ID: 963083130

View in Genome Browser
Species Human (GRCh38)
Location 3:141413079-141413101
Sequence GAGGAGGAATTGTGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 448}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963083117_963083130 28 Left 963083117 3:141413028-141413050 CCCTCCAGAGGTCGTAGTGTTGC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 963083130 3:141413079-141413101 GAGGAGGAATTGTGGGAAATGGG 0: 1
1: 0
2: 6
3: 38
4: 448
963083118_963083130 27 Left 963083118 3:141413029-141413051 CCTCCAGAGGTCGTAGTGTTGCC 0: 1
1: 0
2: 1
3: 4
4: 48
Right 963083130 3:141413079-141413101 GAGGAGGAATTGTGGGAAATGGG 0: 1
1: 0
2: 6
3: 38
4: 448
963083122_963083130 6 Left 963083122 3:141413050-141413072 CCAGCAGTGGCTTCAAACTGGAA 0: 1
1: 0
2: 0
3: 11
4: 164
Right 963083130 3:141413079-141413101 GAGGAGGAATTGTGGGAAATGGG 0: 1
1: 0
2: 6
3: 38
4: 448
963083119_963083130 24 Left 963083119 3:141413032-141413054 CCAGAGGTCGTAGTGTTGCCAGC 0: 1
1: 0
2: 0
3: 5
4: 27
Right 963083130 3:141413079-141413101 GAGGAGGAATTGTGGGAAATGGG 0: 1
1: 0
2: 6
3: 38
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963083130 Original CRISPR GAGGAGGAATTGTGGGAAAT GGG Intronic
901517163 1:9755747-9755769 GAGGAGGAAGCGTGAGATATAGG + Intronic
901538051 1:9895981-9896003 GAGGGGGAATTGGGGAAATTTGG - Intronic
902193247 1:14778594-14778616 GATGAGGAATTGTGAGCAAAAGG - Intronic
902350565 1:15850520-15850542 GGGGAGGAAGTGTGGCAACTGGG - Intronic
903193388 1:21668881-21668903 GAGGAGGGACTGTGGGAAGTGGG - Intronic
904568428 1:31442592-31442614 GAGGAGGAGCAGTGGGAAGTGGG - Intergenic
905305596 1:37015697-37015719 GAGCCGGAGTTGGGGGAAATGGG - Intronic
905650832 1:39655757-39655779 GAGGCTGCATTGTGGGAAAATGG + Intergenic
906195489 1:43927999-43928021 GAAGAGGAATATTGGGAATTTGG + Intronic
906654806 1:47540367-47540389 GAGAAGGATTTCTGGGAAACAGG - Intergenic
907394579 1:54180276-54180298 GAGGAGGAGTTGATGGAACTGGG - Intronic
907486062 1:54779035-54779057 GAGTAGGCAGTCTGGGAAATGGG + Intergenic
907710093 1:56872537-56872559 GGGTATGAATTGTGGGAAAAAGG + Intronic
909478154 1:76105563-76105585 GAGGAGGAAGTGTGGAAAAGTGG - Intronic
910365095 1:86456665-86456687 GAGAGGGAAATGTGGGGAATTGG + Intergenic
911978247 1:104531150-104531172 ATGGAAGAATTGTGGGACATAGG - Intergenic
912047074 1:105472259-105472281 GAGGAGGCATCGTGGGAAAAGGG - Intergenic
912158595 1:106952980-106953002 GGTGATGAATTGTGGCAAATAGG - Intergenic
912681497 1:111732062-111732084 AAGGAGGAGTTGTGGGAACCTGG + Intronic
913408827 1:118527571-118527593 GAGAATGAAATGTGGGGAATGGG + Intergenic
915444782 1:155968432-155968454 CAGGAGGAATTGAGGGAGAGGGG + Intronic
915883054 1:159693484-159693506 GAGTAGGATTCGTGGTAAATTGG + Intergenic
915970889 1:160354370-160354392 GAGGGGGTAGTGTGGGAAAGCGG - Intronic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
917451338 1:175150181-175150203 GAGGAGGACTTTTGGGAAACAGG + Intergenic
918239571 1:182609782-182609804 GAGGAGGTATGGTGGGAAAGAGG - Intergenic
918311666 1:183289613-183289635 GAGGAGGAATGGGTGGGAATGGG + Intronic
918484132 1:185011519-185011541 GAAGAGGACTTGAAGGAAATGGG + Intergenic
919334841 1:196219263-196219285 CAGGAGGAATAGGGAGAAATGGG + Intergenic
920847844 1:209608432-209608454 GAGGAGGGATGGTGGGGAAGAGG - Intronic
921180692 1:212629329-212629351 GAGGAGGGATTCTGGGACACGGG + Intergenic
921282963 1:213585432-213585454 GCTGAGGACTTGTGGGATATGGG - Intergenic
922176960 1:223204515-223204537 GAGGGGGAATTGAGGGACAAAGG - Intergenic
1063605282 10:7518173-7518195 GAAGAGCCAATGTGGGAAATTGG + Intergenic
1063647976 10:7904891-7904913 GTGGAGGAAGTGCGGGGAATTGG - Intronic
1065088115 10:22200894-22200916 GAGGAGGAATTGTGTTAACGTGG - Intergenic
1065287905 10:24202878-24202900 GAAGAGGAATTTTAGAAAATAGG + Intronic
1066028676 10:31394044-31394066 GAGGAGTGATGGTGGGAAAGTGG + Intronic
1066220623 10:33334616-33334638 GAGGAACAAGTGTGGGAAAAGGG - Exonic
1066272319 10:33835869-33835891 GAGGAGGAATTTTAGGCAAAGGG + Intergenic
1066436056 10:35397532-35397554 GAGGAGGAATTCTAGGAGGTAGG + Intronic
1067332767 10:45337404-45337426 GAGCTGAAATTGTGGGAAAATGG + Intergenic
1068926873 10:62549472-62549494 TAGGAGGAATTGTGACAGATTGG + Intronic
1068966188 10:62914274-62914296 GAGGATGAGTTGAGGGTAATAGG - Intronic
1069062247 10:63906355-63906377 GGGGAAGAATTGTGGAAAAGAGG + Intergenic
1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG + Intronic
1069718488 10:70535459-70535481 GAGGAGGAAAAGTGGGGAAGAGG - Intronic
