ID: 963085979

View in Genome Browser
Species Human (GRCh38)
Location 3:141436903-141436925
Sequence ATTTGCTGCATGGCTTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963085976_963085979 -9 Left 963085976 3:141436889-141436911 CCTGTGGGGACCGGATTTGCTGC 0: 1
1: 0
2: 1
3: 3
4: 69
Right 963085979 3:141436903-141436925 ATTTGCTGCATGGCTTACAGTGG 0: 1
1: 0
2: 0
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963085979 Original CRISPR ATTTGCTGCATGGCTTACAG TGG Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
902046902 1:13531339-13531361 CTTTGCTGCAAGGCTTAGATTGG + Intergenic
902217785 1:14945393-14945415 ATTTGGGGCTTGGCTTCCAGAGG + Intronic
904538715 1:31218439-31218461 ATTTGCTGGATGGCTCTAAGAGG + Intronic
904906882 1:33904177-33904199 ATCTGCAGAATGGATTACAGAGG + Intronic
908485750 1:64591164-64591186 ATATGCAGCAAGACTTACAGAGG + Intronic
909212691 1:72844574-72844596 AAATGATGCATGGCTTCCAGTGG + Intergenic
912463985 1:109856810-109856832 ATTTGCTTCAAGTCTGACAGGGG + Intergenic
912726917 1:112067018-112067040 ATTAGCGGCATTGCTGACAGAGG + Intergenic
917649982 1:177066778-177066800 ATTCACTGGATGGCTTAGAGTGG + Intronic
917801642 1:178576218-178576240 AATAGCTGCACTGCTTACAGAGG - Intergenic
918824634 1:189308009-189308031 ATATGCTCCATGACTTACAGTGG - Intergenic
1063056413 10:2509609-2509631 TCTTGCTGTCTGGCTTACAGGGG + Intergenic
1065638084 10:27751752-27751774 ATTTGCTGCTCGGCTGACATGGG - Intergenic
1074746614 10:116540513-116540535 CTTTGCTTCATGCCTTACAAGGG + Intergenic
1074833069 10:117263445-117263467 ATTAGCTGCATGGGTGACACAGG + Intronic
1080614379 11:33933210-33933232 ATTTGCTGAATGAATAACAGAGG - Intergenic
1081454470 11:43207309-43207331 ATCTTCTGCATGGCTCACACTGG + Intergenic
1081846890 11:46247167-46247189 ATTTTCAGCTTGGCTTGCAGAGG - Intergenic
1081978138 11:47248792-47248814 GTTTGCTGCATAGATTACAACGG - Exonic
1082185874 11:49180884-49180906 ATTTGTAAAATGGCTTACAGAGG + Intronic
1082240515 11:49864801-49864823 ATTTGTAAAATGGCTTACAGAGG - Intergenic
1083725549 11:64626144-64626166 ATTTACTGCCGGGCTCACAGTGG + Intronic
1086680456 11:89664486-89664508 ATTTGTAAAATGGCTTACAGAGG - Intergenic
1087503900 11:98996492-98996514 ATCTTCTGCATCGCTTACACCGG - Intergenic
1094007368 12:25769775-25769797 ATTTACTGCGGGGCTTTCAGTGG - Intergenic
1098441247 12:70521408-70521430 ACTTGCTTCATGCCCTACAGAGG - Exonic
1098638710 12:72815110-72815132 ATTTTATTTATGGCTTACAGAGG - Intergenic
1100652898 12:96610465-96610487 ATTTTCTGCATTGCTCACACTGG - Intronic
1101760849 12:107657636-107657658 ATGTGCTCCAGGACTTACAGAGG + Exonic
1103189205 12:118986365-118986387 ATTTGTTGAATGGGATACAGGGG + Intronic
1105738087 13:23293009-23293031 ATTTCCTGCTTGGCATAGAGAGG - Intronic
1107512707 13:41100702-41100724 ATTTTCTGCATGTTTTACATTGG + Intergenic
1113351736 13:109536106-109536128 ACTTGCTGCCTCGCTTAGAGAGG + Intergenic
1113433277 13:110268640-110268662 ATTGGCTGCATGGCTTGCCAAGG + Intronic
1114940572 14:27605242-27605264 ATTTGCTTCCTGGCTTGCAAAGG + Intergenic
1118417412 14:65556800-65556822 ATTTGCTGCATGGTATGCTGAGG + Intronic
1120813946 14:88833802-88833824 ATTTGCTGCATATCTTCCTGTGG + Intronic
