ID: 963091079

View in Genome Browser
Species Human (GRCh38)
Location 3:141484678-141484700
Sequence TCAGTGTGGCTGGAGATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1586
Summary {0: 1, 1: 0, 2: 8, 3: 89, 4: 1488}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963091070_963091079 21 Left 963091070 3:141484634-141484656 CCAAGCAGGAGGAAGGCCAGAAT 0: 1
1: 0
2: 1
3: 24
4: 255
Right 963091079 3:141484678-141484700 TCAGTGTGGCTGGAGATCAGAGG 0: 1
1: 0
2: 8
3: 89
4: 1488
963091073_963091079 5 Left 963091073 3:141484650-141484672 CCAGAATCAGGCTGGTGAGAAAA 0: 1
1: 0
2: 0
3: 19
4: 208
Right 963091079 3:141484678-141484700 TCAGTGTGGCTGGAGATCAGAGG 0: 1
1: 0
2: 8
3: 89
4: 1488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963091079 Original CRISPR TCAGTGTGGCTGGAGATCAG AGG Intergenic
900005074 1:39864-39886 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
900167912 1:1251391-1251413 TCAGCCAGGCTGGAGAGCAGTGG + Intergenic
900252270 1:1677186-1677208 TCACTGAGGCTGGAGTGCAGTGG - Intronic
900262680 1:1740044-1740066 TCACTGAGGCTGGAGTGCAGTGG - Intronic
900705799 1:4079323-4079345 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
900828265 1:4944269-4944291 TCACCGAGGCTGGGGATCAGTGG + Intergenic
901015377 1:6226417-6226439 ACTGTTTGGCTGGAGATCAGTGG - Intronic
901073496 1:6536490-6536512 TCACTGAGGCTGGAGTACAGTGG - Intronic
901172138 1:7266852-7266874 TCTGTGGGCCTGGAGAGCAGTGG + Intronic
901245835 1:7730320-7730342 ACCGTGTGGCTGGAGCACAGAGG - Intronic
901360877 1:8698956-8698978 TCACTCTGGCTGGAGTGCAGTGG + Intronic
901376186 1:8841192-8841214 TCAATGAGGCTGGAGAACAGTGG - Intergenic
901383037 1:8887742-8887764 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
901667450 1:10834906-10834928 TCAGAGTGGGTGGGGCTCAGGGG - Intergenic
901737641 1:11322475-11322497 TCAGGGGAGCTAGAGATCAGGGG - Intergenic
901864356 1:12094418-12094440 CCAGTGTGGCTAGAGATCAGAGG + Intronic
902136274 1:14308786-14308808 TCAGTATGGGTGAAGGTCAGTGG + Intergenic
902263005 1:15240915-15240937 TCAGCCTGGCTGGAGTGCAGTGG - Intergenic
902406325 1:16185613-16185635 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
902477421 1:16695561-16695583 TCACTGAGGCTGGAGTACAGTGG - Intergenic
902539712 1:17145541-17145563 CCAGCGTGGCTGGAGAGAAGTGG - Intergenic
902644237 1:17787302-17787324 TCACTGGGGCTGGAGTGCAGTGG + Intronic
902771693 1:18648882-18648904 GCAGAGGGGCTGGAGAGCAGAGG + Intronic
903085111 1:20849866-20849888 TCAGTGTGGCTCAAGCTTAGTGG - Intronic
903208890 1:21804235-21804257 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
903560735 1:24225107-24225129 TCAGTCAGGCTGGAGTACAGTGG + Intergenic
903642480 1:24869478-24869500 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
903781222 1:25821030-25821052 CCAGTGTGGCTGGAGGGCAAGGG + Intronic
903801788 1:25974288-25974310 TCACTGTAGATGGAGCTCAGTGG + Intronic
903873645 1:26456430-26456452 TCACTCAGGCTGGAGTTCAGTGG + Intronic
903901945 1:26653299-26653321 TCATTCAGGCTGGAGAACAGTGG + Intergenic
904024867 1:27496435-27496457 TCTGTTTGGCTGGAGTGCAGTGG - Intergenic
904186760 1:28711491-28711513 TCACTGAGGCTGGAGTGCAGTGG + Intronic
904255418 1:29251545-29251567 TCAGTCTGGCTGGGGATCATAGG + Intronic
904263844 1:29306619-29306641 TCTGGGTGGCTGGAGAGGAGAGG + Intronic
904470530 1:30732943-30732965 TCAGTGTGGCTGCATAACAGTGG - Exonic
904522088 1:31103336-31103358 TCACTGGGGCTGGAGTGCAGTGG - Intergenic
904930582 1:34083877-34083899 CTAGTGAGGCTGGAGAGCAGTGG - Intronic
905127253 1:35724357-35724379 CCAGTGTGGCTGGAGCTCGGTGG + Intronic
905529519 1:38666081-38666103 TGAGTGTTGCTAGAGATGAGTGG + Intergenic
905760571 1:40553907-40553929 TCACTGCAGCTGGAGAGCAGAGG + Intergenic
905760575 1:40553942-40553964 TCACTGCAGCTGGAGAGCAGAGG + Intergenic
905807617 1:40888263-40888285 TCAGTGTGGCTGGAGTTGGGGGG - Intergenic
905985311 1:42275620-42275642 TCAGCCTGGCTGGAGTTCAGTGG - Intronic
906165707 1:43684598-43684620 TCAGTGTGGCTGGAGCTGGAGGG + Intronic
906243916 1:44259838-44259860 TCACTCAGGCTGGAGTTCAGTGG - Intronic
906373901 1:45278445-45278467 TCACTCAGGCTGGAGAGCAGTGG - Intronic
906593271 1:47048207-47048229 TCAATCAGGCTGGAGAGCAGTGG - Intronic
906767267 1:48445164-48445186 TCAGTTTGGCTGTATGTCAGTGG - Intronic
906917539 1:50027163-50027185 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
907032155 1:51183096-51183118 TCATTGTGGCTCCTGATCAGAGG + Intergenic
907053100 1:51342964-51342986 TCAGTGTGCAGGGAGAGCAGAGG - Intronic
907079355 1:51607201-51607223 TCAGTGAGGCTGGAGTGCAGTGG + Intronic
907146970 1:52243717-52243739 TCACTCTGGCTGGAGTACAGTGG - Intronic
907265597 1:53258384-53258406 GGAGAGTGGCTGGAGATCTGAGG + Exonic
907281549 1:53350294-53350316 TCAGTGTGGCTGGAGCATGGTGG - Intergenic
907441765 1:54483110-54483132 TCACTGAGGCTGGAGTACAGTGG + Intergenic
907470766 1:54672054-54672076 GCAGTGTGACTGGAGCCCAGAGG + Intronic
907690753 1:56663131-56663153 TCACTGAGGCTGGAGGGCAGTGG + Intronic
909499932 1:76322878-76322900 TCACTTAGGCTGGAGTTCAGTGG + Intronic
909501143 1:76337115-76337137 TGAGAGAGTCTGGAGATCAGAGG - Intronic
909563695 1:77032216-77032238 GCAGTGTGGCTGGAGTAGAGAGG + Intronic
910280833 1:85499633-85499655 TCACTGTTGCTGGAGTGCAGTGG - Intronic
910541916 1:88369066-88369088 TCAGCCTGGCTGGAGTGCAGTGG - Intergenic
910556840 1:88543821-88543843 TCAGTGTGATTGGAGCACAGGGG - Intergenic
910812917 1:91256020-91256042 TCAGGCTGGCTGGAGTACAGTGG - Intergenic
910909883 1:92222199-92222221 TCACTATGGCTGGAGTGCAGTGG - Intronic
911083202 1:93953668-93953690 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
911536308 1:99105206-99105228 TCTCTGTGGCTGGGCATCAGAGG - Intergenic
911617392 1:100029468-100029490 TCACTCAGGCTGGAGTTCAGCGG + Intergenic
911748132 1:101463835-101463857 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
911972755 1:104458263-104458285 TCACTGAGGCTGGAGTTCAGTGG - Intergenic
911995987 1:104767081-104767103 TCGCTCTGGCTGGAGCTCAGTGG - Intergenic
912100591 1:106200014-106200036 TCAGTGTGGCTGGAAATCTAGGG - Intergenic
912150098 1:106848239-106848261 TCAGTGAGGCTGGAGTGCAGTGG - Intergenic
912318550 1:108688961-108688983 TCACCCTGGCTGGAGAGCAGTGG - Intergenic
912358043 1:109071568-109071590 TCACTGGGGCTGGAGTACAGTGG - Intronic
912398358 1:109366870-109366892 TCACTCAGGCTGGAGAGCAGTGG - Intronic
913000403 1:114574907-114574929 TCACTGTGGCTGGAGTGCAGTGG + Intronic
913105125 1:115607048-115607070 GCTGTGTGGCTGGAGTGCAGTGG - Intergenic
913238515 1:116806512-116806534 TCAGTGTGGCAGGCAATCAAGGG + Intergenic
913443190 1:118921137-118921159 TCACTCAGGCTGGAGTTCAGTGG - Intronic
914008496 1:143755233-143755255 TCAGGGTGGCTAGACATCACAGG - Intergenic
914224513 1:145708807-145708829 TCATTGAGGCTGGAGTGCAGTGG - Intergenic
914413755 1:147457828-147457850 TCACTGAGGCTGGAGGGCAGTGG - Intergenic
914521715 1:148423403-148423425 TCAGGGTGGCTAGACATCACAGG - Intergenic
914647126 1:149663884-149663906 TCAGGGTGGCTAGACATCACAGG - Intergenic
915030628 1:152877786-152877808 TCAGTGTGGCTGGAGCAGAGTGG - Intergenic
915172513 1:153987917-153987939 TCACCGAGGCTGGAGAGCAGTGG - Intergenic
915190526 1:154146861-154146883 TCACCGAGGCTGGAGAGCAGTGG + Intronic
915435407 1:155901776-155901798 TCACTGAGGCTGGAGTGCAGTGG - Intronic
915744993 1:158149185-158149207 GCAGTGTGGATGGAGAAAAGTGG + Intergenic
916303378 1:163301370-163301392 TCACTGAGGCTGGAGTGCAGTGG + Intronic
916538715 1:165730632-165730654 TCACTGAGGCTGGAGTGCAGTGG + Intronic
916568481 1:166004231-166004253 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
916695780 1:167234692-167234714 TCATCCTGGCTGGAGAACAGTGG - Intronic
916900871 1:169221762-169221784 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
917012427 1:170489165-170489187 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
917134134 1:171772209-171772231 TCAGCGAGGCTGGAGTGCAGTGG - Intergenic
917644859 1:177019922-177019944 TCACTGTGGCTGGAGTGCAATGG + Intronic
917777928 1:178358194-178358216 TCACGGAGGCTGGAGAACAGTGG - Intronic
918187288 1:182139446-182139468 TCAGTATAGCTGGAGCTCAAAGG + Intergenic
918305936 1:183246128-183246150 TCACCCTGGCTGGAGAGCAGTGG - Intergenic
918610421 1:186484123-186484145 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
918688287 1:187447068-187447090 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
918871860 1:189985112-189985134 TCACTGAGGCTGGAGTTCTGTGG + Intergenic
919073880 1:192790791-192790813 TCACTCAGGCTGGAGGTCAGTGG + Intergenic
919330125 1:196160369-196160391 TCAGAGTGCCTGGAGATCATGGG - Intergenic
919886762 1:201940623-201940645 TCAGCCAGGCTGGAGAGCAGTGG + Intronic
919895427 1:202006993-202007015 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
920140022 1:203803643-203803665 TCACTGAGGCTGGAGTGCAGTGG + Intronic
920239638 1:204536210-204536232 TCACCCTGGCTGGAGAGCAGTGG - Intronic
920522733 1:206640588-206640610 TCACTGAGGCTGGAGTGCAGTGG + Intronic
920541255 1:206779787-206779809 TCAATGAGGCTGGAGTGCAGAGG - Intergenic
920768692 1:208858951-208858973 TCAGTGTGGTTGGAGTAAAGTGG + Intergenic
920805025 1:209224873-209224895 CCAGTGTGGTTGGAGCACAGAGG - Intergenic
920834188 1:209492867-209492889 CCAGTGTAGCTAGAGCTCAGTGG + Intergenic
921012201 1:211153117-211153139 TCGCTGAGGCTGGAGTTCAGTGG + Intergenic
921203851 1:212831431-212831453 TCACTGGGGCTGGAGCGCAGTGG - Intronic
921963058 1:221056261-221056283 GCGGTGTGACTGGAGTTCAGGGG + Intergenic
922504178 1:226116974-226116996 TCAGTCAGGCTGGAGTGCAGTGG + Intergenic
922506169 1:226127098-226127120 TCACTGAGGCTGGAGTGCAGAGG - Intergenic
922508413 1:226141365-226141387 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
922591881 1:226783605-226783627 TCACTGAGGATGGAGAACAGTGG + Intergenic
922626162 1:227045844-227045866 TCACTGAGGCTGGAGTTTAGTGG + Intronic
922708425 1:227806355-227806377 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
923229498 1:231971551-231971573 TCAGGGTGGCTGGAGAGGAAGGG - Intronic
923368308 1:233285310-233285332 TCACTCAGGCTGGAGAACAGTGG - Intronic
923481917 1:234393377-234393399 TCAGTGTCTCTGCAGAACAGTGG - Exonic
923573051 1:235133900-235133922 TCAGTTCGGCTGGAGTGCAGTGG + Intronic
923614900 1:235529293-235529315 TCACTGGGGCTGGAGTGCAGTGG + Intergenic
923638486 1:235725392-235725414 TCACTGAGGCTGGAGTGCAGTGG - Intronic
923705252 1:236338728-236338750 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
924156450 1:241181736-241181758 TCACTGGGGCTGGAGTGCAGTGG + Intronic
924177358 1:241405722-241405744 TCAGTGTGGCTGATGAGAAGGGG + Intergenic
924308344 1:242714947-242714969 CCAGTGTGGCTGGAGTGGAGAGG - Intergenic
924376321 1:243413243-243413265 TCACTCAGGCTGGAGTTCAGTGG + Intronic
924518080 1:244782623-244782645 TCAGTGTGGCTGCAGCACAGGGG - Intergenic
924609782 1:245564131-245564153 TCAGTGTGGCTGCAACACAGGGG - Intronic
1062883936 10:1001961-1001983 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1062899457 10:1131442-1131464 CCAGTGTGCCTGGAACTCAGTGG - Exonic
1063082771 10:2783863-2783885 CCAGTGTGGATGGAAATAAGTGG + Intergenic
1063085036 10:2809144-2809166 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
1063100420 10:2945363-2945385 TCAGTGTTGATGGAGACGAGTGG - Intergenic
1063704424 10:8417083-8417105 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
1063889665 10:10616757-10616779 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1063997398 10:11632873-11632895 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1064072083 10:12239113-12239135 TCACCCTGGCTGGAGAGCAGTGG - Intronic
1064570481 10:16687757-16687779 TCACTGAAGCTGGAGTTCAGTGG + Intronic
1064683044 10:17830926-17830948 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1064688866 10:17893193-17893215 TCAGCTTGGCTGGAGTGCAGTGG + Intronic
1065042282 10:21709780-21709802 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1065052284 10:21807352-21807374 TCAGTGTGGTTAGAGCACAGTGG - Intronic
1065057769 10:21864182-21864204 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1065204055 10:23341687-23341709 CCAGTGTGGCTGGAGCAGAGAGG - Intronic
1065344758 10:24738016-24738038 TCACTGAGGCTGGAGTACAGTGG - Intergenic
1065560492 10:26959236-26959258 TCACCGAGGCTGGAGAGCAGTGG - Intergenic
1065855268 10:29825014-29825036 TCACCCTGGCTGGAGAGCAGTGG - Intergenic
1065884551 10:30065539-30065561 TCATTGAGGCTGGAGGGCAGTGG + Intronic
1067224197 10:44364693-44364715 CCAGTGTGGCTGGAGCAGAGAGG + Intergenic
1067330717 10:45315272-45315294 TCATTCTGGCTGGAGTGCAGTGG - Intronic
1067452195 10:46388671-46388693 TCAGTGTGGCTGGATCCCAAGGG + Intronic
1067585042 10:47471084-47471106 TCAGTGTGGCTGGATCCCAAGGG - Intronic
1067899954 10:50229670-50229692 TGAGTGTGGCTGGAGTGCAGAGG - Intronic
1068012049 10:51464246-51464268 TCAGCCAGGCTGGAGAGCAGTGG - Intronic
1068037828 10:51783316-51783338 TCCCTGAGGCTGGAGTTCAGTGG + Intronic
1068320521 10:55408223-55408245 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1068476625 10:57535395-57535417 TCAGTGAGGCTGGAAAGAAGGGG - Intergenic
1068761067 10:60709786-60709808 TCAGTGAGGCTGGAGTGTAGTGG - Intronic
1069212166 10:65775969-65775991 TCATCTTGGCTGGAGTTCAGTGG + Intergenic
1069268466 10:66493643-66493665 TCAGGCTGGATGGAGTTCAGTGG + Intronic
1069562989 10:69444195-69444217 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1069700341 10:70420237-70420259 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1069933254 10:71897801-71897823 TCAGCCAGGCTGGAGAGCAGTGG - Intergenic
1070157262 10:73843110-73843132 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
1070183159 10:74033928-74033950 GCAGTGTGAATGGAGATGAGAGG - Intronic
1070849682 10:79553347-79553369 TCACTGGGGCTGGAGTGCAGTGG + Intergenic
1071163267 10:82777412-82777434 TCAGAGTGGCTGTAGAGCTGAGG + Intronic
1071235543 10:83643772-83643794 TCACCGAGGCTGGAGTTCAGTGG + Intergenic
1071255518 10:83868535-83868557 CCAGTGTTGCTGGATATTAGAGG - Intergenic
1071374747 10:84991083-84991105 TCAGTCTGGCTGGGGATCTCTGG + Intergenic
1071514973 10:86291282-86291304 TCAGTGGGGATGGAGGTCAATGG - Intronic
1071682181 10:87717397-87717419 TCAGTGTTAATGGAAATCAGAGG + Intronic
1072354916 10:94599391-94599413 TCACCGAGGCTGGAGTTCAGTGG + Intronic
1072527000 10:96281021-96281043 TCACTCTGGCTGGAGTGCAGTGG + Intergenic
1072745366 10:97935842-97935864 GCAGTGGGGCTGGAGAGGAGAGG + Intronic
1072882650 10:99243311-99243333 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1072983982 10:100123380-100123402 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1073011394 10:100362721-100362743 TCAGTGTGGCAGGGGAGCACAGG - Exonic
1073091166 10:100940873-100940895 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1073203755 10:101757293-101757315 TCAGTCAGGCTGGAGTGCAGTGG - Intergenic
1073232046 10:101980336-101980358 TCACAGTGGCTGGAGTGCAGTGG + Intronic
1073246452 10:102093931-102093953 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1073366373 10:102945572-102945594 TCAGTGTGGCTGGAGGGTAAAGG - Intronic