1070219186 10:74422838-74422860 GTGGAGGAGTTGTGAGCAATGGG + Intronic
1070587291 10:77775861-77775883 AAGGAGGCATTGAAGGAAATAGG - Intergenic
1070661100 10:78305823-78305845 GAGTTGGAATTGTGGGGAAGGGG - Intergenic
1070979750 10:80634535-80634557 GAGGGGGAACTGGTGGAAATTGG + Intronic
1071777811 10:88808686-88808708 TAGGAGGAGTTTTGGGGAATGGG - Intronic
1071961383 10:90811435-90811457 GAGAAGGAAATGTGGGGAAATGG - Intronic
1073735540 10:106341773-106341795 GAGGAGGAATTGTGGAGCAAGGG + Intergenic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1074769921 10:116726575-116726597 CAGAAGGAACTGTGGGAAATTGG - Intronic
1075652538 10:124138403-124138425 GAGGAGAGATTGAGGGGAATGGG + Intergenic
1075814527 10:125254670-125254692 GAGGAGGAATTGGGGGAGGCGGG - Intergenic
1075867275 10:125735418-125735440 GTGGAGTAATTTCGGGAAATAGG + Intronic
1076348523 10:129797558-129797580 GAGGAGGAAAGGTGGGAATGAGG - Intergenic
1077272253 11:1686821-1686843 GAGGAGGAAGGGAGGGAAAGAGG - Intergenic
1078556318 11:12329467-12329489 GAGGTGGCATGGTGGGAAGTGGG + Intronic
1078653738 11:13219392-13219414 GAGGAGGAATGGGAGGAAACAGG - Intergenic
1078920364 11:15825187-15825209 GATGAGGAATTAGGGGAAAAAGG - Intergenic
1079280214 11:19080544-19080566 GAGGAGTAATGGAGGGAGATTGG - Intergenic
1079595532 11:22241170-22241192 GAGGAGGTAGTGTGGGAGAGGGG - Intronic
1079943123 11:26706996-26707018 GAGGAGATACTGTGGGAAAAAGG - Intronic
1080135094 11:28844799-28844821 GAGGAGGGAATGAGGGAAAGAGG - Intergenic
1081633616 11:44705883-44705905 GAGGAGGAATTCTGGGTTCTTGG + Intergenic
1082071922 11:47946248-47946270 AAGGAGGAAAAGTGGGAAAGGGG + Intergenic
1082650839 11:55790678-55790700 ATGGTGGAAATGTGGGAAATGGG - Intergenic
1082659877 11:55896686-55896708 GAGGATGAATAGTGGGATAGAGG + Intergenic
1082796791 11:57383663-57383685 GAGGAAGAATAATGGCAAATGGG - Intergenic
1083404135 11:62444961-62444983 GAGGAGGTAGTGTTGGTAATGGG - Intronic
1083424541 11:62576251-62576273 GAGGAGGAAGAGTGGGGAAAGGG + Intronic
1085835430 11:79950820-79950842 GTTGAGGAAGTGAGGGAAATCGG + Intergenic
1088027157 11:105199392-105199414 GAGGTGGAAGTGTGGGAAGGTGG - Intergenic
1088590298 11:111397165-111397187 GGGGAGGAATTGTGGGTATTTGG - Intronic
1089189252 11:116642137-116642159 GAGGTGGAATTGTGGGTGATGGG + Intergenic
1089242852 11:117097506-117097528 GAGGAGGCAATGAGGAAAATGGG - Intronic
1089460957 11:118653224-118653246 AAGGAGGAAATGTCAGAAATGGG + Intronic
1089974274 11:122718785-122718807 GTGGAGGAATTGTGTCAGATTGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091838967 12:3605521-3605543 GAGGAGGGATGGTGGGGAAGAGG + Intergenic
1092169897 12:6367621-6367643 GAAGAGGAATTGATGGAAAGGGG + Intronic
1092825874 12:12398321-12398343 GAGGAGGGATTGTGGGCAAAGGG + Intronic
1093362208 12:18243711-18243733 ATGGAGGAATTATAGGAAATGGG - Intronic
1094102027 12:26775053-26775075 GATGAGGACTTGGGGGAAAATGG - Intronic
1095527394 12:43143620-43143642 GAGGAGGACTTGTGGGATGTTGG - Intergenic
1097199941 12:57269816-57269838 GAGGTGGAATAGTTGGAAGTGGG + Exonic
1097416045 12:59317787-59317809 GAGGGGGAATTGTTGCAAAATGG + Intergenic
1097759986 12:63452395-63452417 GGGTAGGAATAGAGGGAAATGGG + Intergenic
1098037311 12:66317372-66317394 GAGGAGGAATTGACAGGAATAGG + Intronic
1098631873 12:72733003-72733025 GAGGAGGAAGTGTGATTAATAGG - Intergenic
1099110992 12:78560832-78560854 GAGGCGGAATGGTGGTGAATTGG - Intergenic
1099883938 12:88503712-88503734 GCGGAGGGATTGTGGGAGAAAGG - Intronic
1099906769 12:88780431-88780453 GAGGGAGAATGGTGGAAAATGGG - Intergenic
1100393674 12:94165879-94165901 GAGGAGGAAGTGAGGGAAGAGGG + Intronic
1100738203 12:97561736-97561758 GAGGAGGAACTGTGGGCTACTGG - Intergenic
1100887254 12:99084983-99085005 GATCAGGATTTGTTGGAAATTGG - Exonic
1101504264 12:105331279-105331301 GAGGAGCAAGTGTGGGAGGTGGG - Intronic
1102598063 12:114007949-114007971 AAGGAGGAAATGTGTGAAAATGG - Intergenic
1102688476 12:114742283-114742305 GGGGAGGAATTGTGGGGCAGAGG + Intergenic
1103120847 12:118377918-118377940 GAGAAGGGTTTGTGGGGAATTGG + Intronic
1103587997 12:121970481-121970503 GAGGAGGAATGGTCTGAACTTGG - Intronic
1104932906 12:132349303-132349325 GGATGGGAATTGTGGGAAATTGG - Intergenic
1104996869 12:132663587-132663609 GAGGGGCTATGGTGGGAAATGGG + Intronic
1105334224 13:19449891-19449913 GAGGAGGAAGGGTAGGAGATAGG - Intronic
1105860701 13:24409463-24409485 GAGGAGGAAGGGTGGGAGATAGG + Intergenic
1107070273 13:36261008-36261030 GATGAGGAAATCTGGGAAAGAGG + Intronic
1107320042 13:39176890-39176912 GAGAAGGAAGTGTGGAAGATAGG - Intergenic
