCAGAGCCAGG + Intergenic
1062314025 9:135956722-135956744 TACCCACAGTTTCCATAGCCTGG + Intronic
1062334314 9:136058327-136058349 TCCCCACGGCTCCCAGTGCCTGG + Intronic
1186518660 X:10186363-10186385 TGCCCAGAGTTACCAGGTCCAGG + Intronic
1187346957 X:18474159-18474181 AGACCAAAGTTCCCAGGGCCAGG - Intronic
1189366115 X:40390022-40390044 TTCTCACAATTCCCTGGGTCAGG - Intergenic
1189575593 X:42349736-42349758 TTCCCACTGTATCAAGGGCCAGG + Intergenic
1192148075 X:68694941-68694963 TACCCCCAAGTCCCAGGGCCTGG + Intronic
1192161179 X:68789074-68789096 TCCCCACTGTTCCCATGGACAGG - Intergenic
1192194489 X:69019198-69019220 TTCCCTTCCTTCCCAGGGCCAGG + Intergenic
1196985281 X:121263245-121263267 TTCCCACAATCCCCAGTCCCTGG + Intergenic
1197103152 X:122680223-122680245 TTCCCATAATTCCCATGGTCGGG - Intergenic
1198427891 X:136538048-136538070 TTCCCACCCTTCACAGGGCCAGG + Intronic
1199347097 X:146754430-146754452 TTCCCAGAGTTCTCAGAGCTTGG + Intergenic
1199542013 X:148967866-148967888 TTCCCAAAGTTCTCAGGGCTTGG + Intronic
1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG + Exonic
1200208973 X:154337322-154337344 ATCCCACAGTTCTGAGGGCCTGG - Intergenic
1200221903 X:154394806-154394828 ATCCCACAGTTCTGAGGGCCTGG + Intronic
1200232878 X:154453298-154453320 TTCCCCCACTCCCCAGGCCCTGG + Intergenic