1073391256 10:103178526-103178548 TCACTGAGGCTGGAGCGCAGTGG - Intronic
1073451007 10:103609114-103609136 TCAGTTGGGCTGGAGTGCAGTGG - Intronic
1073579949 10:104656259-104656281 ACAGTGTGGCTGGAGCAGAGGGG + Intronic
1073657263 10:105430181-105430203 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1073774534 10:106771036-106771058 GCTGAGTGGCTGGAGAGCAGAGG - Intronic
1074083698 10:110190101-110190123 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1074128242 10:110548114-110548136 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1074229557 10:111520309-111520331 CCAGTGTGGGTGGAGGACAGTGG - Intergenic
1074293430 10:112159258-112159280 TCACTCAGGCTGGAGAACAGTGG + Intronic
1074300526 10:112228994-112229016 TCACTCTGGCTGGAGTGCAGAGG - Intergenic
1074787629 10:116854899-116854921 TCAGCCAGGCTGGAGAGCAGTGG - Intronic
1075383383 10:122037207-122037229 CCGGTGTGGCTGGAGAAAAGTGG + Intronic
1075427941 10:122356462-122356484 TGGGTGTGCCTGGAGCTCAGTGG - Intergenic
1075981929 10:126747541-126747563 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1075991596 10:126843128-126843150 TAAGTCTGGCTGGGGATAAGGGG - Intergenic
1076057466 10:127387217-127387239 CCAGTGTGGCTGGAATGCAGAGG - Intronic
1076083951 10:127608400-127608422 CAAGTGAGGCAGGAGATCAGTGG - Intergenic
1076150379 10:128157499-128157521 TCTGCTTGGCTGGAGTTCAGTGG + Intergenic
1076429468 10:130391513-130391535 TCTGTGGGTCTGGAGTTCAGGGG + Intergenic
1077537751 11:3132586-3132608 CCAGTGTGGCTGGAGCAGAGTGG - Intronic
1077666530 11:4115594-4115616 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1077743880 11:4879192-4879214 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1077856768 11:6134218-6134240 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1078171561 11:8932610-8932632 TGAGTGTAACTGGAGAGCAGAGG - Intronic
1078337048 11:10472962-10472984 TCAGCCAGGCTGGAGAGCAGTGG - Intronic
1078518740 11:12047019-12047041 TCAGCGTGGCTGGAGTGGAGAGG - Intergenic
1079106948 11:17577928-17577950 TCAGTGTGGCAGGGGGCCAGAGG - Intronic
1079140052 11:17802617-17802639 CCAGTGTGGCTGAAGAGGAGTGG - Intronic
1079248078 11:18767875-18767897 CCAGTGTGGCTGGAGTGCAGAGG - Intronic
1079487237 11:20948080-20948102 TCACTCAGGCTGGAGAGCAGTGG + Intronic
1080090955 11:28348405-28348427 TCAGTCAGGCTGGAGTACAGTGG + Intergenic
1080151175 11:29054055-29054077 TCAGTGTGGCTAGAATGCAGAGG + Intergenic
1080817368 11:35771683-35771705 TCACCCTGGCTGGAGAGCAGTGG - Intronic
1080929775 11:36797826-36797848 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1081515046 11:43820571-43820593 TTATTGTGGCTGGACATCAGGGG + Intronic
1081600365 11:44488510-44488532 TCAGTGTGGCTGGCAGTCAGTGG - Intergenic
1081620353 11:44615631-44615653 CCAGTGTAGCTTGAGATAAGAGG - Intronic
1082028445 11:47588745-47588767 TGTGTGTGTGTGGAGATCAGGGG + Exonic
1082265056 11:50109277-50109299 TCAGGGTGGCTGGAGCATAGTGG - Intergenic
1082800457 11:57410337-57410359 TCAGTGGGGTTGGAGAGAAGTGG - Intronic
1082852757 11:57780091-57780113 TCACTGAGGCTGGAGTACAGTGG + Intronic
1082956778 11:58878360-58878382 TCAGAGTGGCTGAGGATCATAGG + Intronic
1083134787 11:60662055-60662077 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
1083404659 11:62448258-62448280 TGAGTGTGGCTGGAAGTCATCGG + Intronic
1083451858 11:62751594-62751616 TCACTGAGGCTGGAGTGCAGTGG - Exonic
1083775423 11:64892264-64892286 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1083817258 11:65141460-65141482 TCACTCTGGCTGGAGTGCAGTGG - Intergenic
1083826883 11:65208943-65208965 ACCGTGTGGATGGAGGTCAGTGG - Intronic
1083831347 11:65235869-65235891 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1083916851 11:65751950-65751972 TCACTGAGGCTGGAGCGCAGTGG + Intergenic
1083991814 11:66250816-66250838 TCAGTGCAGCTGGAGACCATGGG + Intergenic
1084596165 11:70118212-70118234 CCAGTGTGGCTGGAGAATGGAGG - Intronic
1084740873 11:71138749-71138771 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1084775858 11:71374605-71374627 TGAGCGAGGGTGGAGATCAGAGG - Intergenic
1084867882 11:72074697-72074719 TCACTCTGGCTGGAGTGCAGTGG - Intronic
1085390945 11:76181881-76181903 TGGGTATGGCTGGAGCTCAGGGG - Intergenic
1085395260 11:76203827-76203849 TCAGTGAGGCTGGAAAGCCGGGG - Intronic
1085493982 11:76950499-76950521 TCACTCTGGCTGGAGAGCAGTGG + Intronic
1085602195 11:77864935-77864957 TCACTGAGGCTGGAGGGCAGTGG - Intronic
1085851775 11:80129049-80129071 TCAGTCAGGCTGGAGTGCAGTGG + Intergenic
1086295444 11:85362007-85362029 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1086394330 11:86398588-86398610 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1086436700 11:86788323-86788345 TCAGGGTGGCTGCAGGTGAGGGG - Intergenic
1087017837 11:93571871-93571893 GTGGTGTGGCTGGAGAGCAGAGG + Intergenic
1087064776 11:94017851-94017873 TCAGTGAGGCTGGAGTGCAGTGG + Intergenic
1087255833 11:95951965-95951987 TCATCGTGGCTGGAGTGCAGTGG + Intergenic
1087263697 11:96039213-96039235 TCACTGAGGCTGGAGTTCAGTGG - Intronic
1087761170 11:102105850-102105872 TCAGCCAGGCTGGAGTTCAGTGG + Intergenic
1087865172 11:103216752-103216774 TCACTCAGGCTGGAGAGCAGTGG - Intronic
1087915945 11:103810981-103811003 TCAGTGTGGCTGGAGATAATGGG - Intergenic
1088103984 11:106185308-106185330 TCAGAGCGGCTGGGGATCACGGG + Intergenic
1088312545 11:108475504-108475526 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1088336910 11:108715482-108715504 TCAGTGAGGCTGGAGTGTAGTGG - Intronic
1088478406 11:110267912-110267934 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1089057666 11:115599705-115599727 TCACTCTGGCTGGAGTGCAGTGG + Intergenic
1089309388 11:117547856-117547878 CCAGCGTGGCTGGAGGTCAGGGG - Intronic
1089477591 11:118777847-118777869 TCAGAGAGGCTGGAGTGCAGTGG - Intronic
1089665426 11:120014852-120014874 TCAGTGAAGATGGAGAGCAGTGG + Intergenic
1090194402 11:124802411-124802433 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1090553529 11:127849139-127849161 TCAGTGTAACTGGAAATTAGAGG + Intergenic
1090589956 11:128255831-128255853 TCAGTGTGGCTGGACTTCCCAGG + Intergenic
1090910940 11:131118727-131118749 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1091021275 11:132102397-132102419 TCAGTGTGCCTGAAGAGCTGGGG + Intronic
1091134114 11:133172539-133172561 TCAGTATGGCTGGAGCCTAGAGG + Intronic
1091138258 11:133212354-133212376 TCAGTGTGGCTAGGATTCAGGGG - Intronic
1091246387 11:134099159-134099181 TCACTGAGGCTGGAGTACAGTGG - Intronic
1091379056 12:44043-44065 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1091464924 12:675504-675526 TCACTGTGGCTGGAGTGCAGTGG - Intergenic
1091730896 12:2879370-2879392 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1091841135 12:3621609-3621631 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1092372744 12:7930834-7930856 TCACCCAGGCTGGAGATCAGTGG + Intronic
1092450103 12:8593793-8593815 TCACTGGGGCTGGAGTACAGTGG + Intergenic
1092684533 12:11027223-11027245 TCCCTGAGGCTGGAGTTCAGTGG - Intronic
1092689221 12:11088299-11088321 TCCCTGAGGCTGGAGTTCAGTGG - Intronic
1093015336 12:14149413-14149435 TCATTCTGGCTGGAGTGCAGTGG + Intergenic
1093648711 12:21618743-21618765 ACAGTGTGGTTGGGGCTCAGAGG - Intergenic
1093660008 12:21745815-21745837 TCTTTGTGTCTGGAGAGCAGAGG - Intronic
1093661659 12:21764278-21764300 TCTGTGAGTCTGGAGTTCAGAGG + Intergenic
1093948918 12:25141788-25141810 TCACTCAGGCTGGAGAGCAGTGG - Intronic
1094432885 12:30389211-30389233 CCACTGTGGCTTGAGATGAGAGG + Intergenic
1094436842 12:30430270-30430292 CCAGTGTGGCTGGTGCCCAGTGG - Intergenic
1094662084 12:32479826-32479848 TCACCCTGGCTGGAGTTCAGTGG + Intronic
1094812180 12:34149362-34149384 TCATTCAGGCTGGAGTTCAGTGG - Intergenic
1095046425 12:37512576-37512598 TCAAAGTGGCTGGGGATCATGGG + Intergenic
1096147666 12:49290451-49290473 TCACTGGGGCTGGAGTACAGTGG + Intergenic
1096266423 12:50126501-50126523 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1096363524 12:51008602-51008624 ACAGTGTTTCTGGAGATCATGGG - Exonic
1096380766 12:51156000-51156022 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1096390047 12:51221642-51221664 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1096708284 12:53437006-53437028 TGAGTGAGACTGGAGTTCAGTGG + Intergenic
1096721694 12:53527733-53527755 TCACTCTGGCTGGAGTGCAGTGG - Intronic
1097008766 12:55937820-55937842 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1097044490 12:56177282-56177304 TCAGCCAGGCTGGAGAGCAGTGG + Intronic
1097326685 12:58285012-58285034 TCAGTGTGGCTGGAGCATAAAGG + Intergenic
1097432232 12:59524568-59524590 TCACCCTGGCTGGAGTTCAGTGG + Intergenic
1097641117 12:62183421-62183443 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
1098020497 12:66150452-66150474 TCACTGAGGCTGGAGGGCAGTGG + Intronic
1098065584 12:66612593-66612615 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1098256001 12:68616322-68616344 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
1098262187 12:68682922-68682944 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1098268915 12:68751335-68751357 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1098386263 12:69922040-69922062 TCAGTGAGGATGGAGAGAAGTGG + Intronic
1098635989 12:72784268-72784290 TCACCGTGGCTGGAGTGCAGTGG + Intergenic
1098967165 12:76803211-76803233 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1098979421 12:76938861-76938883 TCACTCTGGCTGGAGTGCAGTGG - Intergenic
1099186474 12:79521019-79521041 TCAGGCAGGCTGGAGTTCAGTGG + Intergenic
1099220841 12:79912024-79912046 CCAGTGTGACTGGAGCACAGGGG - Intronic
1099336314 12:81364210-81364232 CCAGTGTGGCTGGATTGCAGAGG + Intronic
1099590680 12:84585124-84585146 CCAGTGAAGCTGGAGAACAGGGG - Intergenic
1099660967 12:85561153-85561175 TCACTTAGGCTGGAGTTCAGTGG - Intergenic
1100100242 12:91094738-91094760 TCAGTGTGTTTGGAGAGGAGTGG + Intergenic
1100308858 12:93376577-93376599 CCAGTGTGGCTGCAGAGCGGAGG - Intergenic
1100325331 12:93534888-93534910 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1100345898 12:93730753-93730775 TCACTCTGGCTGGAGTGCAGTGG + Intronic
1100429567 12:94518432-94518454 TCAGTGTGGCTGCAGCAGAGTGG - Intergenic
1100681182 12:96923075-96923097 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1100904514 12:99282299-99282321 CCAGTGTGGCTGGAGCAAAGTGG + Intronic
1101164868 12:102018834-102018856 TTAGTGAGGCTGGAGTGCAGTGG + Intronic
1101370956 12:104129844-104129866 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1101485247 12:105151103-105151125 TCACTCAGGCTGGAGAGCAGTGG - Intronic
1101627324 12:106458159-106458181 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1101874008 12:108587198-108587220 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1102200478 12:111054664-111054686 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1102328440 12:112009804-112009826 TCACTCAGGCTGGAGTTCAGAGG - Intronic
1102352579 12:112205091-112205113 TCATTGAGGCTGGAGTGCAGTGG - Intronic
1102525216 12:113507781-113507803 TCATTCAGGCTGGAGTTCAGTGG + Intergenic
1102727651 12:115079655-115079677 TAAGAGAGGCTGGAGAGCAGGGG + Intergenic
1103006369 12:117423563-117423585 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1103034784 12:117647650-117647672 TTAGTGATGCTGGAGATCAGGGG + Intronic
1103191844 12:119008330-119008352 TCACTGTGGCTGGAGTGCAGTGG - Intronic
1103232490 12:119343416-119343438 TCATAGTGGCTGTAGATCAGGGG + Intronic
1103246930 12:119465716-119465738 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1103401467 12:120646009-120646031 TCACTGTGGCTAGAGTACAGTGG - Intronic
1103493376 12:121341121-121341143 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1103515141 12:121502883-121502905 TCACCGAGGCTGGAGAGCAGTGG - Intronic
1104017356 12:124969879-124969901 TCACTGAGGCTGGAGTGCAGCGG - Intronic
1104427511 12:128690204-128690226 TCAGAGTGAGTGGAGTTCAGTGG + Intronic
1104587552 12:130059605-130059627 TCACTCAGGCTGGAGAACAGTGG + Intergenic
1105282894 13:18979415-18979437 TCTGTGTGTCTGGAGCTCAGGGG - Intergenic
1105369195 13:19787903-19787925 TCAGTGTAGCTGAAGAGGAGAGG - Intergenic
1105404559 13:20122473-20122495 TCACTGGGGCTGGAGTGCAGTGG - Intergenic
1105665581 13:22552338-22552360 CCAGTGTGGCTGGAGCAGAGTGG + Intergenic
1106139777 13:27002466-27002488 TGAATGTGGCTGGAGCTCACAGG - Intergenic
1106264400 13:28097174-28097196 TCATTGAGGCTGGAGTGCAGTGG - Intronic
1106286905 13:28325773-28325795 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
1106341278 13:28829490-28829512 TCATTCAGGCTGGAGTTCAGTGG - Intronic
1106405157 13:29466835-29466857 TCACTGAGGCTGGAGTACAGTGG - Intronic
1106857019 13:33864579-33864601 GGAGTGTGACTGGAGGTCAGGGG + Intronic
1107087657 13:36443616-36443638 TCACCGTGGCTGGAGTGCAGTGG + Intergenic
1107090817 13:36476990-36477012 TCTGTTTGGCTGGAGAAGAGAGG + Intergenic
1107559278 13:41545621-41545643 TCAGGAGGGCTGGGGATCAGTGG + Intergenic
1107897313 13:44978007-44978029 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1107947817 13:45435438-45435460 TCAGTCAGGCTGGAGTGCAGTGG - Intergenic
1108150506 13:47528759-47528781 TCACCGAGGCTGGAGTTCAGTGG - Intergenic
1108234498 13:48389117-48389139 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1108270306 13:48752809-48752831 TCAGTCAGGCTGGAGTGCAGTGG + Intergenic
1108369719 13:49756232-49756254 TCGCTGTGGCTGGAGTGCAGTGG - Intronic
1108369757 13:49756515-49756537 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1108865137 13:54913826-54913848 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1109336265 13:60998916-60998938 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1109341108 13:61060319-61060341 TCACTGTGGCTGGAGTGTAGTGG + Intergenic
1109423486 13:62144207-62144229 GCAGTCAGGCTGGAGTTCAGTGG + Intergenic
1109785604 13:67170883-67170905 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1109954699 13:69550443-69550465 TCACTCAGGCTGGAGAGCAGTGG + Intergenic
1110533673 13:76626707-76626729 TCAGTGTGGCTAGAGTACAGAGG - Intergenic
1110592765 13:77283856-77283878 TCACTGGGGCTGGAGTGCAGTGG - Intronic
1110854335 13:80279434-80279456 TCACTCTGGCTGGAGTGCAGGGG - Intergenic
1111264048 13:85783491-85783513 TGACTCTGGCTGGAGAGCAGTGG - Intergenic
1111269235 13:85858862-85858884 CCAGTATGGCTGGAAATCAGAGG + Intergenic
1111451477 13:88423897-88423919 TCAGTCAGGCTGAAGTTCAGTGG + Intergenic
1111670261 13:91321016-91321038 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1111862686 13:93728254-93728276 TCAGTAAGACTGGAGTTCAGTGG + Intronic
1111929952 13:94502845-94502867 TCACAGTGGCTGGAAGTCAGAGG - Intergenic
1112128924 13:96499738-96499760 CCAGTGTGGCTGAAGCTGAGTGG + Intronic
1112265842 13:97922535-97922557 TCTGTCAGGCTGGAGAGCAGTGG - Intergenic
1112460734 13:99601636-99601658 TCACTGAGGCTGGAGTACAGTGG - Intergenic
1112535120 13:100246347-100246369 TCATTGAGGCTGGAGTGCAGTGG + Intronic
1113181930 13:107638840-107638862 CTAGTGAGGCTGGAGAACAGTGG + Intronic