1107488371 13:40854476-40854498 GAGGAGGAAGGGTAGGAGATAGG - Intergenic
1107888812 13:44896325-44896347 GAGGAGGAATTGGGGGAACGGGG - Intergenic
1107963980 13:45582977-45582999 TTTGAGGAATTGTGGGAAGTTGG - Intronic
1108285972 13:48908173-48908195 GAGGAGGAAGAATAGGAAATGGG - Intergenic
1108622829 13:52200795-52200817 CAGGAGGACTTATGGGAGATGGG + Intergenic
1108628188 13:52253560-52253582 GAGGAGGAAGAGTAGGAGATAGG - Intergenic
1108657871 13:52552889-52552911 GAGGAGGAAGAGTAGGAGATAGG + Intergenic
1108703530 13:52964307-52964329 AAGGAGGGGTTGGGGGAAATGGG + Intergenic
1109130257 13:58575529-58575551 GATGAGGAAATGTTGGAAACTGG - Intergenic
1109347661 13:61135348-61135370 TAGGAGGAGTTTTGGAAAATAGG + Intergenic
1109376864 13:61506926-61506948 GAGGAGGAATAGTGAGAAATTGG + Intergenic
1109732794 13:66437866-66437888 TAGGGGGAATTCTGGGATATTGG + Intronic
1110147921 13:72215926-72215948 AGGGAGAAATTGTGGAAAATTGG - Intergenic
1111614863 13:90650400-90650422 AAGGAGGAATTCTGGTATATAGG - Intergenic
1112127056 13:96479633-96479655 GAGGTGGAATTAAGAGAAATTGG + Intronic
1113411653 13:110095454-110095476 TAGAAGGAATTTTGGGGAATGGG - Intergenic
1114035013 14:18616044-18616066 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1114123632 14:19698972-19698994 CAGTAAGATTTGTGGGAAATGGG - Intergenic
1114545409 14:23496816-23496838 GAAGAAGAAATCTGGGAAATAGG + Intronic
1115046097 14:28996081-28996103 GAGGAGAAAGGGAGGGAAATAGG - Intergenic
1116144020 14:41040376-41040398 GAGGAGGAATGGTGAGTCATAGG + Intergenic
1117370287 14:55072274-55072296 GAAGAGGACTTGTGCGAACTAGG + Intergenic
1117755662 14:58971756-58971778 GAGGAGGACTTGGGGAAATTAGG - Intergenic
1118936952 14:70297205-70297227 AAGAAGGAAATGTGGGAAATGGG + Intergenic
1119339944 14:73868587-73868609 GAGGAGGAGTTTAGGGATATGGG - Intronic
1120737481 14:88069542-88069564 TAAGAGGAATTGTGGTAAACAGG - Intergenic
1122098207 14:99386794-99386816 GAGGAGGAGATGTGGGAGCTTGG - Intergenic
1122283631 14:100638571-100638593 GTGGAGGAGTCGTGGGCAATGGG - Intergenic
1124075892 15:26443846-26443868 GAGGCAGAGTTGAGGGAAATGGG + Intergenic
1124531138 15:30507686-30507708 GAGGAGGAAGTGTCAGATATGGG + Intergenic
1124767517 15:32500010-32500032 GAGGAGGAAGTGTCAGATATGGG - Intergenic
1125343273 15:38695226-38695248 GAGGCAGAAATGTGGGAACTTGG + Intergenic
1125535700 15:40440507-40440529 GGGGAGGATTTGGGGGAAAGGGG + Intronic
1126470755 15:49007738-49007760 GAGGAGGAATTGTTGGTAATAGG - Intronic
1127860742 15:62992329-62992351 TAAGAGGAATTATGTGAAATGGG - Intergenic
1128446879 15:67770463-67770485 GAGGAGGAATTCAGGAACATAGG + Intronic
1128908355 15:71489603-71489625 GAGGAGGAAATGTGGAGAAGCGG - Intronic
1129360405 15:75020690-75020712 GAGAAGGGAAGGTGGGAAATGGG - Exonic
1129877967 15:78989188-78989210 GAGGAGGGATTCTGGGAGCTGGG + Intronic
1130389021 15:83438580-83438602 GAGGAGGAATTCGGAGAAAAAGG - Intergenic
1130861493 15:87894798-87894820 GAGGAGGAAAGGTAGGAACTAGG - Intronic
1131084682 15:89566458-89566480 GAGTAGGAGTTGGGGGAAAGAGG - Intergenic
1131789016 15:95944315-95944337 GAGGAGGAATCAGGGGAGATGGG - Intergenic
1133141182 16:3745959-3745981 GTGGAGGATTCGTGGGGAATGGG - Intronic
1134369199 16:13607555-13607577 AGGGAGGAATTATGGGAAAGAGG + Intergenic
1134778732 16:16876075-16876097 GACTAGGAACTGTGGGAGATGGG + Intergenic
1134836440 16:17365202-17365224 GAGGAGGAAATGCTGGAAAGTGG - Intronic
1135099644 16:19594807-19594829 GAAGAGGAATGGAGGGAATTAGG + Intronic
1138601024 16:58054340-58054362 GATGAGAAATTGTGGGATGTAGG + Intergenic
1138882581 16:61033364-61033386 GAGCAAGAAGTGTGGGAAAAAGG - Intergenic
1139793215 16:69458288-69458310 GAGGACGAGTTGTGGGGAAATGG - Intronic
1141303187 16:82837147-82837169 GAGGGTGAATGGTGGGAAGTGGG + Intronic
1141894942 16:86953369-86953391 GAGGAGGAGTGGTAGGGAATGGG + Intergenic
1142307314 16:89293017-89293039 GAGGAGGACTTGAGGGCTATCGG - Intronic
1143613939 17:8038748-8038770 CAAGAAGAGTTGTGGGAAATGGG + Intergenic
1144141236 17:12350549-12350571 GAGGAGGAATTAGGAGAAAAGGG - Intergenic
1146296405 17:31653901-31653923 AGGGAGGAAATGAGGGAAATTGG - Intergenic
1146666213 17:34705764-34705786 GAAGAGGAATTGTGGGGAACTGG - Intergenic
1146833154 17:36088156-36088178 GAGGTGAAATGGAGGGAAATTGG - Intergenic
1146847675 17:36194769-36194791 GAGGTGAAATGGAGGGAAATTGG - Intronic
1146914003 17:36666504-36666526 GAGGAGGAAGAGAGGGAAAAAGG + Intergenic
1147332142 17:39705455-39705477 GGGGAGGAAGTGTGGGGAAGAGG + Intronic
1147662639 17:42125173-42125195 GTGGAGGGGTTGTGGGCAATGGG + Intronic
