ID: 963093088

View in Genome Browser
Species Human (GRCh38)
Location 3:141504951-141504973
Sequence TCCTTCCCCAGATATCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 1, 2: 12, 3: 68, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963093084_963093088 23 Left 963093084 3:141504905-141504927 CCTGTCTCAGGGCCTTTGCACAT 0: 6
1: 56
2: 381
3: 977
4: 1829
Right 963093088 3:141504951-141504973 TCCTTCCCCAGATATCTGTATGG 0: 1
1: 1
2: 12
3: 68
4: 369
963093085_963093088 11 Left 963093085 3:141504917-141504939 CCTTTGCACATTTTATTCTTTCT 0: 1
1: 1
2: 16
3: 159
4: 1411
Right 963093088 3:141504951-141504973 TCCTTCCCCAGATATCTGTATGG 0: 1
1: 1
2: 12
3: 68
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963093088 Original CRISPR TCCTTCCCCAGATATCTGTA TGG Intronic
900282283 1:1878465-1878487 TCTTTTCCCAGATGTCTGTCTGG + Intronic
900776325 1:4588222-4588244 GCCTTCCCCATGTATCTGTAAGG - Intergenic
901144118 1:7053714-7053736 CCCTTCCCCAGGTATCTGCCTGG + Intronic
901727233 1:11251315-11251337 CTCTTCCCCAGATACCTGTAGGG + Intronic
902369692 1:15998107-15998129 TCCCTGCCCAGATATCTGCTTGG + Intergenic
902959933 1:19956121-19956143 TCTTCACCCAGATATCTGTGTGG + Intergenic
903047721 1:20576756-20576778 CCCTTCCCTAGATATCTGCTTGG + Intergenic
903853696 1:26322996-26323018 TCTTCCCTCAGATATCTGCATGG + Intronic
905463330 1:38135212-38135234 TCCTTCCCAAGACATCAGAAAGG - Intergenic
905521498 1:38603966-38603988 TCCTTCCACAGATGAGTGTAAGG - Intergenic
906610786 1:47200592-47200614 TCTGTCTCCAGATATCTGCAGGG + Intergenic
906611446 1:47206566-47206588 TCTTTCCCCAAATATCTGCATGG + Intergenic
907711788 1:56889944-56889966 ACCTTCCGCAGGTATCAGTACGG + Intronic
907755878 1:57310298-57310320 TCTTCCCCCAGATCTCTGCATGG - Intronic
907905477 1:58781112-58781134 TCCTCCCCCAGCTATCTATATGG - Exonic
908335979 1:63123700-63123722 TCTTTCCCCAAATTTCTGAATGG - Intergenic
908572725 1:65426171-65426193 TTTTTCCCTAGAGATCTGTATGG - Intronic
908623296 1:66009673-66009695 ACTTTCTCCAGATATCTGTATGG + Intronic
908730088 1:67217038-67217060 ACCTTCCCCAACTATCAGTATGG - Intronic
909469398 1:76009999-76010021 TCCTTCCTCAGATATTTTCATGG - Intergenic
910218394 1:84864984-84865006 CCCTTCCCCAGACACCAGTATGG + Intronic
910345578 1:86232630-86232652 TACTCCCCCAGATATCCATATGG + Intergenic
910934375 1:92475622-92475644 ACCTACCCCAGATATTTGTGTGG - Exonic
911005669 1:93219913-93219935 TCCTTCCCCATATATCTCTGAGG - Intronic
912635689 1:111290500-111290522 CCCTTCCCCATGTATCTGTAAGG + Intergenic
912775589 1:112504596-112504618 TACTTCCCCAGACACCTGCATGG + Intronic
912877802 1:113379911-113379933 TCTTCCCCCAGATATCTGCATGG - Intergenic
914783710 1:150809165-150809187 TCCTTCCCCACATCTGTTTATGG - Intergenic
915233751 1:154465366-154465388 TTCTTCCCCAGATAGCTGGCTGG + Exonic