1113195829 13:107804380-107804402 TCCTTGAGGCTGGAGCTCAGAGG + Intronic
1113251099 13:108453321-108453343 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1113627723 13:111858721-111858743 CCAGTGTGGCTGGAGGGCAAGGG + Intergenic
1113745714 13:112742735-112742757 GCAGTGTGGCTGGATCTCAGGGG + Intronic
1113868833 13:113545959-113545981 CCAGTGGGGCTGGAGATGAAGGG + Intronic
1114041424 14:18682115-18682137 TCACTGAGGCTGGAGTCCAGTGG + Intergenic
1114283350 14:21215857-21215879 TCACTGAGGCTGGAGTACAGTGG - Intronic
1114322523 14:21559106-21559128 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1114428787 14:22642840-22642862 TCAGTGAGGCTGTAGTGCAGTGG + Intergenic
1115023485 14:28712063-28712085 TCTATGTGGCTGGAGTGCAGTGG - Intergenic
1115243959 14:31276201-31276223 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1115396007 14:32909307-32909329 TCACTGAGGCTGGAGTTCAGCGG - Intergenic
1115548558 14:34485426-34485448 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1115611784 14:35055471-35055493 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1116950002 14:50870869-50870891 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1117083603 14:52177161-52177183 TCACTCAGGCTGGAGAGCAGAGG + Intergenic
1117317755 14:54590449-54590471 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1117356988 14:54934020-54934042 TCAGTCAGGCTGGAGTGCAGTGG + Intergenic
1117375538 14:55115333-55115355 TCACTGAGGCTGGAGTCCAGTGG - Intergenic
1118181855 14:63501932-63501954 TCAGCCTGGCTGGAGTGCAGTGG + Intronic
1118185937 14:63538577-63538599 TCACTCTGGCTAGAGTTCAGTGG - Intronic
1118414463 14:65519816-65519838 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1118433119 14:65742268-65742290 TTGGTGTGGCTGGAAATCATTGG + Exonic
1118500212 14:66355446-66355468 TCAGAGTGGCTGGAGTTCAAAGG + Intergenic
1118629026 14:67686108-67686130 CCAGTGTGTCTGCAGTTCAGAGG - Intronic
1118850286 14:69577817-69577839 TCACTCAGGCTGGAGTTCAGCGG - Intergenic
1118885207 14:69860252-69860274 TCTGGGTGGATGGGGATCAGGGG + Intronic
1119027236 14:71163921-71163943 TCATAGTGGGTGGAGATGAGCGG - Intergenic
1119068078 14:71550971-71550993 CCAGTGTGGCTGGAGAGGAAAGG - Intronic
1119278512 14:73383104-73383126 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1119314464 14:73681171-73681193 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1119354622 14:73995543-73995565 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1119517643 14:75260888-75260910 TCAGTGTGGATGAAGAAGAGGGG + Intronic
1119548497 14:75491195-75491217 TCATTGAGGCTGGAGTGCAGTGG + Intergenic
1119554640 14:75543607-75543629 TCAGTGAGGCTGGAGTGCAGTGG + Intronic
1119654168 14:76405138-76405160 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1119699115 14:76740187-76740209 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1119856559 14:77905348-77905370 TCACCGTGGCTGGAGTACAGTGG + Intronic
1120177807 14:81313753-81313775 TCATTGAGGCTGGAGCGCAGTGG - Intronic
1120236245 14:81894637-81894659 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1120291260 14:82574139-82574161 TCATTGAGGCTGGAGTGCAGTGG + Intergenic
1120494947 14:85223294-85223316 TCACTGAGGCTGGAGTTCAGTGG - Intergenic
1120612879 14:86664547-86664569 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1121193915 14:92053208-92053230 TCACCCAGGCTGGAGATCAGTGG - Exonic
1121195218 14:92065839-92065861 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1121258025 14:92545618-92545640 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1121302743 14:92885067-92885089 TCACTGGGGCTGGAGTACAGTGG - Intergenic
1121729037 14:96173688-96173710 TCTGTGTAGCTGCAGCTCAGAGG + Intergenic
1121856250 14:97272785-97272807 TCAATGAGGCTGGAGTGCAGTGG + Intergenic
1122038149 14:98963127-98963149 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1122117559 14:99535452-99535474 TGAGTGTGGCTGGAGCTTGGAGG - Intronic
1122268305 14:100556932-100556954 CCAGGTTGGATGGAGATCAGTGG - Intronic
1122396344 14:101435136-101435158 CCTGTGTGGCTGGAAATCTGAGG + Intergenic
1122400057 14:101461723-101461745 TCAGGGTGGCAGGAGGGCAGGGG - Intergenic
1122540349 14:102494501-102494523 TCACTGTGTCTGGAGTGCAGTGG - Intronic
1202845531 14_GL000009v2_random:169771-169793 TCAGTGTGGTTGGAGAAAACAGG - Intergenic
1202875260 14_GL000225v1_random:201450-201472 TCAGTGTGGTTGGAGAAAACAGG + Intergenic
1202877739 14_KI270722v1_random:22670-22692 TCAGTGTGGTTGGAGAAAACAGG + Intergenic
1123664438 15:22597421-22597443 TCACTGAGGCTGGAGTACAGTGG - Intergenic
1123957431 15:25352153-25352175 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1124054117 15:26225817-26225839 TCTGGGTGGCTGAAGATGAGTGG + Intergenic
1124224846 15:27884333-27884355 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1124318275 15:28691858-28691880 TCACTGAGGCTGGAGTACAGTGG - Intergenic
1124435953 15:29649677-29649699 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
1124565165 15:30805599-30805621 TCACTGAGGCTGGAGTACAGTGG + Intergenic
1124805536 15:32878225-32878247 CCCGTGTGGCTGGAGTTTAGTGG + Intronic
1124991322 15:34676889-34676911 GCAGTGTGGTGGGAGAGCAGTGG + Intergenic
1125156577 15:36593601-36593623 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1125179997 15:36871526-36871548 TAAGCCTGGCTGGAGGTCAGAGG - Intergenic
1125498108 15:40216396-40216418 TCACTGAGGCTGGAGTACAGTGG - Intronic
1125618954 15:41041872-41041894 TCACTGAGGCTGGAGTACAGTGG + Intronic
1125666182 15:41432235-41432257 TCAGTCTGGATGGAGTGCAGTGG + Intronic
1125701361 15:41688113-41688135 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1125807711 15:42508403-42508425 TTAGTGTGGCTGTCGCTCAGAGG - Intronic
1125897892 15:43317816-43317838 TCAGTGTGGCATGAAATCATGGG + Intergenic
1126535050 15:49752147-49752169 TGAGTGGGGCTGGTGTTCAGGGG + Intergenic
1126623085 15:50659705-50659727 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1126828647 15:52576757-52576779 TCACTCAGGCTGGAGTTCAGAGG + Intergenic
1127476674 15:59340268-59340290 TCATCCTGGCTGGAGTTCAGTGG - Intronic
1127751624 15:62050760-62050782 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1127809741 15:62554211-62554233 TCACTGTGGCAGGAGAAAAGAGG + Intronic
1128040551 15:64568976-64568998 CCAGTGTGGCTAGAGTACAGAGG - Intronic
1128196690 15:65763634-65763656 TCAGGCTGGCTGGAGTGCAGTGG - Intronic
1128305001 15:66592566-66592588 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1128506490 15:68276815-68276837 TCAGTGTGGCTGCAGCAGAGTGG - Intergenic
1128831303 15:70771880-70771902 CCAGTGTGGCTGGAGCATAGTGG + Intergenic
1129129325 15:73478222-73478244 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1129251408 15:74311112-74311134 TCAGTGTCACAGGAGAGCAGAGG - Intronic
1129430931 15:75501502-75501524 TCACTTAGGCTGGAGCTCAGTGG + Intronic
1129538250 15:76331574-76331596 TCACCGAGGCTGGAGTTCAGTGG + Intergenic
1130333772 15:82941646-82941668 TAGGTGAGGCTGGAGGTCAGGGG - Intronic
1131007711 15:88991853-88991875 TCACCGAGGCTGGAGTTCAGTGG - Intergenic
1131150116 15:90042438-90042460 TCAGTCTGTGTGGAGCTCAGTGG - Intronic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1131551874 15:93364263-93364285 TCTCTGTGGCTGGAGTGCAGTGG - Intergenic
1132418578 15:101643887-101643909 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1132448439 15:101951080-101951102 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1132530701 16:447354-447376 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1132678725 16:1131057-1131079 GCAGTGTGGGTGGGGGTCAGGGG + Intergenic
1132765275 16:1531358-1531380 TGAGGGTGGCTGGCGAACAGCGG + Intronic
1132775804 16:1593349-1593371 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1133070739 16:3245246-3245268 TCACTAAGGCTGGAGAGCAGTGG - Intronic
1133365966 16:5210420-5210442 GCAGTCTGGCTGGAGGACAGTGG - Intergenic
1133457968 16:5959770-5959792 TCAGCCAGGCTGGAGTTCAGTGG - Intergenic
1133751453 16:8729262-8729284 TCACTCAGGCTGGAGAGCAGTGG - Intronic
1133964134 16:10519046-10519068 CCAGTCTGGATGGAGTTCAGCGG + Intergenic
1133966785 16:10537515-10537537 CCAGTGGGGCTGGAGTGCAGTGG - Intronic
1133967355 16:10541046-10541068 TCACTCTGGCTGGAGTGCAGTGG - Intronic
1134286281 16:12864743-12864765 TCACCCTGGCTGGAGAGCAGTGG + Intergenic
1134325722 16:13205799-13205821 TCACTCTGGCTGGAGCGCAGTGG + Intronic
1134351765 16:13444329-13444351 TCACTGAGACTGGAGTTCAGTGG - Intergenic
1134383979 16:13754917-13754939 TCACTCAGGCTGGAGAGCAGTGG + Intergenic
1134385481 16:13768148-13768170 ACAGTGTGGTTGGGGATGAGTGG - Intergenic
1134501922 16:14776036-14776058 TCACCATGGCTGGAGTTCAGTGG + Intronic
1134501947 16:14776318-14776340 TCACCATGGCTGGAGTTCAGTGG + Intronic
1134578614 16:15352575-15352597 TCACCATGGCTGGAGTTCAGTGG - Intergenic
1134578639 16:15352858-15352880 TCACCATGGCTGGAGTTCAGTGG - Intergenic
1134627179 16:15730500-15730522 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1134723949 16:16404687-16404709 TCACCATGGCTGGAGTTCAGTGG + Intergenic
1134723974 16:16404969-16404991 TCACCATGGCTGGAGTTCAGTGG + Intergenic
1134748332 16:16605317-16605339 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1134943456 16:18306900-18306922 TCACCATGGCTGGAGTTCAGTGG - Intergenic
1134943481 16:18307183-18307205 TCACCATGGCTGGAGTTCAGTGG - Intergenic
1135051235 16:19194633-19194655 TCACTGAGGCTGGAGTGCAGGGG + Intronic
1135116715 16:19729993-19730015 TCAGGCTGGCTGGAGTGCAGTGG + Intronic
1135473139 16:22750064-22750086 TCAGGGAGGCTGCAGCTCAGGGG + Intergenic
1135579008 16:23609383-23609405 TCATTCAGGCTGTAGATCAGTGG - Intronic
1135664917 16:24327578-24327600 TCACTGAGGCTGGAGTGCAGCGG - Intronic
1135668320 16:24354150-24354172 TCACTCTGGCTGGAGTGCAGTGG - Intronic
1135690393 16:24532619-24532641 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1135719308 16:24801563-24801585 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1135846185 16:25920640-25920662 TCACTGGGGCTGGAGTACAGTGG + Intronic
1135882711 16:26274461-26274483 ACAGTGTGGCTGGAGCTCTGTGG - Intergenic
1136472077 16:30487743-30487765 TCAGCCAGGCTGGAGAGCAGTGG + Intronic
1136537343 16:30907788-30907810 TCAATGAGCCTGGAGTTCAGAGG - Intergenic
1136594729 16:31240119-31240141 TCACTCAGGCTGGAGTTCAGAGG + Intergenic
1136609717 16:31358855-31358877 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1136611597 16:31369823-31369845 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1136639594 16:31551836-31551858 TCAGCCAGGCTGGAGAGCAGTGG - Intergenic
1136903236 16:34063568-34063590 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1136923157 16:34347816-34347838 TCACCTTGGCTGGAGTTCAGTGG + Intergenic
1136981416 16:35063990-35064012 TCACCTTGGCTGGAGTTCAGTGG - Intergenic
1137282458 16:46989643-46989665 TTACTCTGGCTGGAGTTCAGTGG + Intergenic
1137348797 16:47691661-47691683 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1137501506 16:49014984-49015006 TCAGTGTGGCCGGAGCAGAGTGG + Intergenic
1137512371 16:49112976-49112998 TCCCTGTGGCTGCAGAACAGAGG + Intergenic
1137537963 16:49341882-49341904 GCTGTGTGGCTGGAGTTCAGTGG + Intergenic
1137599475 16:49746515-49746537 TCACCCTGGCTGGAGAGCAGTGG + Intronic
1138002261 16:53293906-53293928 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1138442515 16:57043501-57043523 TCACTGAGGCTGGAGATCACAGG - Exonic
1138566912 16:57840296-57840318 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1138628169 16:58269289-58269311 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1138644195 16:58411351-58411373 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1138677686 16:58663916-58663938 TGAGTGTGGCTGGAGCGGAGAGG + Intergenic
1139246744 16:65452202-65452224 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1139347737 16:66315163-66315185 TCACTCTGGCTGGAGTGCAGTGG - Intergenic
1139351206 16:66337186-66337208 TCGGTGTGGCTGGAGCTTGGAGG + Intergenic
1139368088 16:66446141-66446163 TCACCCAGGCTGGAGATCAGTGG - Intronic
1139412279 16:66773464-66773486 CCAGTGTAGCTTGAGCTCAGAGG - Intronic
1139451774 16:67033377-67033399 TCACTCTGGCTGGAGTGCAGTGG + Intronic
1139525800 16:67515558-67515580 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1139627281 16:68200304-68200326 TCAGTATGGCCTGAGGTCAGGGG + Intronic
1139764220 16:69213537-69213559 TCACTGAGGCTGGAGAGCAGTGG + Intronic
1139850065 16:69946051-69946073 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1139879050 16:70168959-70168981 TCACTGAGGCTGGAGTTCAGTGG - Intergenic
1140028652 16:71315711-71315733 GCAGTGTGCTTGGAGTTCAGAGG + Intergenic
1140091402 16:71842009-71842031 TCACTGGGGCTGGAGTGCAGTGG + Intergenic
1140099786 16:71906041-71906063 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1140373469 16:74426531-74426553 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1140440933 16:74987134-74987156 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1140542246 16:75767697-75767719 TCAATGAGGCTGGAGTGCAGTGG + Intergenic
1140569345 16:76085164-76085186 TCATTCAGGCTGGAGTTCAGTGG + Intergenic
1140766283 16:78161484-78161506 TCACTCTGGCTGGAGTGCAGTGG + Intronic
1140766578 16:78165075-78165097 CTAGTGTGGCTGGAGATGAATGG + Intronic
1140867719 16:79078439-79078461 GCAGGGTGGCTGGAGTTGAGAGG + Intronic
1140901580 16:79372811-79372833 TCAGTGGGTCTGGAGCTGAGAGG - Intergenic
1140986283 16:80160846-80160868 TCAGTGTGACTGGTTATCTGGGG - Intergenic
1141246903 16:82316478-82316500 TCACTCAGGCTGGAGCTCAGTGG + Intergenic
1141288719 16:82697467-82697489 TCACTGGGGCTGGAGTGCAGTGG + Intronic
1141453562 16:84122011-84122033 GCTGTGTGGATGGAGATCATTGG - Intergenic
1141511933 16:84518018-84518040 TCATTGAGGCTGGAGTGCAGTGG + Intronic
1141923985 16:87154965-87154987 TCATGGTGGCTGGAGTGCAGTGG - Intronic
1142323267 16:89398702-89398724 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1142338278 16:89504623-89504645 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1142391719 16:89805499-89805521 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1142475294 17:185189-185211 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1142621159 17:1166477-1166499 TCAGTGTGGCCGGAGGCCCGGGG + Intronic
1142732765 17:1872750-1872772 TCAGCGGGGCTGGAGTGCAGTGG + Intronic
1143148501 17:4791633-4791655 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1143580351 17:7822007-7822029 TCACTGTGGCTGGACCGCAGTGG + Intronic
1143666876 17:8367621-8367643 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1143804578 17:9415727-9415749 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
1143921934 17:10336955-10336977 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1144242260 17:13324080-13324102 TCATTGTGACTGGAGACTAGTGG + Intergenic
1144526075 17:15991066-15991088 TCACTGAGGCTGGAGTACAGTGG - Intronic
1144699125 17:17325312-17325334 TCTGAGTGTCTGGAGCTCAGAGG - Intronic
1144743576 17:17598172-17598194 CCAGTGTGGCTGGAGTACAGAGG - Intergenic
1145183065 17:20769994-20770016 TCACTCAGGCTGGAGCTCAGTGG - Intergenic