1148088855 17:45010554-45010576 GAAGTGCAATGGTGGGAAATGGG + Intergenic
1148258514 17:46158315-46158337 GAGGAGGGGTTGGGGGAATTGGG + Intronic
1153242468 18:3043258-3043280 GAGGAGGACTTGTGGGGAGGGGG + Intergenic
1153265975 18:3269801-3269823 GAGGAGGAAATCTTAGAAATAGG + Intronic
1153865183 18:9261077-9261099 GAGGAGGGAGTGAAGGAAATGGG - Intronic
1154959937 18:21297989-21298011 GAGGAGGAGTTTTAGGAAATGGG + Intronic
1155171194 18:23267807-23267829 GAGGAGGCCTTGTGGGGAAAAGG - Intronic
1156798579 18:41079675-41079697 GAGGAGGAAGGGTGGGAAGGAGG - Intergenic
1157168164 18:45377539-45377561 GAGGGGGAAATGAGTGAAATGGG - Intronic
1157349226 18:46870045-46870067 GAGGAGGAATTGAGTGAAGGGGG - Intronic
1158222922 18:55168781-55168803 GATGAGGAACTTTTGGAAATTGG + Intergenic
1158258103 18:55576296-55576318 TAGGAAGAATTTTGGGAAGTAGG + Intronic
1158676210 18:59520864-59520886 TAGGAGGCATTGTGCCAAATTGG - Intronic
1158813957 18:61071959-61071981 GAGGATGAAGTGTGGGAAGAGGG + Intergenic
1159273163 18:66180253-66180275 AAGGAGGAACTGGGAGAAATTGG - Intergenic
1160261107 18:77295068-77295090 AAGGAGGAATTTTAGGAAAAAGG + Intergenic
1160967448 19:1752964-1752986 GTGGAGGAAGTGGGGGAAAAGGG - Exonic
1161412149 19:4122965-4122987 GAGGAGGAAATCTGGGCAAGGGG - Intronic
1162404014 19:10462696-10462718 AAGGAGGAATTGGGGGAAATGGG - Intronic
1163148989 19:15400109-15400131 GAGGAGGAAGAGTGGGAAGGGGG + Intronic
1163201923 19:15775957-15775979 GAGGAGGAATTGTTGGAGCTGGG - Intergenic
1164158774 19:22612773-22612795 GAGGTGGGATCATGGGAAATTGG + Intergenic
1164172153 19:22734745-22734767 GGGGAGGGAGTGTGCGAAATAGG - Intergenic
1164218077 19:23168588-23168610 GGGGAGGGAGTGTGCGAAATAGG - Intergenic
1165619760 19:37235813-37235835 GAAAAGGAAGAGTGGGAAATTGG + Intronic
1166140888 19:40804555-40804577 GGGGATGAATTGTGGGAAGAGGG + Intronic
1166631474 19:44411168-44411190 GGGGAGTAATTGAGTGAAATTGG - Intergenic
1168130255 19:54313155-54313177 GAGGAGAAATGCAGGGAAATAGG + Intergenic
1168171604 19:54593621-54593643 GAGGAGAAATGCAGGGAAATAGG - Intronic
1168391137 19:56008860-56008882 GGGGTGGAGTTGGGGGAAATAGG + Intronic
925692769 2:6541878-6541900 AGGGAGGAATCATGGGAAATAGG - Intergenic
926657997 2:15430735-15430757 GAGGGGGAATGGTGGAAAAATGG - Intronic
928362875 2:30679743-30679765 GAGGAGGAAGAGTGGGAGAATGG - Intergenic
929002787 2:37364557-37364579 GGTGAGGAATGGTGGGAAACAGG + Intronic
930257865 2:49112400-49112422 GAGGAGGATTTGGGGAAAGTTGG + Intronic
930652129 2:53973077-53973099 GAGGAGGAGTTCTAGGAAACTGG + Intronic
930717739 2:54608577-54608599 GAGGGGGAGTGATGGGAAATAGG + Intronic
930767016 2:55094954-55094976 GAGGAGGACTTGTGTGGAGTAGG - Intronic
930955346 2:57196878-57196900 AAGAAGGAAATATGGGAAATGGG - Intergenic
931114288 2:59147932-59147954 TAAGAGGAACTGTGGCAAATAGG + Intergenic
931175249 2:59847868-59847890 GAGGAGGGATTGTGGGACCTGGG + Intergenic
931404140 2:61960212-61960234 GAGAAGGGATTGTGAGAAATGGG - Intronic
931997700 2:67854914-67854936 GTAGAGGGATTGTGGTAAATTGG - Intergenic
932053037 2:68417814-68417836 GAGGAGGAAATGGGGGAATGTGG + Intergenic
932363855 2:71133211-71133233 GAGGAGGAAGTGTCCGACATGGG + Exonic
932524727 2:72452496-72452518 GGGTATGAATTGTGGGAAAAAGG + Intronic
933649642 2:84840320-84840342 GAGAAGAGATTTTGGGAAATGGG - Intronic
938327196 2:130417564-130417586 CAGTAAGATTTGTGGGAAATGGG - Intergenic
938362742 2:130703913-130703935 CAGTAAGATTTGTGGGAAATGGG + Intergenic
938479601 2:131648313-131648335 GAGGAGAAAATGTGGGACTTTGG - Intergenic
938721571 2:134071715-134071737 GAGGAGGAAGGGTGAGAAATGGG - Intergenic
938841417 2:135168566-135168588 GAGGAGGAATTGAAGAGAATGGG + Exonic
939382873 2:141458812-141458834 GAGGAGGAACTTTATGAAATAGG - Intronic
939462901 2:142519619-142519641 GAGGAGGAATTGGGGGAGGAGGG + Intergenic
939490134 2:142867085-142867107 GAGTAGTAATTTTGGAAAATTGG + Intergenic
939616323 2:144365331-144365353 GAGGATGCATTGTGAGAAAGAGG - Intergenic
940189240 2:151021640-151021662 AAGGAGGAGTTGAGGGACATAGG - Intronic
941680631 2:168394740-168394762 GAGTAGGATTTTTGGAAAATGGG + Intergenic
942503050 2:176612140-176612162 GAGTGAGAATTGTGGGAAGTGGG - Intergenic
942963015 2:181854865-181854887 GAGGAGAAATTTTGAGCAATGGG + Intergenic
944228968 2:197374460-197374482 GAGGTGGAATTGTGTGAGCTTGG - Intergenic
944875864 2:203963702-203963724 AAGGAGGAAATGTGGGGAAATGG + Intergenic
945221961 2:207492734-207492756 GATGAGGAAGTGTGGGAGAAGGG - Intergenic
947044739 2:225968941-225968963 GAGGAAGAGCTGTGGGTAATTGG - Intergenic
947350949 2:229244457-229244479 GAGTTGGAATTTTGGAAAATAGG - Intronic
