ID: 963082827

View in Genome Browser
Species Human (GRCh38)
Location 3:141410203-141410225
Sequence TGCCGATATTAGCCAGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963082823_963082827 -3 Left 963082823 3:141410183-141410205 CCCTCCTGTCCTCATAGATATGC 0: 1
1: 0
2: 1
3: 12
4: 184
Right 963082827 3:141410203-141410225 TGCCGATATTAGCCAGACTTTGG 0: 1
1: 0
2: 0
3: 7
4: 60
963082825_963082827 -7 Left 963082825 3:141410187-141410209 CCTGTCCTCATAGATATGCCGAT 0: 1
1: 0
2: 0
3: 5
4: 52
Right 963082827 3:141410203-141410225 TGCCGATATTAGCCAGACTTTGG 0: 1
1: 0
2: 0
3: 7
4: 60
963082821_963082827 21 Left 963082821 3:141410159-141410181 CCCAGGGGTCTCAATGTAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 963082827 3:141410203-141410225 TGCCGATATTAGCCAGACTTTGG 0: 1
1: 0
2: 0
3: 7
4: 60
963082822_963082827 20 Left 963082822 3:141410160-141410182 CCAGGGGTCTCAATGTAGTAGCT 0: 1
1: 0
2: 0
3: 12
4: 86
Right 963082827 3:141410203-141410225 TGCCGATATTAGCCAGACTTTGG 0: 1
1: 0
2: 0
3: 7
4: 60
963082824_963082827 -4 Left 963082824 3:141410184-141410206 CCTCCTGTCCTCATAGATATGCC 0: 1
1: 0
2: 2
3: 7
4: 109
Right 963082827 3:141410203-141410225 TGCCGATATTAGCCAGACTTTGG 0: 1
1: 0
2: 0
3: 7
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963082827 Original CRISPR TGCCGATATTAGCCAGACTT TGG Intronic
909866134 1:80674226-80674248 TGCTGATATTTGCCACTCTTTGG - Intergenic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
915621185 1:157085540-157085562 TGCCTATAATAGCAACACTTTGG - Intergenic
1066493934 10:35922286-35922308 TGCCGAAATTATCTACACTTGGG + Intergenic
1070072184 10:73100619-73100641 TGCCCATATAAGCCAGACTATGG + Intergenic
1076521838 10:131086054-131086076 TGTCCCTATTACCCAGACTTCGG + Intergenic
1078846778 11:15125714-15125736 TGCCCATATTAGCCAGCATCTGG - Intronic
1084188430 11:67487650-67487672 TTCCCCTATTAGCCAGACTGAGG + Intronic
1084908910 11:72371675-72371697 TGCCTATAATCGCAAGACTTTGG - Intronic
1087049431 11:93870327-93870349 TGCCTATATGAGCAAGAATTTGG + Intergenic
1087790174 11:102397730-102397752 TGTCGATATTACTCAGATTTGGG - Exonic
1091460472 12:640647-640669 TACAGATATTAGCCCTACTTGGG - Intronic
1094574930 12:31676453-31676475 TGCAAAAATTAGCCAGAATTTGG + Intronic
1099999767 12:89819340-89819362 TGCTAATATTAGCTATACTTTGG + Intergenic
1111774288 13:92640019-92640041 TGCCAATTTCAGCCAGAATTAGG - Intronic
1113138497 13:107120342-107120364 TGCCGTTATGAGCCATACTATGG + Intergenic
1113261073 13:108563764-108563786 TGCTCATAATAGCCAGAATTTGG - Intergenic
1122055813 14:99097601-99097623 TACCAAAATTAGCCAGGCTTGGG - Intergenic
1125558532 15:40607158-40607180 TGCCTATAATACCCACACTTTGG - Intronic
1132191171 15:99862414-99862436 TGCCAATTTCAGCCAGAATTAGG + Intergenic
1137694471 16:50452209-50452231 TGACCATACTAGCCAGACATAGG + Intergenic
1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG + Intronic
1143052285 17:4136187-4136209 TACAGAAATTAGCCAGACATGGG + Intronic
1151638463 17:75370208-75370230 TGCCCATAGTAGCCAGCTTTTGG - Intronic
1153859764 18:9190101-9190123 TACCAATATTAACCAGAGTTTGG + Intronic