1145393986 17:22479358-22479380 TCACTCAGGCTGGAGTTCAGAGG - Intergenic
1145783000 17:27576012-27576034 TCCTTGTGGCTGGAGGTCTGAGG + Intronic
1145884878 17:28374931-28374953 TCACTGAGGCTGGAAAGCAGTGG - Intronic
1146115388 17:30132977-30132999 TCACTCTGGCTGGAGTGCAGTGG + Intronic
1146174109 17:30653919-30653941 TCAGGGTGGCTAGAGAGCAATGG + Intergenic
1146259875 17:31414365-31414387 TCAGTCTGGCTGAAGAGCTGTGG + Intronic
1146325232 17:31880379-31880401 TCACCCTGGCTGGAGTTCAGTGG - Intronic
1146347564 17:32069946-32069968 TCAGCGTGGCTAGAGAGCAATGG + Intergenic
1146391946 17:32430809-32430831 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1146443788 17:32920165-32920187 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1146759194 17:35461289-35461311 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1146833640 17:36091975-36091997 TCAGTGGAGCTGCAGAGCAGTGG + Intergenic
1146848230 17:36198814-36198836 TCAGTGGAGCTGCAGAGCAGTGG + Intronic
1147280482 17:39356393-39356415 TCACTGAGGCTGGAGTACAGTGG + Intronic
1147782589 17:42954314-42954336 TTAGTGTGTCTGGAGTGCAGTGG - Intronic
1147802828 17:43106077-43106099 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1147930336 17:43976730-43976752 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1148473477 17:47911184-47911206 TCACCCTGGCTGGAGAGCAGTGG - Intronic
1148511627 17:48175855-48175877 ACTGTGTGGCTGGGGCTCAGTGG + Intronic
1148520491 17:48270381-48270403 TCACTGAGGCTGGAGTGCAGGGG + Intronic
1148540239 17:48474483-48474505 TCACTCAGGCTGGAGAACAGTGG - Intergenic
1148588590 17:48798697-48798719 TCACTCTGGCTGGAGCGCAGTGG - Intronic
1148681906 17:49478981-49479003 TGAGTGTGGCTGGGCACCAGTGG - Intergenic
1148694661 17:49551697-49551719 GCAGTCTGTCTGGAGGTCAGAGG + Intergenic
1148941121 17:51212316-51212338 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
1149233633 17:54565673-54565695 ACAGTGTGGCTGGAGATTTGGGG + Intergenic
1149742374 17:59058822-59058844 TCACTGAGGCTGGAGCACAGTGG - Intronic
1149764218 17:59261534-59261556 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1149959533 17:61092943-61092965 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1150638103 17:66930744-66930766 TCACTGGGGCTGGAGTGCAGTGG - Intergenic
1150673992 17:67228620-67228642 TCATCCTGGCTGGAGTTCAGTGG - Intronic
1150681201 17:67285920-67285942 TCGCTGTGGCTGGAGTGCAGTGG - Intergenic
1150702546 17:67460461-67460483 TCAGCCAGGCTGGAGAGCAGTGG + Intronic
1150882541 17:69046999-69047021 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1151079500 17:71312312-71312334 TAAGTGCTGCTGGAGATCAGAGG - Intergenic
1151440759 17:74127418-74127440 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1151569000 17:74916667-74916689 TCAGTCTGGCTGGAGAGCTTTGG + Exonic
1151616317 17:75214815-75214837 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
1151848039 17:76671733-76671755 TGAGTGTGGCCGGACATCCGGGG + Intergenic
1151897518 17:76990323-76990345 TCCGTGTGGCAGGAGGTCACGGG - Intergenic
1152074226 17:78148862-78148884 ACTGTGTGGATGGAGATCAAAGG + Intronic
1152179678 17:78811089-78811111 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1152261249 17:79268513-79268535 GAACTGTGGCTGGAGCTCAGAGG - Intronic
1152482146 17:80561468-80561490 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1152504810 17:80741793-80741815 TTCGTGTGGCTGGAGAGGAGAGG + Intronic
1152791383 17:82282270-82282292 TCAGGGCTGCTGGAGACCAGTGG + Intergenic
1153078662 18:1195054-1195076 TCACTGAGGCTGGAGTGCAGCGG + Intergenic
1153226647 18:2905641-2905663 TTAGTGAGGCTGGAGTGCAGCGG + Intronic
1153238026 18:3006958-3006980 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1154115406 18:11609526-11609548 TCACAGTGGCTGGAGCTCTGAGG + Intergenic
1154189324 18:12215659-12215681 TTACTGAGGCTGGAGGTCAGAGG - Intergenic
1154360397 18:13655883-13655905 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1155284671 18:24275409-24275431 TCAGAGTGGAAGGAGATCTGAGG + Intronic
1155571757 18:27202272-27202294 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1155868480 18:30995930-30995952 TCGCTGAGGCTGGAGTTCAGTGG - Intronic
1155955928 18:31956813-31956835 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1156016241 18:32550471-32550493 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1156120942 18:33841937-33841959 TCATTGTGGCTGAAGAGCGGGGG + Intergenic
1156241244 18:35256811-35256833 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1156287614 18:35714268-35714290 TCACTTAGGCTGGAGAGCAGTGG - Intergenic
1156727443 18:40146678-40146700 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1157249731 18:46083943-46083965 TCACTGAGGCTGGAGTGCAGTGG - Exonic
1157258157 18:46156677-46156699 TCAGTGAGGATGGAGAACAGAGG + Intergenic
1157317759 18:46607127-46607149 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1157611431 18:48958777-48958799 TCACTTAGGCTGGAGAGCAGTGG - Intergenic
1157805291 18:50653359-50653381 TCAGCGAGACTGGAGATCAGAGG + Intronic
1157832721 18:50871688-50871710 TCACTGAGGCTGGAGTGCAGCGG - Intergenic
1157910918 18:51616844-51616866 TCAATGGGGCTGGGGCTCAGTGG - Intergenic
1157996067 18:52557697-52557719 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1158117825 18:54016313-54016335 CCAATGTGGCTGGAGTTCACAGG - Intergenic
1158206848 18:55002570-55002592 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1158252637 18:55506900-55506922 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1158475254 18:57774060-57774082 GCAGGGTGGCTGTAGATGAGAGG - Intronic
1158700454 18:59741180-59741202 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1158947681 18:62461838-62461860 TCATTGAGGCTGGAGGGCAGTGG + Intergenic
1159074898 18:63668983-63669005 TCAGCCAGGCTGGAGAGCAGTGG - Intronic
1159249073 18:65850122-65850144 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1159436815 18:68428935-68428957 TCAATCTGGCTGGAGTGCAGTGG - Intergenic
1159680992 18:71351819-71351841 TCACCGTGGCTGGAGTGCAGTGG - Intergenic
1159688918 18:71460667-71460689 TTAATGTGGCTGGAGCTTAGTGG + Intergenic
1160083727 18:75754456-75754478 CCAGTGAGGCTGGAGCTGAGGGG + Intergenic
1160384142 18:78484869-78484891 TCAGTGTGGCAGGAAGGCAGCGG + Intergenic
1160636827 19:81473-81495 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1161467766 19:4441566-4441588 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1161556672 19:4946612-4946634 TCATTCTGGCTGGAGTGCAGTGG + Intronic
1161907132 19:7165084-7165106 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1161948955 19:7456675-7456697 GCAGTCTTGCTGGAGAGCAGTGG - Intronic
1162157888 19:8692118-8692140 GCAGTGTGGCTGGAGGTAAAGGG + Intergenic
1162436964 19:10666713-10666735 TCAGGTAGGCTGGAGTTCAGTGG + Intronic
1162441694 19:10696224-10696246 TCAGTGTGGCTGGAGGTGAGCGG - Intergenic
1162491069 19:10992149-10992171 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1162493152 19:11007045-11007067 TCACTCTGGCTGGAGGGCAGTGG - Intronic
1162512102 19:11125428-11125450 TCACTGAGGCTGGAGTCCAGTGG - Intronic
1162710628 19:12591348-12591370 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
1162731241 19:12720358-12720380 CCAGGGTGGCTGGAGTACAGTGG + Intronic
1162835980 19:13318335-13318357 TCAGTGTGGCTGGAGTGGAGTGG + Intronic
1162862302 19:13515393-13515415 TCACTGAGGCTGGAGTACAGTGG - Intronic
1162908734 19:13838344-13838366 TCACTTAGGCTGGAGTTCAGTGG - Intergenic
1162938818 19:13995993-13996015 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1162986055 19:14270834-14270856 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1162994659 19:14326534-14326556 TCACTCTGGCTGGAGTGCAGTGG - Intergenic
1163077393 19:14906707-14906729 TCACCCTGGCTGGAGAGCAGTGG - Intergenic
1163244240 19:16082950-16082972 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1163307995 19:16494399-16494421 TCACTGAGGCTGGAGTGCAGGGG + Intronic
1163353886 19:16797138-16797160 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1163429920 19:17261217-17261239 CCAGTGTGGCTGGAACACAGGGG - Intronic
1163619602 19:18350883-18350905 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1163768778 19:19178350-19178372 TCAGTCAGGCTGGGGAGCAGGGG + Intronic
1163887323 19:19978043-19978065 TCAGTGTGGGTGAAGATGTGGGG - Intergenic
1163950701 19:20582413-20582435 TCAGTGTGGGTGAAGATGTGGGG - Intronic
1163956601 19:20648134-20648156 TCACTGAGGCTGGAGCACAGTGG - Intronic
1163961468 19:20698908-20698930 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1164003480 19:21128457-21128479 ACAGTGAGGCTGGAGATATGGGG + Intergenic
1164106485 19:22110791-22110813 GCACTGTAGCTGGAGATCACTGG + Intergenic
1164171626 19:22730404-22730426 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1165488794 19:36111306-36111328 TCACTGTGCCTGGAGGTAAGGGG + Exonic
1165684944 19:37811877-37811899 TCAGGCTGGATGGAGTTCAGTGG - Intronic
1165748185 19:38243334-38243356 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1165837275 19:38766628-38766650 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1165940250 19:39411342-39411364 CCAGTGTGGCTGGAGCAGAGTGG - Intergenic
1166341064 19:42137297-42137319 TCACTCAGGCTGGAGAGCAGTGG - Intronic
1166365369 19:42275507-42275529 CCAGGGTGGCTGGAGAGCTGAGG + Intronic
1166371703 19:42305167-42305189 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1166929177 19:46291041-46291063 CCAGTGTGGCTGGAGCAGAGGGG - Intergenic
1167131157 19:47586739-47586761 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1167233495 19:48299369-48299391 TCAGCCAGGCTGGAGAGCAGTGG - Intronic
1167252658 19:48408778-48408800 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1167327188 19:48833948-48833970 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1167390904 19:49194292-49194314 TCACTCAGGCTGGAGAGCAGTGG + Intronic
1167395821 19:49227912-49227934 TCACTGAGGCTGGAGAGCTGTGG - Intergenic
1167486139 19:49763939-49763961 TCATGGAGGCTGGAGTTCAGTGG + Intergenic
1167564522 19:50248110-50248132 TCAGTGAGGCTGAAGAGCAAGGG + Intronic
1167660063 19:50791060-50791082 TCAGAGTTGATGGAGGTCAGAGG - Intronic
1167866046 19:52328977-52328999 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1167928509 19:52844078-52844100 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1168365848 19:55786479-55786501 TCACTCAGGCTGGAGAGCAGTGG - Intronic
1168429454 19:56266535-56266557 TCACTGAGGCTGGAGAGCAGTGG + Intronic
1168518764 19:57031803-57031825 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1202672939 1_KI270710v1_random:10270-10292 TCAGTGTGGTTGGAGAAAACAGG - Intergenic
1202711439 1_KI270714v1_random:21387-21409 TCACTGAGGCTGGAGTACAGTGG - Intergenic
925547969 2:5038851-5038873 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
926263119 2:11285785-11285807 TCACTGAGGCTGGAGTGCAGTGG - Intronic
926271156 2:11367055-11367077 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
926284638 2:11478827-11478849 TCAGCGAGGCTGGAGTACAGTGG - Intergenic
926668056 2:15546686-15546708 TCACTGAGGCTGGAGTGCAGTGG - Intronic
926819884 2:16840321-16840343 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
926890075 2:17631924-17631946 TCACTGAGGCTGGAGTGCAGTGG + Intronic
927605414 2:24482509-24482531 TCAGCTTGGCAGGAGATGAGGGG - Intergenic
927835455 2:26394351-26394373 TCACTCTGGCTGGAGTGCAGTGG - Exonic
927894087 2:26770365-26770387 TCACTGAGGCTGGAGTGCAGTGG - Intronic
928580432 2:32701969-32701991 TCACTGAGGCTGGAGTGCAGTGG - Intronic
928639291 2:33281029-33281051 TCACTCGGGCTGGAGAGCAGTGG - Intronic
929326316 2:40615799-40615821 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
929406991 2:41653820-41653842 TCACTGAGGCTGGAGTTCAGTGG + Intergenic
929625678 2:43404230-43404252 TCACTCAGGCTGGAGTTCAGTGG + Intronic
929643656 2:43606681-43606703 TCACTCAGGCTGGAGAGCAGTGG + Intergenic
929680729 2:43991067-43991089 TCACTGAGGCTGGAGTGCAGTGG + Intronic
930341438 2:50121062-50121084 TCACTGAGGCTGGAGTGCAGTGG + Intronic
930693974 2:54392225-54392247 TCATCATGGCTGGAGTTCAGTGG - Intergenic
930704373 2:54489657-54489679 TCAGCCTGGCTGGAGTGCAGTGG - Intronic
931349850 2:61477268-61477290 TCACTCTGGCTGGAGTGCAGTGG + Intergenic
931358451 2:61557361-61557383 TCACCCTGGCTGGAGTTCAGTGG + Intergenic
931399793 2:61921015-61921037 TCACTGAGGCTGGAGTACAGAGG + Intronic
931717943 2:65043997-65044019 TCACCGAGGCTGGAGAGCAGTGG - Intergenic
932173651 2:69579545-69579567 TCATTGAGGCTGGAGTGCAGTGG - Intronic
932175740 2:69599815-69599837 TCACTGAGGCTGGAGTGCAGTGG + Intronic
932229188 2:70068456-70068478 TGAGTCTGGCTGGAGAACGGGGG + Intergenic
933233450 2:79836807-79836829 TCACTCAGGCTGGAGAGCAGTGG + Intronic
933524231 2:83415842-83415864 TCAGCCAGGCTGGAGAGCAGTGG + Intergenic
933879025 2:86649350-86649372 TCAGTCTGGCTGGTGGTAAGAGG - Intronic
933906658 2:86900542-86900564 TCCCTGTGGCTGGAGTACAGTGG - Intergenic
933915506 2:86988403-86988425 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
934007487 2:87781498-87781520 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
934024815 2:87993093-87993115 TCCCTGTGGCTGGAGTACAGTGG + Intergenic
934066164 2:88344138-88344160 TCACCGTGGCTGGAGTGCAGTGG + Intergenic
934875722 2:97917984-97918006 TCACTGAGGCTGGAGTGCAGTGG + Intronic
935269411 2:101420501-101420523 TCACCGAGGCTGGAGTTCAGTGG - Intronic
935575941 2:104710472-104710494 TCTCTGTGGCTGGAGTGCAGTGG - Intergenic
935668413 2:105534649-105534671 TCACTGGGGCTGGAGTGCAGTGG + Intergenic
935684036 2:105668083-105668105 TGTGTGTGGCTGGGCATCAGAGG + Intergenic
935718689 2:105960718-105960740 TCAGTGTGGCTGGAGGGCGGTGG - Intergenic
935771127 2:106422418-106422440 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
935775892 2:106471171-106471193 TCCCTGTGGCTGGAGTACAGTGG + Intergenic
935908952 2:107873532-107873554 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
935995633 2:108768992-108769014 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
936130734 2:109838646-109838668 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
936213963 2:110532839-110532861 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
936498715 2:113048400-113048422 TCACTCAGGCTGGAGAGCAGTGG - Intronic
936564649 2:113573568-113573590 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
936799086 2:116244370-116244392 ACAGTGTGGCTGGACCTCATGGG + Intergenic
937162902 2:119782743-119782765 TCATCCAGGCTGGAGATCAGTGG + Intronic
937375689 2:121334378-121334400 TCACTCAGGCTGGAGAGCAGTGG + Intergenic
937466168 2:122134966-122134988 TCATAGTGGCTGGAGCTGAGTGG + Intergenic
937854006 2:126659819-126659841 TCACTCTGGCTGGAGTGCAGTGG + Intronic
938138948 2:128781162-128781184 TGAGTGTGTGTGGAGATAAGTGG + Intergenic
938262803 2:129907312-129907334 CCACAGTGGCTGGAGATGAGAGG + Intergenic
938268788 2:129950391-129950413 TCACTGAGGCTGGAGTCCAGTGG - Intergenic
938290342 2:130145662-130145684 TCACTTAGGCTGGAGTTCAGTGG - Intergenic