948537628 2:238657965-238657987 GGGGAGGAATTGGAGTAAATGGG + Intergenic
1169043891 20:2520648-2520670 GAGGAGAATCAGTGGGAAATGGG + Intronic
1169095150 20:2891160-2891182 TAGGAGAAATGGTGGAAAATAGG - Intronic
1169548551 20:6676727-6676749 GAAGAGAAATTGTAAGAAATTGG + Intergenic
1170437431 20:16345062-16345084 GAGGAGGTGTTCTGGGCAATGGG - Intronic
1170661825 20:18349356-18349378 GAAGAGGGTTTTTGGGAAATAGG + Intergenic
1170951780 20:20943247-20943269 GAGGAGGAAAGGCGGGAAAGGGG - Intergenic
1170956934 20:20989780-20989802 TAGGAGAAACTGTGGGAAAGGGG + Intergenic
1172998777 20:39090795-39090817 CAGGAAGGATTCTGGGAAATGGG - Intergenic
1173150039 20:40559208-40559230 GAGGAGGAATTGCTGGAAAAGGG - Intergenic
1174115702 20:48225026-48225048 GAGGAGGAAGTGGGGGAGAGTGG + Intergenic
1174299038 20:49568574-49568596 GAGGAGGGAATGTGGGAAGACGG + Intergenic
1174507952 20:51029047-51029069 GAGGAGGGATGGAGGGAGATGGG - Intergenic
1174760989 20:53207227-53207249 GAGAAGGAAGAGAGGGAAATTGG + Intronic
1176589034 21:8622444-8622466 GAGAAGGAGTTTTGGGAAATAGG - Intergenic
1176603072 21:8810209-8810231 GAGGAGTAACTGAGTGAAATTGG - Intergenic
1176738834 21:10578768-10578790 GAGGAGGAAGGGTAGGAGATAGG + Intronic
1176922223 21:14701686-14701708 GAGAAGGAATTGTAGGTTATTGG + Intergenic
1177149992 21:17445662-17445684 GAGGCGGAATTATGGGGGATTGG - Intronic
1177995708 21:28094610-28094632 CAGGAGTATTTGTTGGAAATTGG - Intergenic
1178093885 21:29193401-29193423 AGGGAGGAATTATGGGAAAGAGG + Intergenic
1178709544 21:34902839-34902861 CACTTGGAATTGTGGGAAATCGG + Intronic
1178759143 21:35383905-35383927 GATGAGGAAATATGGGATATAGG - Intronic
1178921390 21:36741004-36741026 GAGGTGGAATTGTGGTTTATGGG + Intronic
1179242320 21:39603190-39603212 GAGGAGGAAATTTGGGAAATGGG + Intronic
1179632048 21:42684642-42684664 AAGGAGGATGTGGGGGAAATGGG + Intronic
1179810581 21:43866583-43866605 GAGGAGGATTGGTTGGAAAGAGG - Intronic
1180118163 21:45725775-45725797 GAGGAGGAGGTGTTGGAACTGGG + Intronic
1180158927 21:45990458-45990480 GAGGAGGAATGGGGCGAGATGGG + Intronic
1180271858 22:10599441-10599463 GAGAAGGAGTTTTGGGAAATAGG - Intergenic
1180345358 22:11701766-11701788 GAGGAGTAACTGAGTGAAATTGG - Intergenic
1180352360 22:11815546-11815568 GAGGAGTAACTGAGTGAAATTGG + Intergenic
1180352385 22:11815690-11815712 GGGGAGTAATTGAGTGAAATTGG + Intergenic
1180352408 22:11815837-11815859 GAGGAGTAACTGAGTGAAATTGG + Intergenic
1180353130 22:11820007-11820029 GAGGAGTAACTGAGTGAAATTGG - Intergenic
1180385111 22:12172350-12172372 GAGGAGTAACTGAGTGAAATTGG + Intergenic
1180385849 22:12176520-12176542 GAGGAGTAACTGAGTGAAATTGG - Intergenic
1180459133 22:15543090-15543112 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1182180405 22:28341182-28341204 AAACAGGAATTGTGGGCAATTGG + Intronic
1182671059 22:31996456-31996478 GAGGAGGAATTCTAGGAAGAAGG + Intergenic
1183901554 22:41009706-41009728 CAGGAGGAAGTGTGGGCAATGGG + Intergenic
1184653966 22:45932004-45932026 TAGGAGGAAGTGAGGAAAATGGG - Intronic
949138284 3:599325-599347 GAGAAGGAGTTTTGGGAAGTAGG + Intergenic
950242685 3:11385863-11385885 GAGGACGATTTGTAGAAAATTGG - Intronic
951021639 3:17787297-17787319 GAGGAGGAAGAGAGGGAAGTGGG - Intronic
951244350 3:20323465-20323487 GAGGTGGAATTGTTGCAAAATGG + Intergenic
951749121 3:26014147-26014169 GAAAAGGAATTCTGGGAAACAGG - Intergenic
953006492 3:38984078-38984100 GAGAAGGAACAGTGGGAAAGAGG - Intergenic
953378621 3:42449332-42449354 GAGGAGAAAAGGTGGGAAATGGG + Intergenic
953628361 3:44589531-44589553 GTGGAGGAACTATGGGAACTAGG + Intronic
953651067 3:44804725-44804747 AAGGAGGAAAAGTGAGAAATGGG - Intronic
955163551 3:56488669-56488691 GGGGATTAATTGGGGGAAATGGG - Intergenic
955431594 3:58851174-58851196 GAGGAGTCATTGTGTGAAGTAGG + Intronic
955471193 3:59288080-59288102 GAGGAGAAATGGTAGGAGATGGG - Intergenic
956294839 3:67701165-67701187 GAGGAGGGAATGTTAGAAATGGG - Intergenic
956775960 3:72565727-72565749 GAGGTGAAATGGTGGGAGATGGG + Intergenic
956832168 3:73062210-73062232 GATGAGACATTGTGGAAAATTGG - Exonic
957550176 3:81694239-81694261 GAGGAGGAAGGGAGGGAAAAAGG + Intronic
959374586 3:105572809-105572831 GAGGAGGGAGTGGGGGAAACTGG - Intronic
960459967 3:117921614-117921636 GAGGAGGCAGTGTGGGAGGTAGG - Intergenic
960757422 3:121031232-121031254 GAGGATGCATTGTGGAAAATAGG + Intronic
960867740 3:122219055-122219077 AAGGAGGAATTGTATAAAATGGG + Intronic
961006702 3:123410335-123410357 GAGGAGGAATTGGGGGATAAGGG - Intronic
961644057 3:128383081-128383103 GAGGAGGCAGTGTGGGAAGTGGG - Intronic