1122049314 14:99044364-99044386 TTTTGCTGCATGTCTGACACTGG - Intergenic
1123859815 15:24453497-24453519 ATTTGCTGCATGTCTTTCTCAGG + Intergenic
1124061305 15:26296081-26296103 ATTTGCTGCTTGTTTTAAAGTGG + Intergenic
1125973036 15:43927582-43927604 ATATGCTGCATGGGATAGAGTGG - Intronic
1128914141 15:71544262-71544284 ATTTGCTCCATGTCACACAGCGG - Intronic
1130509583 15:84578077-84578099 ATTAGCTGCTTGGCTTTCTGTGG - Intergenic
1133974305 16:10589578-10589600 ATTTGCTGAAAGGATTAAAGCGG - Intergenic
1133992752 16:10722185-10722207 AAGTGCTGTATGGCTTACAGAGG + Intergenic
1135910499 16:26556383-26556405 ATGAGCTGCATGGATTACAGAGG - Intergenic
1140836643 16:78800605-78800627 CTTTGCTAAATGGCTTGCAGTGG + Intronic
1144110513 17:12026863-12026885 ACTTGCTGGAGGGTTTACAGTGG + Intronic
1157946412 18:51985715-51985737 ATTTGCTGCATCTTTGACAGTGG - Intergenic
1157953090 18:52062298-52062320 ATTTACTGCATAGGTTATAGTGG + Intergenic
1159653649 18:71006146-71006168 ATCTGCTTCATGGCTTACATTGG - Intergenic
1164780939 19:30892034-30892056 ATTTGCTGGATGGATTACAATGG + Intergenic
1164985831 19:32647799-32647821 ACTCCCTGCATGGCTTACTGTGG - Intronic
1168275205 19:55274195-55274217 ATCTGCTGCCTGGCTAGCAGGGG + Intronic
927530841 2:23798645-23798667 ATTTGCAGCATATTTTACAGTGG - Intronic
927844154 2:26462737-26462759 ATTTGCTGCATGATTTGCTGGGG + Intronic
933453974 2:82497795-82497817 ATATGCTGCATCACTTGCAGAGG + Intergenic
933875426 2:86615850-86615872 ATTAGCTGCAGGGACTACAGTGG - Intronic
942924968 2:181420703-181420725 AGTAACTGCATGGCCTACAGGGG - Intergenic
943944121 2:194036614-194036636 ATTTGCTTCGTGGCTTAAAGAGG - Intergenic
946854588 2:223940277-223940299 ATTTACTGCATGCATCACAGTGG - Intronic
949006650 2:241653208-241653230 ATTTTCTGGATGACTTACGGGGG + Intronic
1169854614 20:10089515-10089537 ATTTGCTGTCTGGATTACTGAGG - Intergenic
1170918852 20:20656447-20656469 ATTTGGTGTCTGGCTTACAAAGG - Intronic
1171947789 20:31393674-31393696 ATTTCCTCCATGCCTGACAGGGG - Intergenic
1172324408 20:34023443-34023465 ATATGCTGCCTTCCTTACAGAGG + Intronic
1177759653 21:25388896-25388918 GTTTGCCGCATGGCTTACTTTGG + Intergenic
1178007908 21:28243621-28243643 TTTTTCTGAATGTCTTACAGTGG + Intergenic
1178673351 21:34611838-34611860 ACTTGCTGCAAGGCTTACCAAGG + Intronic
1178691638 21:34754887-34754909 ACTTGCTGCAGGGCTTAGCGCGG + Intergenic
1178940257 21:36899672-36899694 ATTTGTTGAATGGATGACAGAGG - Intronic
1182080254 22:27523811-27523833 AGATGCTGCCTGGCTCACAGGGG - Intergenic
949954504 3:9256572-9256594 ATTTGCAGCATGGCTTCCACTGG + Intronic
951146054 3:19228931-19228953 CTTCGCTGCATGACTTGCAGTGG - Intronic
956018701 3:64911134-64911156 ATTTGCTGCATGCCTACCACTGG - Intergenic
956766864 3:72491503-72491525 ATGTGCTGCATGGCCAAGAGGGG - Intergenic
958500313 3:94897390-94897412 ATTCACTGCATGTCTTACAAAGG - Intergenic
959015050 3:101124291-101124313 ATTTGCTGTGCGGCTTTCAGTGG - Intergenic
960473812 3:118099332-118099354 ATCAGCTGCCTGGCCTACAGTGG + Intergenic
962602860 3:137007858-137007880 ATCTTCTGCATGGCTCACACTGG + Intronic
963085979 3:141436903-141436925 ATTTGCTGCATGGCTTACAGTGG + Intronic