1164649635 19:29882570-29882592 TGCCGGTGTTAGCCAGGCATAGG + Intergenic
925634901 2:5933677-5933699 TGCAGATGTGAGCCAGACTTAGG + Intergenic
925943267 2:8839384-8839406 TGTCAATATTTGCCAGCCTTGGG + Intergenic
927506397 2:23617716-23617738 TGCTGATACTATCCAGACTGCGG - Intronic
929842281 2:45480396-45480418 TGTCAACATTAGCCAGAGTTTGG + Intronic
930171867 2:48259855-48259877 TGCCTTTATTCTCCAGACTTGGG + Intergenic
939720678 2:145646704-145646726 TGACAATATTAGCAAGACTAGGG + Intergenic
943287632 2:186024805-186024827 TGCCTATATTATGCAGACTTGGG + Intergenic
946806152 2:223473192-223473214 TGCCGCTATTACCTGGACTTGGG - Intergenic
1170346156 20:15389075-15389097 TGTGGATACTAGCCAGATTTGGG + Intronic
1174716937 20:52768982-52769004 TGCTGAAACTTGCCAGACTTTGG - Intergenic
1174949517 20:55028950-55028972 TGCCACTATTACCCAGACCTGGG - Intergenic
1176271933 20:64239870-64239892 GGCGGATATTGGCGAGACTTTGG - Exonic
1179614884 21:42576279-42576301 TGCCCATCTTAGCCAGATTAGGG + Intronic
1182477454 22:30583915-30583937 TGCCGATAGCTGCCAGACCTTGG - Intronic
951090762 3:18571313-18571335 TGCAGATACTAGCTAGACTTTGG + Intergenic
951317881 3:21208502-21208524 TGCCTATATTCCCCACACTTTGG + Intergenic
953098407 3:39801748-39801770 TGCAAATATTAGGCAGATTTGGG - Intergenic
961575029 3:127828277-127828299 TACAAAAATTAGCCAGACTTGGG - Intergenic
962883717 3:139603367-139603389 TGCCCATGTTACCCAGACTTAGG + Intronic
963082827 3:141410203-141410225 TGCCGATATTAGCCAGACTTTGG + Intronic
963629812 3:147718989-147719011 TGCCTATATTTGCAATACTTTGG - Intergenic
977479232 4:97553733-97553755 TGCTGTTGTTAGACAGACTTGGG - Intronic
990491170 5:56304271-56304293 TGCTCATATTTGTCAGACTTGGG + Intergenic
995686032 5:114773224-114773246 GGCCCATATTAGCCATACTTGGG + Intergenic
998225933 5:140326218-140326240 TGGCGATGGTAGCCAGAATTAGG - Intergenic
999840172 5:155416139-155416161 GGCCGACATAAGCCAGGCTTTGG + Intergenic
1003490629 6:6618316-6618338 TGCTGATAGAAGCCAAACTTAGG + Intronic
1010155575 6:72788326-72788348 TGCCTGTATTAACAAGACTTTGG + Intronic
1013628914 6:111965897-111965919 TGCTGATATTTGACTGACTTTGG + Intergenic
1015858428 6:137650678-137650700 TGCCGAAATTAGCCAGCCTCAGG - Intergenic
1016044048 6:139463287-139463309 TGCAAAAATTAGCCAGGCTTGGG - Intergenic
1029005037 7:97200750-97200772 TGGCAATGTGAGCCAGACTTGGG + Intergenic
1029818976 7:103126886-103126908 TGCCTATAATACCCACACTTTGG - Intronic
1030377953 7:108775454-108775476 AGCCAATGTTTGCCAGACTTTGG - Intergenic
1031952794 7:127909690-127909712 TGCCTATAATAGCAATACTTTGG - Intronic
1033119795 7:138657618-138657640 TGCTGTTGTTAGCCAGAATTTGG + Intronic
1039280498 8:35979134-35979156 TCCCAATTTTAGCCAGTCTTGGG + Intergenic
1045317051 8:101052332-101052354 AGCCCATACTACCCAGACTTGGG + Intergenic
1046093440 8:109530683-109530705 TCCCAATATTGGCCAGAGTTGGG - Intergenic
1049027448 8:140004786-140004808 TGGGGATATCTGCCAGACTTGGG - Intronic
1059315435 9:113421655-113421677 TGTCAATATTAGCAAGCCTTTGG - Intronic
1194540466 X:95163941-95163963 TGCACATATTAACCAGAATTTGG - Intergenic