962092915 3:132263806-132263828 TAGGAGAAGCTGTGGGAAATTGG - Intronic
963083130 3:141413079-141413101 GAGGAGGAATTGTGGGAAATGGG + Intronic
963644492 3:147896459-147896481 GAGGGGGAAGTGGGGGACATAGG - Intergenic
963830208 3:149999665-149999687 GAGGAGCCATTGTGAGCAATGGG + Intronic
964188642 3:153977370-153977392 GAGCAGAGATTGTGAGAAATTGG - Intergenic
966261670 3:177985569-177985591 GAGGAGCAAATATGGGAGATTGG + Intergenic
966266046 3:178044669-178044691 GAGAAGGGATTGGGGGAAGTAGG + Intergenic
966343012 3:178946190-178946212 AAGGAGGAATTATGGAAAGTTGG - Intergenic
966431245 3:179833090-179833112 GAGGATGGATTGTGGGCAGTAGG + Intronic
966763748 3:183439892-183439914 GAGGGTGAACTGTGGGAAAAGGG + Intergenic
967116362 3:186343090-186343112 TTGGAGGAATTCTGGGAACTGGG + Intronic
969633815 4:8353655-8353677 GAGGAGGAAGGGTTGGAAGTTGG + Intergenic
970267099 4:14300423-14300445 GAGGAAGGAGTGTGGGAAAGGGG - Intergenic
971077790 4:23169965-23169987 GAGGAGGAAATGTTGCAATTGGG - Intergenic
971444104 4:26723941-26723963 GAGCAGAAATTGTAGGAAGTTGG + Intronic
971897556 4:32617247-32617269 GAGGGGGAACTGTGGGTATTTGG - Intergenic
973385995 4:49514702-49514724 GAGGAGTAACTGAGTGAAATTGG - Intergenic
973954018 4:56045314-56045336 GAGGAGGAGTTGGGGGAAAATGG - Intergenic
974100679 4:57412643-57412665 AATGAGGAACTGGGGGAAATTGG - Intergenic
974659955 4:64874149-64874171 AAGGAGTAAATGTGGAAAATAGG + Intergenic
974797026 4:66766315-66766337 GATGAGGAATTGTTGGGAACCGG + Intergenic
974904909 4:68043492-68043514 GAGGGGAAAGTGTGGGTAATGGG - Intergenic
975172898 4:71253059-71253081 AAGGAGGAGTTGGAGGAAATGGG + Intronic
975868895 4:78756343-78756365 AAGGAGGTATTGGGGGAAAGAGG - Intergenic
976533584 4:86184999-86185021 GAGGAGAAATAATGGGAAAGGGG + Intronic
977319207 4:95489761-95489783 GAGGAGGAATTTTGGGGTAACGG + Intronic
978349685 4:107808585-107808607 GATTAAGAATTGTGGGAGATAGG - Intergenic
980400918 4:132284730-132284752 CAGGAGGAAGCGTGTGAAATGGG - Intergenic
980403563 4:132325375-132325397 GAGGAGGAATTGTGATATACTGG - Intergenic
980510591 4:133781485-133781507 GAAGAGGATTCATGGGAAATTGG + Intergenic
980707278 4:136515769-136515791 GTAGAGGAATTGTTGGAGATAGG + Intergenic
981095569 4:140775966-140775988 GAGGAGGGAATGTGGGAATGAGG - Intergenic
981756655 4:148147202-148147224 ATGGAGGAAAGGTGGGAAATAGG - Intronic
982226248 4:153170136-153170158 GAGGAGGAAGAGGGGGAAAAGGG + Intronic
982405703 4:155017642-155017664 GAGGAAGGAATGTGGGAATTTGG + Intergenic
982818430 4:159916409-159916431 GAGAATGAATAGTGGGAAGTGGG - Intergenic
982822162 4:159954765-159954787 GAAGAGGAATTGCGGGAATGGGG - Intergenic
983914533 4:173277997-173278019 GAGGAGAAATTTTAGGAAACTGG + Intronic
984853284 4:184172129-184172151 AAGGAAGAAGTGTGGGCAATGGG + Intronic
985147776 4:186911991-186912013 GAGGAGGAGGTTTGGGAAGTGGG - Intergenic
985282402 4:188300442-188300464 GAGGAGGGATGGGGGCAAATTGG - Intergenic
986347588 5:6848983-6849005 GAGGGGGAATAGGGGCAAATAGG + Intergenic
987312472 5:16694069-16694091 GAGGAAGAATGGTGTGAATTTGG - Intronic
989436549 5:41419994-41420016 GATGAGTAATTATGGGAAATGGG - Intronic
989991633 5:50774273-50774295 AAGGAGGAAATGTGGGGAAAAGG - Intronic
990650807 5:57897669-57897691 AAGGAGGAAATGGGGGAAAATGG - Intergenic
991058310 5:62343415-62343437 GAGGTGGTATTGTGTGAGATAGG + Intronic
992081573 5:73238669-73238691 GAGGAGGAATTTGGGGAAATGGG + Intergenic
992224862 5:74610595-74610617 CAGGAGCAATTGTGGGGAGTTGG - Intergenic
992250111 5:74867630-74867652 GAGCAGGAATTTTGGGTAGTTGG + Intergenic
992781122 5:80128866-80128888 GAGGAGCAATTGTGGAAGAGAGG - Intronic
992804098 5:80320021-80320043 GGGGAGGAAGGGTGGGAAAGGGG - Exonic
994516619 5:100780357-100780379 AAGGAGGAGTTGTAGGAAGTTGG - Intergenic
994581615 5:101649373-101649395 GAAGAGAAATTTTGGAAAATGGG + Intergenic
996513872 5:124348026-124348048 GAAATGGAATAGTGGGAAATAGG - Intergenic
996653127 5:125906100-125906122 GAAGAGGAAATATGGGACATTGG - Intergenic
997172451 5:131737139-131737161 AAGCAGGAATTGTAGGAAAAAGG - Intronic
998290716 5:140911427-140911449 GAGCTGAAATTGCGGGAAATTGG - Intronic
999484355 5:151980205-151980227 GAAGAGGAATGGTGAAAAATGGG + Intergenic
1000932626 5:167270490-167270512 AAAGAAGAATTGAGGGAAATAGG - Intergenic
1001038863 5:168317588-168317610 CAGGAGGCAATGGGGGAAATAGG - Intronic
1001261048 5:170228928-170228950 GAGGAGGTATTGTGGGGGAATGG + Intergenic
1001667677 5:173446841-173446863 AAGGAGGAAGTGTTGGAAGTTGG + Intergenic
1003872214 6:10412452-10412474 GAGGAGGAAGGGAGGGAAAGAGG + Intronic