938466194 2:131527303-131527325 TCACTTAGGCTGGAGTTCAGTGG + Intergenic
938797944 2:134734560-134734582 TGAGTGTGGCTGGAGCTTAGGGG - Intergenic
938879471 2:135569764-135569786 TCACTCAGGCTGGAGTTCAGTGG + Intronic
939179741 2:138790179-138790201 TCAGATTTGCTGAAGATCAGAGG + Intergenic
939292256 2:140211708-140211730 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
939389200 2:141544703-141544725 TCACTGAGGCTGGAGTGCAGTGG + Intronic
939427319 2:142056109-142056131 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
940041704 2:149368335-149368357 TCAGTATGGATGGAGTTTAGGGG + Intronic
940140947 2:150489843-150489865 TGATTGTGGCTGGACAACAGAGG + Intronic
940309988 2:152268435-152268457 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
940551315 2:155160571-155160593 TCAGTGATGCTGGAGATGAAGGG + Intergenic
940635092 2:156289870-156289892 TCAGTCAGGCTGGAGTGCAGTGG + Intergenic
940641902 2:156353670-156353692 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
940687267 2:156868511-156868533 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
940695808 2:156976944-156976966 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
941025467 2:160451646-160451668 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
941106503 2:161360393-161360415 TCACTGAGGCTGGAGTGCAGTGG + Intronic
941156089 2:161980147-161980169 TCAGTGTGTCTGGAGGTCCTTGG + Intronic
941286617 2:163621694-163621716 TCAGTCTATCTGGAAATCAGAGG - Intronic
941439517 2:165515843-165515865 TCACTCAGGCTGGAGTTCAGTGG + Intronic
941700033 2:168594543-168594565 TCATTGAGGCTGGAGTGCAGTGG - Intronic
941907701 2:170732808-170732830 TCACTGAGGCTGGAGGGCAGTGG - Intergenic
941946414 2:171103312-171103334 TCACTGAGGCTGGAGTGCAGTGG + Intronic
942160826 2:173184868-173184890 TCACTCTGGCTGGAGTGCAGTGG - Intronic
942206991 2:173629096-173629118 TCAGTGTGGCTGGATATGAGTGG + Intergenic
942241648 2:173967715-173967737 TCAGTCTTGCTGGAGCGCAGTGG - Intergenic
943148872 2:184084125-184084147 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
943370565 2:187010803-187010825 TCACTCTGGCTGGAGTGCAGTGG - Intergenic
943558013 2:189428576-189428598 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
943663534 2:190584834-190584856 TCACTTAGGCTGGAGAGCAGTGG - Intergenic
943686506 2:190823953-190823975 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
944143833 2:196484997-196485019 CCAGTATGGTTGGAGAGCAGGGG + Intronic
944530261 2:200660904-200660926 TCAGTGTGGCTGGAGAAAGCTGG + Intronic
944575204 2:201084595-201084617 TCACTGAGGCTAGAGAGCAGTGG - Intronic
944641654 2:201732526-201732548 TCACTGGGGCTGGAGTGCAGTGG - Intronic
944804400 2:203266939-203266961 TCACTGAGGCTGGAGTGCAGTGG - Intronic
944900956 2:204215614-204215636 TCAGTATGGCTGGAGTGGAGTGG - Intergenic
945062613 2:205922511-205922533 TGAGTGAGGCTGGAGTGCAGTGG + Intergenic
945139305 2:206667003-206667025 TCAGCCAGGCTGGAGAGCAGTGG - Intronic
945474322 2:210263655-210263677 TCACTAAGGCTGGAAATCAGAGG - Intergenic
945525776 2:210886531-210886553 GCAGTGTGACTGGAACTCAGGGG + Intergenic
945728377 2:213502163-213502185 TCACTCAGGCTGGAGAGCAGTGG + Intronic
945885129 2:215367480-215367502 TCAGTGTTGAATGAGATCAGAGG - Intronic
946293460 2:218764160-218764182 TCACTCTGGCTGGAGTGCAGTGG + Intergenic
946389653 2:219407867-219407889 TCACTCAGGCTGGAGAGCAGTGG + Intergenic
946554661 2:220842168-220842190 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
947199973 2:227606452-227606474 TCACTGGGGCTGGAGTGCAGTGG - Intergenic
947275100 2:228381893-228381915 TCAGTGTGGCTAGAGCAGAGTGG + Intergenic
947424503 2:229971313-229971335 TCACTCAGGCTGGAGTTCAGTGG - Intronic
947684292 2:232068856-232068878 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
947777607 2:232726327-232726349 TCACTGGGGCTGGAGTGCAGTGG - Intronic
948001023 2:234567598-234567620 CCAGTGTTGCTGGACATCAGGGG - Intergenic
948097719 2:235349762-235349784 CCAGTGTGGCGGGAGGGCAGTGG + Intergenic
948280067 2:236740296-236740318 CCAGTGTGGCTGGAGAGAAGTGG + Intergenic
948512264 2:238476487-238476509 CCAGTGAGGCTGGAGTGCAGAGG + Intergenic
948750831 2:240131971-240131993 TCAGTGTGGCTGGGGAGCGTCGG - Intronic
948979641 2:241486420-241486442 TCACTGGGGCTGGAGTGCAGTGG - Intronic
1168895459 20:1320621-1320643 ACAGTGAGGCTGGAGATGAGTGG - Intronic
1169116624 20:3070556-3070578 TCACTCTGGCTGGAGTGCAGTGG + Intergenic
1169374381 20:5054699-5054721 TCACTTTGGCTGGAGTGCAGTGG - Intergenic
1169647111 20:7824127-7824149 CCAGTGTGGCTGGAACTGAGTGG + Intergenic
1170014119 20:11761859-11761881 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1170590280 20:17766136-17766158 CCAGTGTGGCTGGAGCAGAGTGG + Intergenic
1170693741 20:18638582-18638604 CCAGTGTGGCTGGAGCTTGGAGG + Intronic
1171482463 20:25464375-25464397 TCACTCTGGCTGGAGTGCAGTGG - Intronic
1171540990 20:25956189-25956211 TCAAAGTGGCTGGGGATCATGGG + Intergenic
1171800072 20:29604118-29604140 TCAAAGTGGCTGGGGATCATGGG - Intergenic
1171844015 20:30252560-30252582 TCAAAGTGGCTGGGGATCATGGG + Intergenic
1171940023 20:31319383-31319405 TCAGTCAGGCTGGAGTGCAGTGG + Intergenic
1172038624 20:32028392-32028414 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1172136028 20:32687436-32687458 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1172142231 20:32731276-32731298 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1172440539 20:34962665-34962687 TCTGTCAGGCTGGAGAGCAGTGG + Intergenic
1173037534 20:39427163-39427185 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1173287270 20:41684085-41684107 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1173535495 20:43808809-43808831 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1173599669 20:44284634-44284656 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1173747087 20:45445970-45445992 CCAGTGTGGCTGGGGCTGAGTGG + Intergenic
1173789692 20:45819980-45820002 TCAGCCAGGCTGGAGAGCAGTGG - Intergenic
1173987136 20:47270196-47270218 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1174070747 20:47897464-47897486 TTAGTGGAGCTGGAGATCACAGG + Intergenic
1174153315 20:48501192-48501214 TTAGTGGAGCTGGAGATCACAGG - Intergenic
1174253967 20:49240465-49240487 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1174299261 20:49569571-49569593 TCAGTGTGGCTGGAGCAGAGTGG - Intergenic
1174357070 20:50005671-50005693 TCAGTGTGGCTGGGGGAGAGAGG + Intergenic
1174391119 20:50218941-50218963 TGAGAGTGGCCAGAGATCAGGGG - Intergenic
1174582085 20:51579301-51579323 ACTGTGTGGCTAGAGAGCAGGGG + Intergenic
1174595052 20:51677281-51677303 TCAGTGTAGCCGCAGATCATTGG - Intronic
1174603753 20:51745393-51745415 TCACTCTGGCTGGAGTGCAGTGG - Intronic
1174638238 20:52020317-52020339 TCAGCCAGGCTGGAGTTCAGTGG - Intergenic
1175164454 20:57033402-57033424 GCAGTGGGGCTGGAGAGAAGGGG + Intergenic
1175201660 20:57282255-57282277 TCACTGAGGCTGGAGTACAGTGG + Intergenic
1175432709 20:58917894-58917916 TCACTGAGGCTGGAGTACAGTGG - Intergenic
1175525362 20:59629908-59629930 TGGGTGTGGCTGTAGACCAGGGG + Intronic
1175954277 20:62600501-62600523 TCAGCCTGGCTGGAGTGCAGTGG - Intergenic
1176002053 20:62836618-62836640 TCACTTTGGCTGGAAAGCAGTGG - Intronic
1176030130 20:63007706-63007728 CCAGTGTGGCTGGACCCCAGGGG - Intergenic
1176042872 20:63074496-63074518 TCACCCAGGCTGGAGATCAGTGG - Intergenic
1176071412 20:63228555-63228577 TCATCCTGGCTGGAGTTCAGTGG + Intergenic
1176334971 21:5588004-5588026 TCAGTGAGGCTGGAGTGCAGTGG - Intergenic
1176368379 21:6047350-6047372 TCACAGTGGCTGGTGACCAGTGG - Intergenic
1176392786 21:6232944-6232966 TCAGTGAGGCTGGAGTGCAGTGG + Intergenic
1176410233 21:6445770-6445792 CCAGGGTGGCTGGAGCCCAGCGG + Intergenic
1176468633 21:7083230-7083252 TCAGTGAGGCTGGAGTGCAGTGG - Intronic
1176492194 21:7465008-7465030 TCAGTGAGGCTGGAGTGCAGTGG - Intergenic
1176508448 21:7673375-7673397 TCAGTGAGGCTGGAGTGCAGTGG + Intergenic
1176639028 21:9280109-9280131 TCAGTGTGGTTGGAGAAAACAGG + Intergenic
1176651584 21:9553191-9553213 TCATTCAGGCTGGAGAGCAGTGG + Intergenic
1176783895 21:13232197-13232219 GCTGTGGGGCTGGAGACCAGGGG - Intergenic
1177419425 21:20837226-20837248 TCAGTGTTGCTGGGGAACTGAGG + Intergenic
1178086090 21:29113491-29113513 TCACTGCGGCTGGAGTGCAGTGG + Intronic
1178453094 21:32722508-32722530 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1178848621 21:36194524-36194546 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1178949286 21:36973188-36973210 TCGCTGAGGCTGGAGACCAGTGG - Intronic
1178954862 21:37012841-37012863 TCAGAGTGGCAGGAAAACAGGGG - Intronic
1179142830 21:38741805-38741827 TTAGTGTGGCTGGAACTAAGGGG + Intergenic
1179231076 21:39504342-39504364 TCAGAGCGGCTAGAGATGAGAGG - Intronic
1179440985 21:41394009-41394031 ACAGTGGGGATGGAGAGCAGTGG - Intronic
1179685726 21:43054092-43054114 CCAGGGTGGCTGGAGCCCAGCGG + Intronic
1179729005 21:43357010-43357032 TCACCGAGGCTGGAGAGCAGTGG + Intergenic
1179755140 21:43491192-43491214 TCACAGTGGCTGGTGACCAGTGG + Intergenic
1180390139 22:12222701-12222723 TCAGTGTGGTTGGAGAAAATAGG - Intergenic
1180415795 22:12711766-12711788 TCAGTGTGGTTGGAGAAAATAGG + Intergenic
1180423072 22:12887616-12887638 TCAGTGTGGTTGGAGAAAACAGG + Intergenic
1180849869 22:19011855-19011877 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1181146032 22:20847715-20847737 TCACTCAGGCTGGAGAGCAGTGG - Intronic
1181261584 22:21601930-21601952 TCGCTGAGGCTGGAGTTCAGTGG - Intronic
1181320614 22:22002921-22002943 TCACCCAGGCTGGAGATCAGTGG - Intergenic
1181430519 22:22878857-22878879 TCAGTGGGGTGTGAGATCAGTGG - Intronic
1181548562 22:23620982-23621004 TCTGTGAGGATGGAGTTCAGCGG - Intronic
1182102264 22:27666267-27666289 TCACTCAGGCTGGAGCTCAGTGG - Intergenic
1182116645 22:27760467-27760489 TCACTCTGGCTGGAGTGCAGTGG - Intronic
1182118290 22:27770696-27770718 TCACCCTGGCTGGAGAGCAGTGG + Intronic
1182346519 22:29670036-29670058 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1182363934 22:29765377-29765399 TCTGTGCGGCTGGAGTGCAGTGG - Intronic
1182489354 22:30660341-30660363 TCACTCAGGCTGGAGAGCAGAGG + Intronic
1182663292 22:31940356-31940378 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1182845180 22:33424802-33424824 TCAGTCAGGCTGGAGTACAGTGG - Intronic
1182914910 22:34020666-34020688 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1182927768 22:34142324-34142346 TCAGCGAGGCTGGAGTGCAGTGG + Intergenic
1183097333 22:35560931-35560953 TCAATGTAGCTGGAGCACAGAGG + Intergenic
1183131010 22:35836063-35836085 ACAGTGTGGCTGCAGCTCCGTGG + Intronic
1183333871 22:37235761-37235783 GCACTGTGGCTGGACATTAGAGG - Intronic
1183442728 22:37832402-37832424 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1183791494 22:40074190-40074212 TCACCGAGGCTGGAGAGCAGTGG - Intronic
1183898534 22:40988278-40988300 TCAGTGTCCCTGGAAATTAGAGG - Intergenic
1183963073 22:41424361-41424383 TCATTCAGGCTGGAGTTCAGTGG + Intergenic
1184135614 22:42547715-42547737 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
1184147016 22:42617707-42617729 CCAGTGTGGCTGGAGGGGAGTGG - Intergenic
1184272772 22:43394078-43394100 TGGGTGTGGCAGGAGAGCAGTGG + Intergenic
1184794242 22:46722428-46722450 GAAGTCTGGCTGGAGAGCAGAGG + Intronic
1185233359 22:49696058-49696080 TCATTGAGGCTGGAGTGCAGTGG - Intergenic
1203314857 22_KI270736v1_random:179669-179691 TCACCCTGGCTGGAGTTCAGTGG - Intergenic
949126332 3:449383-449405 TCACTCTGGCTGGAGTGCAGGGG - Intergenic
949164534 3:922514-922536 TCAGTGCAGCTGCAGTTCAGTGG - Intergenic
949762127 3:7482382-7482404 TCAGTGTAGCTGCAGATAGGAGG + Intronic
949963072 3:9330471-9330493 TCAGAGTGGCTGGGGATCGTGGG - Intronic
950052104 3:10000075-10000097 TCATTCTGGCTGGAGTGCAGTGG + Intronic
950076473 3:10190911-10190933 TCACTGTGGCTGGGGAAGAGAGG + Intronic
950311958 3:11966644-11966666 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
950528664 3:13539892-13539914 TCAGGGTGAGTGGAGATCAGGGG + Intergenic
950591612 3:13940008-13940030 TCACTGAGGCTGGAGTTCAGTGG + Intronic
950776613 3:15355813-15355835 TCACTGTTGCTGGAGACCTGTGG - Intergenic
950843624 3:15992504-15992526 TCATTGAGGCTGGAGTGCAGTGG + Intergenic
951031076 3:17882300-17882322 TCACTGAGGCTGGAGTGCAGTGG + Intronic
951872150 3:27374775-27374797 TCCTTGTGTCTGGACATCAGGGG - Exonic
952426557 3:33180798-33180820 TCAGTGAGGCTGGAGAGCAGTGG - Intronic
952479814 3:33749456-33749478 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
952527291 3:34224027-34224049 TCACTCAGGCTGGAGAACAGTGG + Intergenic
952617124 3:35287972-35287994 TCACTGAGGCTGGAGTTCAGTGG + Intergenic
952749024 3:36809458-36809480 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
953237519 3:41119503-41119525 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
953327944 3:42028660-42028682 CCAGTGTGGCTGCAGTGCAGGGG + Intronic
953405986 3:42659984-42660006 TCAGGGTGGTTAGAGCTCAGGGG + Intronic
953633365 3:44639823-44639845 TCAGTGTGGCTAGAGTCTAGGGG + Intronic
953763865 3:45717717-45717739 ACACTGTGGCTGGGGAGCAGGGG - Intronic
953903566 3:46857119-46857141 GCAGTGTGGCTCTAGGTCAGAGG - Intergenic
954323823 3:49850692-49850714 TCAGCCAGGCTGGAGTTCAGTGG + Intronic
954425875 3:50442882-50442904 TCAGATGGGCTGGAGAGCAGGGG + Intronic
954566045 3:51600925-51600947 TCACTGAGGCTGGAGTACAGTGG - Intronic
954574228 3:51666411-51666433 GCAGGGTGGCTGGTGATAAGAGG + Exonic
954736435 3:52710720-52710742 TCAGTCAGGCTGGAGTGCAGTGG - Exonic
954866775 3:53736299-53736321 TCACTGAGGCTGGAGTGCAGTGG - Intronic
955496955 3:59543254-59543276 TCAGGGTTTCTGGAGATCACAGG - Intergenic
955503824 3:59611380-59611402 CCAGTGTGGCTGGAACACAGTGG + Intergenic
955765849 3:62343284-62343306 TCAGTATGGTTGGAACTCAGAGG - Intergenic
955839405 3:63096374-63096396 TCACTTTGGCTGGATGTCAGAGG + Intergenic
955961578 3:64346316-64346338 CCGGTGTGGCTGGAGCACAGTGG + Intronic
956174307 3:66458660-66458682 TCACCGTGGCTGGAGTGCAGTGG - Intronic
956256674 3:67290600-67290622 TCAGTGTGGCTGCAGAGGAAAGG - Intergenic
956416262 3:69033232-69033254 TCACTGAGGCTGGAGTGCAGTGG - Intronic
956634024 3:71345346-71345368 TCACTGAGGCTGGAGTTCAGTGG - Intronic
956975562 3:74574961-74574983 TCACTGAGGCTGGAGTACAGTGG + Intergenic
957026924 3:75192876-75192898 TGAGTGTGGCATGAGAGCAGTGG - Intergenic
957126053 3:76162347-76162369 TCACTCAGGCTGGAGTTCAGTGG + Intronic
957151889 3:76497067-76497089 TCATTGTGGCTGGAGTGCAGTGG - Intronic
957211286 3:77261805-77261827 TCACTCAGGCTGGAGTTCAGTGG + Intronic
957800537 3:85074153-85074175 TTAATGTGGCTGGAGAGAAGTGG - Intronic
958546794 3:95564274-95564296 TCATTCAGGCTGGAGTTCAGTGG + Intergenic
959285523 3:104403777-104403799 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
959446362 3:106445175-106445197 TCACCCTGGCTGGAGTTCAGTGG + Intergenic
959583024 3:108001356-108001378 TCATTCTGGCTGCAGCTCAGGGG - Intergenic
960048003 3:113215410-113215432 TCAGTGTGAATGGAGTTCACAGG - Intronic
960183182 3:114607056-114607078 TCACTGAGGCTGGAGTGCAGTGG - Intronic