964972739 3:162581242-162581264 ATTTGTTGAATGAGTTACAGAGG - Intergenic
966332185 3:178826516-178826538 ATTTACTACATGGCTTACTGAGG - Intronic
968430046 4:551494-551516 AGATGCTCCATGACTTACAGTGG + Intergenic
970558739 4:17261481-17261503 ATTTGCTGAATGCCTGACACAGG - Intergenic
974814812 4:66990164-66990186 ACTTGCTGTATGGATTAGAGTGG - Intergenic
978130648 4:105192431-105192453 ATTTAAAGCAGGGCTTACAGAGG - Intronic
984491841 4:180443996-180444018 ATATGCTGCATTGATAACAGGGG + Intergenic
986001695 5:3635499-3635521 ATTCGCTGCATTGCAGACAGCGG - Intergenic
987896174 5:23950172-23950194 ATTTGCTCTCTGGCTTACGGTGG + Intergenic
992034425 5:72758577-72758599 ATTTGCTTCAAGTCCTACAGAGG - Intergenic
993136791 5:83978539-83978561 ATTTGCTGCATGGCTAGTGGTGG + Intronic
994634570 5:102328174-102328196 ACATGCTGCGTTGCTTACAGTGG - Intergenic
994849170 5:105032155-105032177 TTTTGCTACATTGCTCACAGAGG + Intergenic
996191943 5:120555452-120555474 ATCTGCTTCCTGGCTTACAGAGG + Intronic
998776523 5:145609768-145609790 ATTTCCTGCCTGGCTACCAGTGG + Intronic
1001646559 5:173286459-173286481 ATTTGCTAGATTGCTTGCAGGGG + Intergenic
1003203565 6:3986855-3986877 ATTTGCAGGATGGCTAATAGTGG - Intergenic
1003252431 6:4442022-4442044 TTTTGCTGCATGAGTTTCAGAGG + Intergenic
1005686812 6:28261117-28261139 ATTTTCTGCATGGCTTTAATTGG + Intergenic
1005889209 6:30122799-30122821 ATTTACTGCCTGGCTCTCAGTGG - Intergenic
1006891887 6:37435739-37435761 TTTTGCTCCATGACTGACAGAGG - Exonic
1007129082 6:39452765-39452787 TTTTGTTGCTTGGCTTACACTGG - Intronic
1009696469 6:67111048-67111070 ATTTCATTCATGGCTTACAAGGG + Intergenic
1016387133 6:143539483-143539505 CCATCCTGCATGGCTTACAGAGG - Intronic
1016489669 6:144583539-144583561 TTTTGTTGCATCGCTTACAAAGG + Intronic
1019527111 7:1485362-1485384 ATGTGCTGCAGGGCTATCAGTGG - Exonic
1022604726 7:31799611-31799633 ACTTGCTACATGGCTCACAGTGG - Intronic
1024971637 7:55077179-55077201 ATTTTCTGCTAGGCTTACAAAGG - Intronic
1026249072 7:68651507-68651529 AGTTGCTCCATGTCTTATAGGGG + Intergenic
1040432319 8:47355651-47355673 TTTTTCTGCATGGGTTACATTGG + Intronic
1040744112 8:50619429-50619451 ATAAGCTACATGGCTCACAGGGG + Intronic
1042572667 8:70183856-70183878 ATTTGCTGCCTGGCACATAGTGG + Intronic
1046685101 8:117216027-117216049 ATTTGTTTTCTGGCTTACAGTGG - Intergenic
1050092527 9:2029218-2029240 ATTTGATGCATGCCTTCCTGTGG - Exonic
1050685012 9:8158594-8158616 ATTTTCTGCATGTCTAGCAGAGG - Intergenic
1052782786 9:32797752-32797774 TTTTGGTGCATGGATTGCAGTGG + Intergenic
1057980823 9:99661119-99661141 AGCTAGTGCATGGCTTACAGTGG - Intergenic
1059421407 9:114194750-114194772 ATGTCCTGCATGGCTTTCTGCGG + Intronic
1060934763 9:127508534-127508556 ATTTGCTGCAGGGCATACCGCGG + Exonic
1188967660 X:36574803-36574825 ATTTGTTGAATGTCTTACTGAGG - Intergenic
1191040017 X:56068852-56068874 ATTACCTGCATGGCTATCAGTGG - Intergenic
1193374763 X:80745947-80745969 ATATTCTGCTTGGCTTACTGTGG + Intronic
1195114705 X:101685505-101685527 ATATGCTGGATGGATTACATTGG + Intergenic
1201404437 Y:13635635-13635657 ATTTGCTGCAGGGGGTCCAGGGG - Intergenic
1202027457 Y:20539796-20539818 TTTTGCTGCAAGGCATACTGTGG + Intergenic