1004285985 6:14321404-14321426 CAGGAGGAAAGGGGGGAAATTGG - Intergenic
1004303256 6:14477244-14477266 GAGGAGGAAATGTGGGAGCGGGG + Intergenic
1006046742 6:31305429-31305451 GAGGAGGAAGTGTGGGGTGTGGG + Intronic
1006392424 6:33766386-33766408 CAAGAGGTATTGTGGGAACTGGG - Intergenic
1006417934 6:33915899-33915921 GAGGAGTAACTGTGGGGACTTGG + Intergenic
1006800451 6:36756447-36756469 AAGGAGGATTTGTGGGAGACTGG + Intronic
1007111240 6:39314442-39314464 GAGGAGGAGTGTTGGGGAATGGG + Exonic
1007452106 6:41947940-41947962 GAGGGAGAGTAGTGGGAAATGGG - Intronic
1008131036 6:47720377-47720399 TAGGCAGAATTCTGGGAAATGGG + Intronic
1008558594 6:52700600-52700622 GAGGTAGGGTTGTGGGAAATAGG + Intergenic
1008631235 6:53364365-53364387 GCTGAGGAATAGTGGGAAACAGG + Intergenic
1009355486 6:62739686-62739708 GAGGGGGAATAATGGGCAATAGG + Intergenic
1010018569 6:71134133-71134155 AAGGAGGAAGTGTGGGCAAGTGG + Intergenic
1010163757 6:72890959-72890981 GTGGAAGAATTTTGGGAAATGGG + Intronic
1011132321 6:84064325-84064347 GGGGAGCAATGGTGAGAAATGGG - Intronic
1012182576 6:96172994-96173016 GAGGAAGACTTGTAGAAAATGGG + Intronic
1013242007 6:108254859-108254881 GAGGAGGAAGTGTGTGCAAAAGG + Intronic
1014247805 6:119085422-119085444 GATGAGGAATTATTGGAAACTGG - Intronic
1014706133 6:124749843-124749865 AAGGGGAAATAGTGGGAAATGGG - Intronic
1014904233 6:127007057-127007079 GAGGAGGAAATGTGGTAAAGAGG - Intergenic
1014905708 6:127024434-127024456 GAGTAGGCATTTTGGGAAACTGG + Intergenic
1015141889 6:129943929-129943951 GACCAGGAACTGTGGGAACTAGG + Intergenic
1016254035 6:142082363-142082385 TAGGAGCAATTGTGGTAAAGTGG + Intronic
1018227500 6:161642699-161642721 GTGGAGGAATTGGGAGAAGTTGG + Intronic
1018351076 6:162959676-162959698 GAGGAGCAAGTGTAGGAAAAAGG + Intronic
1018815452 6:167327019-167327041 GAGTAGGTATTGGGGGAAAGAGG + Intronic
1022267857 7:28775207-28775229 CAGGAGGGATTGTGGGCAACGGG - Intronic
1023218060 7:37886615-37886637 GGGGAGGAATTGTGGGATAGAGG - Intronic
1023521677 7:41055929-41055951 GAGGAGGTATTGGTGGAAAATGG - Intergenic
1023528223 7:41127470-41127492 GAGGAGGAATTGAGGAAATGTGG - Intergenic
1024475806 7:49808721-49808743 CAGAAGGAAATCTGGGAAATTGG + Intronic
1027444204 7:78253962-78253984 GAGTATAAATTGTGGGAATTAGG + Intronic
1029209288 7:98892671-98892693 GTGGAGGAAATGGGGGAAAAGGG - Intronic
1029290577 7:99499591-99499613 GAGGTGGGAGTGTGGAAAATAGG - Intronic
1030346364 7:108437274-108437296 GAGTGGGAAGTGGGGGAAATGGG + Intronic
1031521842 7:122776771-122776793 GATGAGGAATAGTTGGAATTTGG + Intronic
1032169305 7:129571184-129571206 GAGGTGGAATTCTGGGGAGTGGG - Intergenic
1032619038 7:133509021-133509043 GAGGAGAAAAGGTGGGTAATTGG - Intronic
1033600652 7:142886095-142886117 GAAGAGGCACTGTGGGAAAGTGG - Intergenic
1034300745 7:150013429-150013451 TGAGAGGAAGTGTGGGAAATGGG - Intergenic
1034473344 7:151268361-151268383 GGGGAGGAGATGTGGCAAATCGG - Intronic
1034805305 7:154083871-154083893 TGAGAGGAAGTGTGGGAAATGGG + Intronic
1035140318 7:156753017-156753039 ACTGAGGAATTGTAGGAAATGGG + Intronic
1035263414 7:157675615-157675637 GAGGAGGAAGTGTGCGGAAACGG + Intronic
1037000901 8:13717570-13717592 TAGGGGGAATTGATGGAAATAGG + Intergenic
1038125258 8:24666424-24666446 GAAGAGGAATAGAGGGAAATGGG - Intergenic
1040807926 8:51415205-51415227 CAGTAGGAATTGTAGAAAATTGG + Intronic
1040908195 8:52490711-52490733 GATGTGGAGTTGGGGGAAATGGG + Intergenic
1041160322 8:55035360-55035382 GAGGAGGACTTTTAGCAAATAGG + Intergenic
1042619905 8:70693755-70693777 ATGGGGGACTTGTGGGAAATTGG + Intronic
1043085713 8:75828620-75828642 TAGGAGGGATTTTAGGAAATCGG - Intergenic
1043486455 8:80703137-80703159 GCAGAGGACTTGTGGGAAAATGG - Intronic
1043755274 8:83995597-83995619 GAGGTGGAAGTGTTGCAAATGGG + Intergenic
1044647257 8:94457229-94457251 AAGGAGGAAGTGGGGAAAATAGG + Intronic
1044800034 8:95944839-95944861 AAGGAGGAATTGAGAGTAATGGG - Intergenic
1045154219 8:99449015-99449037 GAGGATGGATTGGGGGTAATTGG + Intronic
1045832646 8:106482369-106482391 GATGAGGCAGTGTGGGATATTGG + Intronic
1047757795 8:127931990-127932012 GAGGAGGAAATGGGGCAAAGAGG - Intergenic
1047825344 8:128567526-128567548 GAGGAGGAAAGGAGGGAGATGGG + Intergenic
1048117859 8:131545444-131545466 AAGGAGGAATCATGGGAAAGAGG - Intergenic
1048462030 8:134628999-134629021 GAGCATGAATTGGGGTAAATAGG + Intronic
1049055382 8:140232370-140232392 GAGGAGGAACTGGGGGAACCTGG + Intronic
1050042637 9:1512089-1512111 AAGAAGGAATTCGGGGAAATGGG + Intergenic
1050542370 9:6681458-6681480 GAGGAGGAAGTGGCGGAAGTGGG - Intergenic