960365922 3:116772248-116772270 TCAGTTTGACTGGAGCTCAAGGG - Intronic
960926308 3:122797939-122797961 TCACTGAGGCTGGAGTGCAGTGG - Intronic
960977150 3:123186447-123186469 TCACTGAGGCTGGAGTGCAGTGG + Intronic
961175913 3:124834824-124834846 TCACTGTGGCTGGAATGCAGAGG + Intronic
961596166 3:128019249-128019271 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
961799641 3:129437036-129437058 TCAGAGTTGCAGGAGAGCAGAGG - Exonic
962093607 3:132270749-132270771 ACAGTGTAGCGGGAGAACAGAGG + Intronic
962227838 3:133631147-133631169 TCACTTAGGCTGGAGTTCAGTGG - Intronic
963091079 3:141484678-141484700 TCAGTGTGGCTGGAGATCAGAGG + Intergenic
963865706 3:150358667-150358689 TCACCCAGGCTGGAGATCAGTGG + Intergenic
963871383 3:150418484-150418506 ACAGGGTGGCTGGAGGACAGAGG - Intronic
964632763 3:158830712-158830734 TCACTGTGGCTGGGGCACAGAGG - Intergenic
965392672 3:168123994-168124016 TGAGTGTGGCTGTATCTCAGAGG - Intergenic
965607363 3:170510348-170510370 TCACTGAGGCTGGAGTGCAGTGG - Intronic
966093337 3:176167414-176167436 TCAGTTTGGCTGGACTCCAGGGG - Intergenic
966184764 3:177217654-177217676 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
966356639 3:179086914-179086936 TCATTGGGGCTGGAGTGCAGGGG - Intergenic
966371701 3:179257121-179257143 TCACTGAGGCTGGAGTGCAGTGG - Intronic
966429148 3:179813536-179813558 TCACTGAGGCTGGAGTGCAGTGG + Intronic
966432647 3:179848511-179848533 GCACTGAGGCTGGAGTTCAGTGG - Intronic
966519378 3:180855949-180855971 TCACTGAGGCTGGAGTGCAGTGG - Intronic
966540061 3:181078997-181079019 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
966540238 3:181081186-181081208 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
966542952 3:181111936-181111958 ACACTGTGGCTGGAGTGCAGTGG - Intergenic
966563273 3:181347244-181347266 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
966606749 3:181828669-181828691 TCACTGAGGCTGGAGGGCAGTGG + Intergenic
966825328 3:183960303-183960325 CCAGTGTGGCTTGAGAGTAGGGG - Intronic
966891430 3:184410148-184410170 GCACTGTGGCTGGAGTGCAGTGG - Intronic
966957947 3:184903489-184903511 TCAGTCAGGCTGGAGTACAGTGG + Intronic
966964644 3:184978451-184978473 TCACCCTGGCTGGAGAGCAGTGG + Intronic
966978888 3:185111687-185111709 TCAGTGTGGCCAGAGATCCTGGG - Intronic
967157376 3:186705756-186705778 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
967167451 3:186795042-186795064 TCACTCAGGCTGGAGAACAGTGG + Intronic
967595714 3:191325008-191325030 TCACTGAGGCTGGAGTGCAGTGG - Intronic
967731368 3:192909895-192909917 TCACTCAGGCTGGAGAGCAGTGG - Intronic
967822013 3:193847182-193847204 TCACTCAGGCTGGAGAGCAGTGG + Intergenic
967839687 3:193995250-193995272 TTAGTGTAGCTGGATATAAGGGG + Intergenic
968020594 3:195384685-195384707 TCACTGAGGCTGGAGTACAGTGG - Intronic
968077979 3:195826875-195826897 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
968116272 3:196092510-196092532 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
968354680 3:198095803-198095825 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1202747867 3_GL000221v1_random:124910-124932 TCAGTGTGGTTGGAGAAAACAGG - Intergenic
968565872 4:1312467-1312489 TCATTCAGGCTGGAGTTCAGTGG + Intronic
968718346 4:2178649-2178671 TCACTCAGGCTGGAGTTCAGTGG + Intronic
968723908 4:2230253-2230275 TCACTCAGGCTGGAGTTCAGTGG - Exonic
968945372 4:3660921-3660943 TCACTGTGGCAGGAGGTGAGAGG + Intergenic
969076733 4:4585141-4585163 TCACTCAGGCTGGAGAGCAGTGG + Intergenic
969137846 4:5044869-5044891 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
969267900 4:6077524-6077546 TCACTGAGGCTGGAGCTCAGTGG + Intronic
970039377 4:11778830-11778852 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
971247758 4:24945659-24945681 TCAGCCAGGCTGGAGTTCAGTGG + Intronic
971290140 4:25330029-25330051 TCACTGAGGCTGGAGTGCAGTGG + Intronic
971376093 4:26056926-26056948 TCAGGCTGGCTGGAGTGCAGTGG + Intergenic
971462977 4:26922683-26922705 TCAGTTTTCCTGGAGGTCAGTGG + Intronic
971477272 4:27084153-27084175 TCAGCGTGGCTGGAACACAGAGG + Intergenic
971935556 4:33143063-33143085 TGTGTGTGGCTGGAGTACAGGGG + Intergenic
972445583 4:39140187-39140209 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
972546541 4:40085494-40085516 TCACTGAGGCTGGAGTGCAGTGG + Intronic
972596146 4:40531445-40531467 TGGGTGTGGTTGGAGATAAGGGG + Intronic
972638133 4:40902459-40902481 TCAGGGTGGCTGGAGCTGACAGG + Intronic
973304866 4:48635074-48635096 CCAGTGTGGCTGGAGCTCAAGGG + Intronic
973337645 4:48972472-48972494 TCACTGAGGCTGGAGTACAGTGG - Intergenic
973692633 4:53453515-53453537 CCAGGCTGGCTGGAGTTCAGTGG + Intronic
973752620 4:54037311-54037333 TCACTGAGGCTGGAGTTCAGTGG - Intronic
973762811 4:54135297-54135319 TCACTCTGGCTGGAGTGCAGTGG - Intronic
974064019 4:57060877-57060899 TCACTCAGGCTGGAGAGCAGTGG - Intronic
974148563 4:57976065-57976087 TCAATCAGGCTGGAGAGCAGTGG - Intergenic
975443885 4:74440664-74440686 TCAGGCTGACTGGATATCAGAGG - Intergenic
975590549 4:75995643-75995665 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
975617154 4:76257817-76257839 TCATTGTGGGAGGAGCTCAGTGG - Intronic
975867154 4:78735951-78735973 TCAGTGTTTCTTGAGAGCAGTGG + Intergenic
976554249 4:86432312-86432334 TCACTGAGGCTGGAGTGCAGTGG + Intronic
976734959 4:88300082-88300104 TCACTCTGGCTGGAGTGCAGTGG + Intergenic
976792473 4:88893785-88893807 TCAGCCTGGCTGGAGTGCAGTGG - Intronic
976906198 4:90239539-90239561 TCACTTAGGCTGGAGAGCAGTGG + Intronic
976928218 4:90529252-90529274 TCACTGGGGCTGGAGTGCAGTGG + Intronic
977216016 4:94284436-94284458 TCACTCTGGCTGGAGTGCAGTGG + Intronic
977219148 4:94318750-94318772 TCACTGAGGCTGGAGTGCAGTGG + Intronic
977241391 4:94574456-94574478 TCACTGAGGCTGGAGTGCAGTGG - Intronic
978666603 4:111191888-111191910 TCACTCAGGCTGGAGAGCAGTGG + Intergenic
978748810 4:112224359-112224381 TCAGTGTGGCTTTATATCTGTGG + Intergenic
978763140 4:112377348-112377370 TCAGTGCCTCTGGAGCTCAGTGG - Intronic
978871924 4:113589110-113589132 GCAGTGTGGCTGGGGCTGAGTGG + Intronic
978876842 4:113650044-113650066 TCACTCTGGCTGGAGGGCAGTGG - Intronic
979050671 4:115927713-115927735 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
979108371 4:116717218-116717240 CCAGTGTGACTGGAGTGCAGTGG + Intergenic
979343012 4:119550460-119550482 TAAGTGTGGCTGAAGATGAGTGG + Intronic
979353145 4:119669596-119669618 TCACTGAGGCTGGAGTACAGTGG - Intergenic
979664766 4:123298396-123298418 GCAGTGTGGCTGGGCCTCAGCGG - Intronic
980034744 4:127871004-127871026 CCAGTGTGGCTGGAGTGAAGTGG + Intergenic
980154831 4:129091998-129092020 ACAGGGAGACTGGAGATCAGGGG - Intronic
980217152 4:129867118-129867140 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
980763272 4:137265461-137265483 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
980906727 4:138955387-138955409 TCAGCCAGGCTGGAGAGCAGTGG - Intergenic
981223310 4:142262308-142262330 CCAGTGTGACTGGAGCTAAGGGG - Intronic
981263306 4:142749097-142749119 TCACTCAGGCTGGAGAGCAGTGG - Intronic
981591809 4:146372412-146372434 TCACTCAGGCTGGAGTTCAGTGG - Intronic
981993865 4:150955229-150955251 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
982176392 4:152709261-152709283 TCACTGAGGCTGGAGTGCAGGGG - Intronic
982320216 4:154069261-154069283 TCACTGAGGCTGGAGTTCAGTGG - Intergenic
982353916 4:154445769-154445791 TCACTCAGGCTGGAGCTCAGTGG - Intronic
982419053 4:155172542-155172564 TCACTGGGGCTGGTGATGAGGGG - Intergenic
982441408 4:155440618-155440640 TCAATGAGGCTGGAGTGCAGTGG + Intergenic
982461738 4:155677810-155677832 TCAGTCAGGCTGGAGTACAGTGG - Intronic
982709242 4:158743663-158743685 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
982733108 4:158977652-158977674 TCAGCCAGGCTGGAGAGCAGTGG + Intronic
982795762 4:159641578-159641600 TCTGTCCGGCTGGAGCTCAGTGG - Intergenic
982862437 4:160470101-160470123 TCACTGGGGCTGGAGTGCAGTGG + Intergenic
982869623 4:160561523-160561545 TCAGTGTGACTTCAGATGAGAGG + Intergenic
982944230 4:161598333-161598355 TCACTGAGGCTGGAGTGCAGTGG - Intronic
983113514 4:163782627-163782649 TCACTGAGGCTGGAGTGCAGTGG - Intronic
983206502 4:164915930-164915952 ACAGTGATGCTGGTGATCAGTGG - Intergenic
983212121 4:164969616-164969638 ACAGTGATGCTGGTGATCAGTGG + Exonic
983488848 4:168364078-168364100 TCACTGGGGCTGGAGTACAGTGG - Intronic
983642188 4:169953353-169953375 TCAGTGTGGCTGGAATATAGGGG + Intergenic
983935182 4:173497708-173497730 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
983970149 4:173861876-173861898 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
984064949 4:175036315-175036337 TCACTATGGCTGGAGTGCAGTGG + Intergenic
984077672 4:175204347-175204369 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
984274400 4:177592038-177592060 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
984457369 4:179987367-179987389 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
984514449 4:180720658-180720680 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
984794202 4:183643374-183643396 TCACTCAGGCTGGAGTTCAGTGG - Intronic
984828553 4:183950490-183950512 CCAGTGTGGCTGGAGCTCCTGGG + Intronic
984853565 4:184174175-184174197 TCACCGAGGCTGGAGAGCAGTGG + Intronic
985041288 4:185894064-185894086 TCAGAGGGGCTGGAGAACACAGG - Intronic
985294942 4:188426949-188426971 TCAATGAGGCTGGAGTGCAGTGG + Intergenic
1202753921 4_GL000008v2_random:38520-38542 TCAGTGTGGTTGGAGAAAACAGG + Intergenic
985888756 5:2699835-2699857 TCACCGTGGCTGGAGTTCTGAGG - Intergenic
986066130 5:4236104-4236126 TCACTCTGGCTGGAGTGCAGTGG - Intergenic
986369859 5:7069091-7069113 TCGGTGAGGCAGGAGAACAGTGG - Intergenic
986995886 5:13606611-13606633 TCACTCAGGCTGGAGCTCAGTGG - Intergenic
987312207 5:16691657-16691679 TCACTGAGGCTGGAGTGCAGTGG - Intronic
987436280 5:17897500-17897522 CCAGTGTGGCTGGAGTGGAGTGG + Intergenic
987543133 5:19280505-19280527 TCACCCTGGCTGGAGAGCAGTGG + Intergenic
987889794 5:23862615-23862637 TCACTGAGGCTAGAGTTCAGTGG - Intergenic
988053205 5:26056866-26056888 TCCATGAGGCTGGAGTTCAGGGG + Intergenic
988368938 5:30342124-30342146 TCATTGAGGCTGGAGTGCAGAGG + Intergenic
988877413 5:35462299-35462321 TCAGTCAGGCTGGAGTACAGTGG - Intergenic
988907144 5:35801471-35801493 TCACTGAGGCTGGAGAGCAGTGG - Intronic
988919237 5:35925466-35925488 TCAGTATGGTTGGAGAACAGAGG + Intronic
989217172 5:38917377-38917399 GCAGTGTGGCTGTGGACCAGTGG + Intronic
989382789 5:40825743-40825765 TCACTGAGGCTGGAGTGCAGTGG + Exonic
989459562 5:41682006-41682028 TCACTGTGGCTGGAGGCCAAAGG - Intergenic
990704326 5:58511120-58511142 TCTGGTTAGCTGGAGATCAGAGG + Intergenic
990819480 5:59821191-59821213 TCACTGAGGCTGGAGTGCAGTGG - Intronic
991294205 5:65063663-65063685 TCACTCAGGCTGGAGAGCAGTGG + Intergenic
991585459 5:68197091-68197113 CCAGCATGGCTGGAGAACAGAGG + Intronic
992399410 5:76398312-76398334 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
992731776 5:79677837-79677859 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
993056028 5:82980570-82980592 GCAGTGAGGCTGGAGTGCAGTGG - Intergenic
993122453 5:83793247-83793269 TCAATCTGGCTGGAGTGCAGTGG + Intergenic
993382493 5:87223870-87223892 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
993486016 5:88486752-88486774 TAAGTGTGCCTGGAGTTCATGGG - Intergenic
994228291 5:97281274-97281296 TCAGCTAGGCTGGAGTTCAGTGG + Intergenic
994299504 5:98130217-98130239 TCACTCTGGCTGGAGTGCAGTGG - Intergenic
994413208 5:99436350-99436372 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
994497913 5:100536014-100536036 TCAGCCTTGCTGGAGATCACCGG - Intronic
994756031 5:103794333-103794355 TCACTGAGGCTGGAGTACAGTGG + Intergenic
994763072 5:103880788-103880810 TCAGTGTAGCTGAAGAAGAGAGG - Intergenic
995059374 5:107796855-107796877 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
995495210 5:112734828-112734850 TCACTGAGGCTGGAGTACAGTGG + Intronic
995694417 5:114864272-114864294 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
995785139 5:115819722-115819744 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
996034675 5:118745344-118745366 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
996039856 5:118797368-118797390 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
996214567 5:120851088-120851110 TATGTGTGGCTGAAGAGCAGAGG + Intergenic
996436242 5:123435495-123435517 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
997334949 5:133100843-133100865 TCAGTCGGGCTGGAGTTCAGTGG + Intronic
997454494 5:134006701-134006723 TCAGTCAGGCTGGAGTACAGCGG - Intergenic
997608450 5:135193210-135193232 TCAGAGTGGCTGGAAATAAAAGG - Intronic
997904206 5:137798595-137798617 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
997973727 5:138425964-138425986 TCACCGAGGCTGGAGAGCAGTGG - Intronic
998320109 5:141221940-141221962 CCAGTGTGGATGGAGAGAAGAGG - Intergenic
998384372 5:141747982-141748004 TCTGTGTGGCTGGAGCTGAGGGG - Intergenic
998547848 5:143046262-143046284 TCATTCAGGCTGGAGTTCAGTGG - Intronic
999054319 5:148557483-148557505 TATGTGTGTCTGGAGCTCAGAGG + Intronic
999062194 5:148647807-148647829 TCAGCGAGGCTGGAGTGCAGTGG - Intronic
999239795 5:150120795-150120817 CCAGTGTGGCTGCAGCTCATAGG - Intronic
999373999 5:151073857-151073879 TCACTCAGGCTGGAGTTCAGTGG - Intronic
999806852 5:155089383-155089405 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
999873905 5:155781499-155781521 TCACTGTGGCTGGTGTGCAGTGG + Intergenic
1000345271 5:160308992-160309014 TCAGTGTGGCTTAAGAGCAATGG + Intronic
1000720568 5:164701189-164701211 TCAGCTTGGCTGGAGTGCAGTGG - Intergenic
1000848494 5:166310805-166310827 TCTGTGTGGCTGGAGTGAAGTGG - Intergenic
1001033265 5:168278228-168278250 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1001288714 5:170441493-170441515 TCTGTGTGGCAGGCGATCAATGG + Intronic
1001637646 5:173223540-173223562 TCAGAGAGGCTGGAGTGCAGTGG + Intergenic
1001728993 5:173934143-173934165 TTACTGTGGCTGGAGTACAGTGG - Intronic
1001749622 5:174118675-174118697 TGCATGTGGCTGGAGGTCAGTGG - Intronic
1001860544 5:175050566-175050588 TCAGTGTGGCTGGACAGTATGGG - Intergenic
1001930066 5:175666464-175666486 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1002025115 5:176391570-176391592 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1002032688 5:176442193-176442215 GGAGTGTGTCTGGAGCTCAGGGG - Intergenic
1002069497 5:176670903-176670925 TCCCTGAGGCTGGAAATCAGGGG + Intergenic
1002210836 5:177598306-177598328 TCAGTCAGGCTGGAGTGCAGTGG - Intergenic
1002338640 5:178499048-178499070 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1002996890 6:2294844-2294866 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1003002787 6:2351612-2351634 ACAGTGTGGCTGGTGACCACTGG + Intergenic
1003087967 6:3076638-3076660 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
1004817632 6:19329879-19329901 TCAGTGTGGCTGAAGTAGAGTGG + Intergenic
1005038674 6:21581565-21581587 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1005175916 6:23044815-23044837 TCAATGTGGATAGAGCTCAGTGG + Intergenic
1005392443 6:25347354-25347376 CCAGTGGGGCAGGAGATCAATGG - Intronic
1005689604 6:28290133-28290155 TCACTCTGGCTGGAGTGCAGTGG + Intronic
1005839557 6:29733147-29733169 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1005872327 6:29983851-29983873 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1006323245 6:33333433-33333455 TCAGTGGGGCTGGAGTGCAATGG - Intergenic
1006505347 6:34485629-34485651 TTTGTGAGGCTGGAGTTCAGGGG + Intronic
1006515421 6:34542847-34542869 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1006612846 6:35305183-35305205 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1006739575 6:36297724-36297746 TGAGTGAGGTTGGAGCTCAGAGG + Intronic
1006746246 6:36344821-36344843 TCTGTCTGGCTGGAGTGCAGTGG + Intergenic
1006841824 6:37033262-37033284 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1006888517 6:37402826-37402848 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1007085905 6:39145094-39145116 TCAGTGTGGCTTGACCTAAGTGG - Intergenic
1007301485 6:40871126-40871148 GCACTGTGGCTGGTGTTCAGGGG + Intergenic
1007525103 6:42485300-42485322 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1007565655 6:42848373-42848395 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1007645267 6:43374966-43374988 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1007649519 6:43409748-43409770 TCACTGAGGCTGGAGTACAGTGG - Intergenic
1008103873 6:47422020-47422042 TCAGCCAGGCTGGAGTTCAGTGG + Intergenic
1008148058 6:47916153-47916175 GCAGTGTGGCTCAAGATAAGAGG + Intronic
1008200060 6:48575018-48575040 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1010687098 6:78865899-78865921 TCATTCTGGCTGGAGTGCAGTGG - Intergenic
1010807430 6:80254658-80254680 TCAGTCTGCCTGGAGTGCAGTGG - Intronic
1010967866 6:82233285-82233307 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
1011068316 6:83354082-83354104 TGAGTGTAGCTGGAGAAGAGAGG - Intronic
1011088017 6:83564375-83564397 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1011475647 6:87748453-87748475 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1011673537 6:89708261-89708283 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1011746957 6:90415341-90415363 TCAGTGTGGGTTGAGAGCTGTGG - Intergenic
1011883354 6:92059525-92059547 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1012064339 6:94530588-94530610 TCAATGTGGCTGGAGATTTATGG - Intergenic
1012177981 6:96113276-96113298 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1012952384 6:105532262-105532284 CCAATTTGGCTGGAGCTCAGAGG + Intergenic
1013033219 6:106356412-106356434 TCAGTGATGCTGGAGAAGAGAGG - Intergenic
1013050880 6:106533834-106533856 TATGTGAGGCTGGAGTTCAGGGG + Intronic
1013067116 6:106694650-106694672 TCAGTGTGACTGCTGATCTGGGG - Intergenic
1013212252 6:107997625-107997647 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1013506063 6:110801443-110801465 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1014008533 6:116449821-116449843 TCAGTGAGGTTGGAGAGGAGAGG + Intergenic
1014359313 6:120456448-120456470 TCACTGGGGCTGGAGTGCAGTGG + Intergenic
1014450980 6:121581450-121581472 TCAGGGTGGCTGAATATTAGGGG - Intergenic
1015280064 6:131423558-131423580 TCTGTGTGGCTGGAGATCATGGG + Intergenic
1015411567 6:132899391-132899413 TCAGTCAGGCTGGAGTGCAGAGG - Intergenic
1015788491 6:136942803-136942825 GACTTGTGGCTGGAGATCAGTGG + Intergenic
1015950502 6:138548020-138548042 TCACTCTGGCTGGAGTGCAGTGG + Intronic
1015969724 6:138731577-138731599 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1015977796 6:138808764-138808786 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1016276167 6:142355583-142355605 TCCCTGTCGCTGGAGAGCAGAGG - Intronic
1016761962 6:147747548-147747570 TCACTGAGGCTGGAGCACAGTGG + Intergenic
1016912660 6:149214571-149214593 TCAGTGTGACTGGAGCACAGAGG - Intergenic
1017160585 6:151361955-151361977 GCAGTTTGGCTGGAGATCCGTGG + Intergenic
1018214654 6:161514926-161514948 TCAGTGCTGCTTGAGACCAGGGG - Intronic
1018806953 6:167269155-167269177 TGAGCGTGGCTGGAGACCGGCGG + Intergenic
1019417241 7:933469-933491 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417252 7:933499-933521 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417268 7:933536-933558 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417289 7:933596-933618 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417299 7:933626-933648 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417310 7:933656-933678 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417321 7:933686-933708 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417342 7:933746-933768 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417352 7:933776-933798 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417383 7:933866-933888 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417393 7:933896-933918 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417414 7:933956-933978 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417425 7:933986-934008 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417446 7:934046-934068 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417464 7:934106-934128 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417485 7:934166-934188 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417496 7:934196-934218 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019417517 7:934256-934278 TCAGTGGTGCTGGAGAGCCGGGG + Intronic
1019734200 7:2642500-2642522 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1020084870 7:5304854-5304876 TCACTGAGGCTGGAGTGCAGTGG + Exonic
1020103584 7:5409547-5409569 TTACTGGGGCTGGAGTTCAGTGG - Intronic
1020110887 7:5447154-5447176 TCACTGAGGCTGGAGTCCAGTGG + Intronic
1020147931 7:5659460-5659482 TCAGTATGGCTGGAGCCCAGTGG + Intronic
1020360667 7:7323596-7323618 CCAGTGTGGCTGGAGTTCACGGG + Intergenic
1020483992 7:8697967-8697989 TAAGTGTGGCAGGAAATCATTGG + Intronic
1020687204 7:11310572-11310594 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1020698899 7:11452502-11452524 TCAGTGAGACTGGGGATCATTGG - Intronic
1020806069 7:12791553-12791575 TCACCGAGGCTGGAGTTCAGTGG - Intergenic
1021268160 7:18550761-18550783 TCAGAGTGGCTGGAGTAGAGTGG + Intronic
1022098156 7:27153653-27153675 TGAGTATGGCTGGAGGGCAGGGG - Intergenic
1022637345 7:32149384-32149406 GCAGTGTGGTCTGAGATCAGAGG - Intronic
1022679481 7:32530914-32530936 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1023039776 7:36161852-36161874 TCACTGAGGCTGGAGAACAATGG - Intronic
1023170343 7:37385341-37385363 CCAGTGTGGCTGGAGGGGAGGGG - Intronic
1023310705 7:38883340-38883362 TGAGTGTGGCTGGAGCAGAGTGG - Intronic
1023352159 7:39331545-39331567 TCACTCTGGCTGGAGTGCAGTGG + Intronic
1023546103 7:41319025-41319047 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1023607606 7:41944254-41944276 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1023728816 7:43170592-43170614 TCAGGGTGGCTGGAAAATAGAGG + Intronic
1023743051 7:43298031-43298053 TCACCCTGGCTGGAGTTCAGTGG - Intronic
1024073424 7:45805708-45805730 TCACTGAGGCTGGAGTGCAGAGG - Intergenic
1024265695 7:47604764-47604786 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
1024292783 7:47817189-47817211 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1024572856 7:50738476-50738498 TCACTCAGGCTGGAGAGCAGTGG + Intronic
1024613277 7:51085198-51085220 TCAGTGCGGTTGGGGATCAGGGG + Exonic
1025053995 7:55749826-55749848 TCACTGAGGCTGGAGTGCAGAGG + Intergenic
1025063513 7:55832159-55832181 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1025076579 7:55949104-55949126 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1025132101 7:56380299-56380321 TCACTGAGGCTGGAGTGCAGAGG + Intergenic
1025185086 7:56851400-56851422 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1025292428 7:57742443-57742465 TCAAAGTGGCTGGGGATCATGGG + Intergenic
1025618582 7:63146414-63146436 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1025686846 7:63725564-63725586 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1025907214 7:65796712-65796734 TCAGGGTGGCTGGAGCATAGTGG + Intergenic
1026041391 7:66871105-66871127 TCAGGGTGGCTGGAGCATAGTGG + Intergenic
1026086158 7:67264911-67264933 TGAGTGAGGCTGGAGTGCAGTGG - Intergenic
1026138541 7:67684960-67684982 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1026670779 7:72388931-72388953 TCTGTGTGGCTGCAGATCGCTGG + Intronic
1026690998 7:72549898-72549920 TCTGTGAGGCTGGAGTGCAGTGG + Intergenic
1026728712 7:72892996-72893018 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1026732305 7:72922891-72922913 TGTGTGTGGCTGGAGTTAAGTGG - Intronic
1026975385 7:74494789-74494811 TCACTCAGGCTGGAGAGCAGTGG + Intronic
1027111673 7:75444470-75444492 TGTGTGTGGCTGGAGTTAAGTGG + Intronic
1027115068 7:75472471-75472493 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1027153399 7:75749407-75749429 TCACTCTGGCTGGAGTGCAGTGG + Intergenic
1027215847 7:76183274-76183296 TCACTCAGGCTGGAGAGCAGCGG - Intergenic
1027283902 7:76629001-76629023 TGTGTGTGGCTGGAGTTAAGTGG + Intergenic
1027379297 7:77588910-77588932 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
1027631443 7:80610913-80610935 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
1028208509 7:88044763-88044785 TCAGTTAGGCTGGAGTGCAGTGG + Intronic
1028322985 7:89485539-89485561 TCACTCTGGCTGGAGTGCAGTGG - Intergenic
1028540191 7:91934521-91934543 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1028553015 7:92092684-92092706 TCACTGAGGCTGGAGTACAGTGG + Intronic
1028615845 7:92765999-92766021 CCACTGTGGCTGGAGAACCGTGG + Intronic
1028847338 7:95496806-95496828 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
1029258508 7:99285640-99285662 TCTGTGTGGCTTGAGTCCAGAGG + Intergenic
1029275692 7:99402837-99402859 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1029315050 7:99704328-99704350 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1029465540 7:100722408-100722430 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1029482799 7:100823365-100823387 TCAGTGTGGCTGGAGCACAGTGG + Intronic
1029557563 7:101280935-101280957 TCAGCCTGGCTGGAGTACAGTGG + Intergenic
1029637175 7:101792781-101792803 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1029856281 7:103520313-103520335 ACAGTCTGGCTGGAGTGCAGTGG + Intronic
1030171767 7:106609859-106609881 TCACTCTGGCTGGAGTGCAGTGG + Intergenic
1030473890 7:110003425-110003447 GCAGTATGGCTGGAGTTCAGAGG + Intergenic
1030780221 7:113591789-113591811 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1030862380 7:114650743-114650765 GGAGTGTGGCTGGAGTGCAGGGG - Intronic
1031354091 7:120768726-120768748 TCAGTCAGGCTGGAGTGCAGTGG - Intergenic
1031533126 7:122900225-122900247 TCAGAGTGACTGGAAAACAGAGG + Intergenic
1031538585 7:122964770-122964792 TCACTCAGGCTGGAGAGCAGTGG - Intergenic
1031584826 7:123521605-123521627 TCACTCTGGCTGGAGGGCAGTGG - Intronic
1031745313 7:125488738-125488760 TCATTGAGGCTGGAGTGCAGTGG - Intergenic
1032045284 7:128601624-128601646 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1032160507 7:129505927-129505949 CCAGTGTGGCTGGAGTCAAGTGG + Intronic
1032187049 7:129735488-129735510 TCAGCCTGGCTGGAGTGCAGTGG - Intronic
1032351035 7:131164149-131164171 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1032487793 7:132300968-132300990 TGGGTGTGGCTGGACATCAAAGG + Intronic
1033043773 7:137942101-137942123 ACAGTGTGGCTGGTGAACTGTGG - Intronic
1033146878 7:138878720-138878742 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1033167187 7:139050405-139050427 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1033254361 7:139786953-139786975 TCAATAAGGCTGGAGGTCAGTGG - Intronic
1033427385 7:141256471-141256493 CCAGAGTGGCTGGAGCGCAGTGG + Intronic
1033991310 7:147290641-147290663 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1034127591 7:148687441-148687463 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1034177870 7:149114436-149114458 ACAGTCTGGCTGGAGTGCAGTGG + Intronic
1034247701 7:149661379-149661401 TCAGGCTGGCTGGAGTGCAGTGG + Intergenic
1035101437 7:156400765-156400787 TCACTCTGGCTGGAGTGCAGTGG + Intergenic
1035150331 7:156865265-156865287 TCACTGTGCCTGGAGTGCAGTGG - Intronic
1035220613 7:157404328-157404350 TCAGTTAGGCTGGAGTGCAGTGG + Intronic
1035857511 8:2992461-2992483 TCAGTCAGGCTGGAGTGCAGTGG + Intronic
1035967850 8:4214335-4214357 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1035996179 8:4549855-4549877 TCACTCTGGCTGGAGTGCAGTGG - Intronic
1036123439 8:6042086-6042108 CCAGTGTGGCTGGGGACCCGAGG + Intergenic
1036362910 8:8092365-8092387 TCACCGAGGCTGGAGAACAGTGG + Intergenic
1036436537 8:8739362-8739384 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1036630173 8:10507616-10507638 TCACTGTGGCTGGAGTGCAGTGG - Intergenic
1036813072 8:11880855-11880877 TCACTGAGGCTGGAGTACAGTGG - Intergenic
1036916147 8:12806028-12806050 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1037110265 8:15157346-15157368 GCAGTGTGGCTGGTGTGCAGTGG - Intronic
1037162866 8:15793936-15793958 TCAGTGTGGCTAGAGCAAAGTGG + Intergenic
1037356938 8:18030642-18030664 TCACTGAGGCTGGAGTGCAGAGG - Intergenic
1037459999 8:19099405-19099427 TCACTGAGGCTGGAGGGCAGTGG + Intergenic
1037463320 8:19135283-19135305 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1037468223 8:19181922-19181944 TGAGTGTGTTTGGAGATCATGGG - Intergenic
1037706427 8:21319279-21319301 CTAGTCTGGCTGGAAATCAGGGG + Intergenic
1037711086 8:21355941-21355963 TCAGACTGGCTGGAGGGCAGGGG - Intergenic
1038155930 8:24990478-24990500 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1038250612 8:25900417-25900439 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1038291480 8:26253328-26253350 TCACTCAGGCTGGAGAACAGTGG - Intergenic
1038540817 8:28388564-28388586 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1038747119 8:30264126-30264148 TCACTGAGGCTGGAGTACAGTGG - Intergenic
1038807632 8:30809895-30809917 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
1038955356 8:32462641-32462663 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1039540118 8:38360033-38360055 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1039709255 8:40039594-40039616 TCAGTGGAGCTGGTGATCATGGG - Intergenic
1039845315 8:41321611-41321633 CCGGTGGGGCTGGAGAGCAGAGG + Intergenic
1039848222 8:41341304-41341326 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1040029542 8:42812166-42812188 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1040361010 8:46664500-46664522 TCTGTGAGGCTGGAGTACAGTGG - Intergenic
1040489513 8:47906591-47906613 TCACTGTGTCTGGAGTGCAGTGG - Intronic
1040913103 8:52541427-52541449 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1041038404 8:53819490-53819512 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1041208244 8:55520544-55520566 TCACTCTGGCTGGAGTGCAGTGG - Intronic