1050633404 9:7583954-7583976 GAAGAGGGATTGTTGGAGATGGG + Intergenic
1051048086 9:12899636-12899658 TAAAAGGAATTGTGGTAAATAGG + Intergenic
1051698538 9:19794451-19794473 GAGGGGGAAGTGTGGGAGAAGGG + Intergenic
1051851625 9:21516154-21516176 GGAGTGGAATTTTGGGAAATAGG - Intergenic
1052091214 9:24329874-24329896 GGGGTGGAATAGTGGGGAATTGG + Intergenic
1052163094 9:25289980-25290002 GAGGAGGAATTCTGGGCTGTGGG - Intergenic
1052540376 9:29804087-29804109 GAGGAAGGACTGTGGGAAATTGG - Intergenic
1053602782 9:39627566-39627588 AAGGAAGAATTATGGTAAATAGG - Intergenic
1054250755 9:62714870-62714892 AAGGAAGAATTATGGTAAATAGG + Intergenic
1054564864 9:66749382-66749404 AAGGAAGAATTATGGTAAATAGG + Intergenic
1055836258 9:80446518-80446540 GAGTAGGAATAGTGGGTAAATGG - Intergenic
1055955641 9:81770820-81770842 GAGGAGTAATTGAGTGAACTTGG + Intergenic
1056439111 9:86602831-86602853 GCAGTGGAATTGTTGGAAATGGG + Intergenic
1056597200 9:88017260-88017282 GAGGAGGAGTGTTGGGAAAGAGG - Intergenic
1056641804 9:88377885-88377907 GAGGAGGAATTTTGAGATATAGG - Intergenic
1056726399 9:89122805-89122827 GAGTAGGAATTGTGGGAAGGAGG + Intronic
1056885121 9:90434273-90434295 AATGAGGAATTGTGTAAAATTGG - Intergenic
1057760409 9:97869270-97869292 GAGGAGGAATTAGGTGAATTAGG + Intergenic
1059700156 9:116768194-116768216 GAGGATGAGTGGTGAGAAATTGG - Intronic
1059774346 9:117460704-117460726 GAGGAGGAGGGGTGGGAAAGAGG + Intergenic
1059938676 9:119336762-119336784 GAGGGTGAATTGTGGGGAATGGG + Intronic
1060004259 9:119985758-119985780 GAAGAGGAAGGGTTGGAAATTGG - Intergenic
1060207090 9:121688517-121688539 GGGGAGGAATTGTGGGTAGAAGG - Intronic
1060684427 9:125595756-125595778 GAGGAGCCATTGTGAGCAATGGG + Intronic
1060803175 9:126557432-126557454 GAGGAAGAAGTGTGAGGAATGGG - Intergenic
1061918378 9:133769062-133769084 GAGGAGGAGCTGTGGGACTTGGG - Intronic
1203698678 Un_GL000214v1:118400-118422 GAGGAGTAACTGAGTGAAATTGG + Intergenic
1203699627 Un_GL000214v1:124698-124720 GAGGAGTAACTGAGTGAAATTGG + Intergenic
1203701490 Un_GL000214v1:137000-137022 GAGGAGTAACTGAGTGAAATTGG + Intergenic
1203480326 Un_GL000224v1:5584-5606 GAGGAGTAACTGAGTGAAATTGG + Intergenic
1203481293 Un_GL000224v1:11912-11934 GAGGAGTAACTGAGTGAAATTGG + Intergenic
1203482257 Un_GL000224v1:18221-18243 GAGGAGTAACTGAGTGAAATTGG + Intergenic
1203548844 Un_KI270743v1:152085-152107 GAGGAGTAACTGAGTGAAATTGG + Intergenic
1203549599 Un_KI270743v1:156464-156486 GAGGAGTAACTGAGTGAAATTGG - Intergenic
1203550540 Un_KI270743v1:162629-162651 GAGGAGTAACTGAGTGAAATTGG - Intergenic
1203569918 Un_KI270744v1:120935-120957 GAGGAGTAACTGAGTGAAATTGG + Intergenic
1203619040 Un_KI270749v1:101024-101046 GAGAAGGAGTTTTAGGAAATAGG - Intergenic
1186412475 X:9356138-9356160 GAGGAAAAATTGTGGGAAATAGG + Intergenic
1187087744 X:16059331-16059353 GGGGAGGAGTGGTGGGGAATAGG + Intergenic
1187539485 X:20177845-20177867 GAAGGGGAACTGTGGGAAAGAGG + Intronic
1187786267 X:22890448-22890470 GAGGAGAAATATTGGAAAATGGG + Intergenic
1187946924 X:24435137-24435159 GATTAGGAATTGGGGGTAATGGG + Intergenic
1188865634 X:35310134-35310156 AAGGAGGAAGTGAGGGAAACGGG + Intergenic
1188918251 X:35939043-35939065 GGAGAGGAATTGTGAAAAATGGG + Intronic
1193872713 X:86821303-86821325 CCAGAGGAATTGTGGGAAGTAGG + Intronic
1194626970 X:96236756-96236778 TAAGAGTAATTGTGGGAATTAGG - Intergenic
1195501970 X:105612690-105612712 GTGCAGGAATTGTGAGACATTGG + Intronic
1195598102 X:106715989-106716011 GAGGAGGAGTAGTGGGAGATTGG - Intronic
1195668009 X:107448287-107448309 GAGGGGCAATTGTGGGACAAGGG - Intergenic
1196763353 X:119220871-119220893 GAGGAGCCATTGTGAGCAATGGG + Intergenic
1196898304 X:120359501-120359523 GAGGGGGAATTTTGGGCACTGGG + Intergenic
1197902961 X:131393132-131393154 GATGAGGGAGTGTGGGCAATGGG - Intronic
1198463306 X:136883237-136883259 GAGGAGCAAGTTTGGGATATAGG + Intergenic
1199282103 X:146013988-146014010 GAGGAGGGAGGGAGGGAAATGGG + Intergenic
1199362597 X:146940840-146940862 GAGGAGGTAGAGTGGTAAATCGG - Intergenic
1199816720 X:151403996-151404018 GAGGAGGAATTTTGGGGGAATGG + Intronic
1201290893 Y:12420585-12420607 GAGGAGGAATTGCGGGGCGTGGG - Intergenic
1201670033 Y:16509644-16509666 GAGGGGAAATGGTGGGAAAGTGG - Intergenic
1202246287 Y:22823575-22823597 GAGAAGGCATTGTGGCATATTGG + Intergenic
1202399275 Y:24457323-24457345 GAGAAGGCATTGTGGCATATTGG + Intergenic
1202471505 Y:25212763-25212785 GAGAAGGCATTGTGGCATATTGG - Intergenic
1202597570 Y:26558298-26558320 GAGGAGGAAGAGTAGGAGATAGG + Intergenic