1041232623 8:55768974-55768996 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1041672876 8:60510616-60510638 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1041888136 8:62836676-62836698 TCAGCCTGGCTGGAGCTGAGTGG + Intronic
1041953002 8:63525397-63525419 TCAGTCAGGCTGGAGTACAGTGG + Intergenic
1042118860 8:65461997-65462019 TCATTGAGGCTGGAGCGCAGTGG - Intergenic
1042285595 8:67107085-67107107 TCACTGAGGCTGGAGTGCAGGGG + Intronic
1042482945 8:69324186-69324208 TTTGTGTAGCTGGAGATCTGGGG - Intergenic
1042542025 8:69916853-69916875 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1042623671 8:70733065-70733087 TCACTATGGCTGGAGTGCAGTGG - Intronic
1042705710 8:71664135-71664157 TCAGTGTGGCTGGAGGAGGGTGG - Intergenic
1042884477 8:73532586-73532608 TCACTGAGGCTGGAGTACAGTGG - Intronic
1043091844 8:75914182-75914204 TCACCGAGGCTGGAGTTCAGTGG + Intergenic
1043299959 8:78715998-78716020 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1043423590 8:80125376-80125398 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1043509904 8:80940046-80940068 TCCGTGAGGCTGGAGTGCAGTGG + Intergenic
1043582265 8:81727742-81727764 CCAGTGTGGCTGGAGCAGAGTGG + Intronic
1043618251 8:82155061-82155083 TCAGTGATGCTGAAGAGCAGTGG + Intergenic
1043795821 8:84537435-84537457 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1043840281 8:85094312-85094334 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1043857925 8:85282962-85282984 TCACTGAGGCTGGAGTACAGTGG + Exonic
1043948404 8:86280177-86280199 TCACTTAGGCTGGAGTTCAGTGG + Intronic
1043954598 8:86345447-86345469 TCCCTGTGGCTGGAGTGCAGTGG + Intronic
1043987287 8:86708605-86708627 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1044598320 8:93979793-93979815 TCACTGTGGCTGGAGCCAAGTGG - Intergenic
1044706088 8:95010126-95010148 TCACTGGGGCTGGAGTGCAGTGG + Intronic
1044711338 8:95061222-95061244 TCAGTGTTTCAGTAGATCAGGGG - Intronic
1044728484 8:95212125-95212147 TCAGTGTGGCTGTGGTTTAGGGG + Intergenic
1044951187 8:97436893-97436915 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1045031384 8:98139691-98139713 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1045132783 8:99175715-99175737 TCACTCAGGCTGGAGAGCAGTGG - Intronic
1045192385 8:99895755-99895777 TCTGTCTGGCTGGAGTACAGTGG - Intergenic
1045249629 8:100472687-100472709 TCAGGGTGGATGGAGTTGAGTGG - Intergenic
1045464833 8:102460279-102460301 TCATTATGGCTGGAGTGCAGTGG - Intergenic
1045586182 8:103539780-103539802 TCAGGGTGACTGCAGCTCAGGGG - Intronic
1045610210 8:103831422-103831444 TCAGAGTGACTCGAGGTCAGTGG + Intronic
1045966027 8:108025562-108025584 TCCCTGTGGCTGGAGTACAGTGG + Intronic
1046165190 8:110424529-110424551 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1046479254 8:114793594-114793616 TCACTCTGGCTGGAGTGCAGTGG + Intergenic
1046578853 8:116067099-116067121 TCAGAGCAGCTGGAGATCATGGG + Intergenic
1047099553 8:121661658-121661680 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1047589398 8:126311213-126311235 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1047768134 8:128006061-128006083 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1047912489 8:129545315-129545337 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1048228777 8:132616624-132616646 TTAGTGAGGCTGGAAATCAGGGG + Intronic
1049167718 8:141137017-141137039 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1049347162 8:142145225-142145247 GCAGTCTTGCTGAAGATCAGGGG - Intergenic
1049479651 8:142815784-142815806 TCAGTGAGCCTGGAGCCCAGAGG - Intergenic
1049632766 8:143667611-143667633 TCATTCAGGCTGGAGAGCAGTGG - Intergenic
1049713311 8:144077347-144077369 GCAGAGTGGCTGTAGAGCAGAGG + Intergenic
1049887769 9:39646-39668 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1049928344 9:431546-431568 TCACCGTGGCTGGAGTGCAGTGG + Intronic
1050020683 9:1281648-1281670 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1050508902 9:6373942-6373964 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1050639405 9:7651205-7651227 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1051341597 9:16116858-16116880 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1051447948 9:17162152-17162174 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1051629013 9:19125881-19125903 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1052009229 9:23386324-23386346 TCACTCAGGCTGGAGAACAGTGG + Intergenic
1052133910 9:24887596-24887618 TCAGTGTGGCTAGTCGTCAGTGG - Intergenic
1052320683 9:27164357-27164379 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1052920766 9:33966008-33966030 TCAGTCAGGCTGGAGCGCAGTGG - Intronic
1053121890 9:35553698-35553720 GAAGTGTGGCTGGAGCACAGTGG + Intronic
1053228194 9:36380530-36380552 TCATTGAGGCTGGAGTGCAGTGG + Intronic
1053233403 9:36431093-36431115 TCAGTTTGGCTACAAATCAGAGG + Intronic
1053315227 9:37045372-37045394 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1053397830 9:37790469-37790491 GCTGTGTGGCAGGAGATAAGAGG - Intronic
1053504098 9:38626468-38626490 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1053661512 9:40285544-40285566 TCACTCAGGCTGGAGTTCAGTGG - Intronic
1053911887 9:42914887-42914909 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1054164081 9:61703269-61703291 TCAAAGTGGCTGGGGATCACGGG - Intergenic
1054373633 9:64431761-64431783 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1054523097 9:66090740-66090762 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1054767763 9:69056585-69056607 TCATCCTGGCTGGAGAACAGTGG - Intronic
1054780894 9:69165166-69165188 TCACTGAGGCTGGAGGGCAGTGG + Intronic
1054878862 9:70124125-70124147 TCAGGGAGGCTGGAGAACATGGG + Intronic
1055040502 9:71865819-71865841 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1055396250 9:75877968-75877990 TCAGTCAGGCTGGAGTGCAGTGG - Intergenic
1055405531 9:75969911-75969933 TCACTCAGGCTGGAGTTCAGTGG + Intronic
1055440681 9:76333136-76333158 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1055805456 9:80088031-80088053 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1056218657 9:84429686-84429708 TCACTGAGGCTGGAGGGCAGTGG + Intergenic
1056368648 9:85932215-85932237 TCAGTGGGGCTGGGGATGAGTGG - Intergenic
1056822396 9:89852834-89852856 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1056903223 9:90620697-90620719 TCAGAGAGGCTGGAGTGCAGTGG - Intronic
1056990279 9:91404341-91404363 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1057025520 9:91731873-91731895 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1057083989 9:92192049-92192071 TCACTCTGGCTGCAGCTCAGCGG + Intergenic
1057363693 9:94398851-94398873 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1057565851 9:96165772-96165794 TCAGTCAGGCTGGAGTGCAGTGG + Intergenic
1057601984 9:96466328-96466350 TCACTCGGGCTGGAGAGCAGTGG - Intronic
1057659642 9:96989236-96989258 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1058069905 9:100591386-100591408 TCAGTGTGGCTGAGGAACAAAGG + Intergenic
1058237393 9:102507486-102507508 TAAGTGTTGCTGGAGGTCTGAGG - Intergenic
1058300860 9:103370774-103370796 CCAGTGTGGCCAGAGAACAGAGG - Intergenic
1058547590 9:106077371-106077393 TCACTGAGGCTGGAGTACAGTGG - Intergenic
1058772935 9:108256259-108256281 TCACTGAGGCTGGAGTACAGTGG + Intergenic
1059078443 9:111220827-111220849 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1059222292 9:112635288-112635310 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1059589409 9:115641885-115641907 ACAGTGAGGTTGGAGATCATTGG - Intergenic
1059606195 9:115838992-115839014 TCATTGAGGCTGGAGTGCAGTGG - Intergenic
1059819449 9:117956068-117956090 TCAGTGGGGCAGGAGAATAGGGG + Intergenic
1060342835 9:122791999-122792021 TCACTCTGGCTGGAGTGCAGTGG - Intergenic
1060463667 9:123883001-123883023 TCATTGTGGCTGGAGTTCAGTGG - Intronic
1060929634 9:127480725-127480747 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1061041495 9:128143592-128143614 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1061185511 9:129050609-129050631 TCACTCTGGCTGGAGTGCAGTGG + Intronic
1061698500 9:132396705-132396727 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1061715917 9:132518809-132518831 GCAGTGTGGCCGGAGCTCAGAGG - Intronic
1061789491 9:133051617-133051639 TCAGTGTGGCCGGAGTGTAGAGG - Intronic
1061839119 9:133347622-133347644 CCAGTGCGGCTGGAGGGCAGAGG - Exonic
1062094116 9:134694326-134694348 CCAGTGTGGGTGGAGGGCAGAGG - Intronic
1062494692 9:136826224-136826246 TCTGTGTGGCTGGGGATCCCTGG - Intronic
1062577387 9:137215045-137215067 GCAGCGTGGCTGTAGCTCAGGGG - Intronic
1203426667 Un_GL000195v1:46912-46934 TCAGTGAGGCTGGAGTGCAGTGG + Intergenic
1203757120 Un_GL000218v1:142324-142346 TCAGTGTGGTTGGAGAAAACAGG - Intergenic
1203488664 Un_GL000224v1:82930-82952 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1203501285 Un_KI270741v1:24825-24847 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1203716505 Un_KI270742v1:154992-155014 TCAGTGTGGTTGGAGAAAACAGG - Intergenic
1203534709 Un_KI270743v1:23244-23266 TCAGTGTGGTTGGAGAAAACAGG + Intergenic
1203629315 Un_KI270750v1:56746-56768 TCATTCAGGCTGGAGAGCAGTGG + Intergenic
1203650734 Un_KI270751v1:118553-118575 TCAGTGTGGTTGGAGAAAACAGG - Intergenic
1185619079 X:1442465-1442487 TAAGTGTGGCTGGGGAGCCGGGG + Intronic
1185636289 X:1554384-1554406 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1185829644 X:3288193-3288215 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1185836524 X:3349505-3349527 TCACTGTGGCTGGAGTGCAGTGG - Intergenic
1185839751 X:3377449-3377471 TCACTTAGGCTGGAGTTCAGTGG - Intergenic
1185870564 X:3661554-3661576 TCACTGAGGCTGGAGTGCAGAGG - Intronic
1185891847 X:3828812-3828834 TCAGTGTGGAAGAAGATCAGAGG - Intronic
1185896954 X:3867226-3867248 TCAGTGTGGAAGAAGATCAGAGG - Intergenic
1185902072 X:3905652-3905674 TCAGTGTGGAAGAACATCAGAGG - Intergenic
1186060916 X:5706131-5706153 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1186674982 X:11806609-11806631 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1186737254 X:12478541-12478563 TCACTAAGGCTGGAGAGCAGTGG - Intronic
1187461417 X:19490707-19490729 TCACTTAGGCTGGAGAGCAGTGG - Intronic
1187523167 X:20031248-20031270 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1187577042 X:20568174-20568196 TCAGTGTTGATGGAGATAAATGG + Intergenic
1188064213 X:25637636-25637658 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1188946018 X:36303224-36303246 TCACTGAGGCTGGAGCGCAGTGG + Intronic
1189136429 X:38555560-38555582 GCAGTGGGGCTGGAGAGAAGGGG - Intronic
1189355201 X:40305083-40305105 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1189535704 X:41933412-41933434 TCACTCTGGCTGGAGTGCAGAGG - Intergenic
1189932975 X:46034189-46034211 TCAGTCAGGCTGGAGTGCAGTGG - Intergenic
1190051562 X:47154016-47154038 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1190241862 X:48662923-48662945 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1190523907 X:51309628-51309650 TCAGTCAGGCTGGAGTGCAGTGG + Intergenic
1190744020 X:53310342-53310364 TCAGCCAGGCTGGAGAACAGTGG - Intronic
1190890697 X:54564771-54564793 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1191839460 X:65501289-65501311 TCACCTGGGCTGGAGATCAGTGG + Intronic
1192005033 X:67201648-67201670 GCAGTGGGGCTGGAGTGCAGTGG - Intergenic
1192356757 X:70411249-70411271 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1192476652 X:71449810-71449832 TCACTGAGGCTGGAGTGCAGTGG + Intronic
1192698640 X:73445195-73445217 GCAGTGTGGGTGGAGATAAGTGG - Intergenic
1192729366 X:73786893-73786915 TCACTGAGGCTGGAGTGCAGTGG - Intergenic
1193387376 X:80887034-80887056 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1193572616 X:83162258-83162280 TCACCGAGGCTGGAGTTCAGTGG + Intergenic
1195050187 X:101089713-101089735 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1195371130 X:104174266-104174288 TCATTGAGGCTGGAGTACAGTGG - Intronic
1195635806 X:107114641-107114663 TAAGTGTTGTTGGAGTTCAGAGG - Intronic
1195698066 X:107681554-107681576 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1196207871 X:112961569-112961591 TCAGTGGGAATGGAGAACAGAGG + Intergenic
1196253376 X:113487424-113487446 TAAGTCTGGATGTAGATCAGTGG - Intergenic
1196280184 X:113814924-113814946 TCAGTCAGGCTGGAGTGCAGTGG - Intergenic
1196787374 X:119432746-119432768 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1196824683 X:119731850-119731872 TCTGTGTGTCTGGAATTCAGAGG + Intergenic
1196920410 X:120579496-120579518 ACAGTGTTGCTGGAGTGCAGTGG - Intergenic
1197427829 X:126320018-126320040 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1197568166 X:128114577-128114599 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1197628141 X:128826569-128826591 ACAGTGCGGATGGAGAACAGGGG - Intergenic
1197714823 X:129699104-129699126 TCAGTGTGGCCTGAGAGGAGAGG + Intergenic
1197743079 X:129910619-129910641 TCACTTAGGCTGGAGAGCAGTGG - Intronic
1197761910 X:130033940-130033962 TCACTGAGGCTGGAGTGCAGTGG - Intronic
1198424535 X:136503251-136503273 TCTGTGTGGATTGAAATCAGTGG + Intronic
1198575297 X:138004174-138004196 TCAGTGTGGCTGGAGCATAGAGG + Intergenic
1199464318 X:148118448-148118470 TCACTGAGGCTGGAGTACAGTGG - Intergenic
1200051262 X:153433095-153433117 CCTGTGTGGCTGGAGGCCAGTGG + Intergenic
1200163644 X:154021364-154021386 GCAGTGTGCCTGGAGAGCACTGG + Intergenic
1200185598 X:154181137-154181159 TCAGTCAGGCTGGAGTGCAGTGG - Intergenic
1200191249 X:154218273-154218295 TCAGTCAGGCTGGAGTGCAGTGG - Intergenic
1200197004 X:154256077-154256099 TCAGTCAGGCTGGAGTGCAGTGG - Intergenic
1200202657 X:154293197-154293219 TCAGTCAGGCTGGAGTGCAGTGG - Intronic
1200331959 X:155307409-155307431 TCAATGTGACTGGAATTCAGAGG + Intronic
1200868176 Y:8067773-8067795 TCACTCAGGCTGGAGAACAGTGG - Intergenic
1200977189 Y:9225982-9226004 TCACCCAGGCTGGAGATCAGTGG + Intergenic
1200977940 Y:9232474-9232496 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1201136154 Y:10991559-10991581 TCACTGAGGCTGGAGTGCAGTGG + Intergenic
1201170703 Y:11259944-11259966 TCAGTGTGGTTGGAGAAAACAGG - Intergenic
1201236073 Y:11913415-11913437 TCACTTAGGCTGGAGTTCAGTGG + Intergenic
1201248361 Y:12029772-12029794 TCAGTCAGGCTGGAGTGCAGTGG + Intergenic
1201266335 Y:12210750-12210772 TCAGTGGGACAGGAGCTCAGAGG - Intergenic
1201285052 Y:12371909-12371931 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1201316768 Y:12655126-12655148 TCACTCTGGCTGGAGTGCAGTGG + Intergenic
1201597746 Y:15691296-15691318 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1201757321 Y:17500438-17500460 TCACTCAGGCTGGAGTTCAGTGG - Intergenic
1201844233 Y:18405544-18405566 TCACTCAGGCTGGAGTTCAGTGG + Intergenic
1202018710 Y:20440622-20440644 TCAGGCTGGATGGAGAGCAGTGG - Intergenic