915729089 1:158040273-158040295 TCTTTCCCCAGTTAGATGTATGG - Intronic
915806473 1:158858791-158858813 TGTTTCCCCAGTTATCTGTGAGG - Intergenic
916155328 1:161839748-161839770 TTCTTCCTCAGATATCCATATGG - Intronic
916463622 1:165050380-165050402 TCTTTCCCCAGACACCTGTCTGG - Intergenic
916679905 1:167094569-167094591 TCCTTCCACAGATGTCAGCAAGG - Intronic
919017483 1:192057935-192057957 TCCACCCCCAAATGTCTGTATGG - Intergenic
919663203 1:200268276-200268298 TTCTTCCCCAGACATCCATATGG + Intergenic
919870894 1:201820413-201820435 TCCTCCCCCAGAGATCTGGCTGG + Exonic
920080975 1:203372755-203372777 ATCTTCACCAGATATCTGTTAGG - Intergenic
920162706 1:204011555-204011577 TCTTTCCCCAGATATCCTCATGG - Intergenic
920168985 1:204058005-204058027 TACTACCACAGATATCTTTATGG + Intergenic
920295307 1:204952592-204952614 TCCTTCCCCAGAGCACTGTTAGG - Intronic
920307772 1:205030141-205030163 TCCTTCCCAAGTTTTCTGCAGGG + Intergenic
920721089 1:208387610-208387632 TCCTTCATTAGATATTTGTAAGG + Intergenic
923573326 1:235136150-235136172 TCCTTCCCCCCATATCTGACAGG + Intronic
923591159 1:235320814-235320836 TCCTCCCCCAGAAACCTGAATGG + Intronic
1065309070 10:24396637-24396659 TCTTCCCCCAGATATCTGCATGG - Intronic
1065314965 10:24454898-24454920 TCGCTCACCAGATATCTGCAGGG + Intronic
1065775413 10:29115245-29115267 TCTTTCCCCAGAAAGCTGCATGG - Intergenic
1066142041 10:32514484-32514506 TCCTTCCCCAGATATTTCAGAGG + Intronic
1067404152 10:46005297-46005319 TCCCTCCCCAGATATCATTTAGG - Intronic
1067468373 10:46518216-46518238 TCCTTCCCCAGACACCTGGGAGG - Intergenic
1068250657 10:54435504-54435526 TCTTTCCACAGATATTTGTTCGG - Intronic
1070069846 10:73077068-73077090 GCCTTCCCCAAATCACTGTAAGG - Intronic
1070565051 10:77597777-77597799 TCCTTCCCCAGAAAGCCATATGG + Intronic
1071930347 10:90462722-90462744 TATTTCCCCAGATATCTGCAAGG - Intergenic
1072891817 10:99330603-99330625 TCCTTCACCAGGTCACTGTAGGG - Exonic
1073451647 10:103613176-103613198 TCTTTGCCCAGGTATCTGTGGGG + Exonic
1074459903 10:113627217-113627239 TCCTTCACCACATAACTGAAGGG + Intronic
1074527349 10:114274026-114274048 GCCTTCCCCTGATATTTGGAAGG - Intronic
1074622659 10:115142279-115142301 TCTTCCCCTAGATATCTATATGG - Intronic
1074731755 10:116385504-116385526 TCCACCCCCTGATCTCTGTATGG + Intergenic
1075653375 10:124144969-124144991 CCCTTCCCCTGATTTCTGAAGGG - Intergenic
1076637500 10:131891883-131891905 TCCTTTCCCAGATAGCTGGAGGG - Intergenic
1078266938 11:9762082-9762104 TCTTCCCCCAGATATCTTCACGG - Intergenic
1078968136 11:16371262-16371284 TCTTCCCCCAGATATCTGCATGG + Intronic
1079153146 11:17919756-17919778 TGCTTCCCCAGATATCTGCATGG + Intronic
1079802766 11:24891743-24891765 TTCTTCCCCAGATAACTTTTTGG + Intronic
1080044434 11:27794349-27794371 TCTTTCACCAGGTATCTATATGG - Intergenic
1080547592 11:33336218-33336240 TCTTCCCCTAGATATCTGTATGG - Intronic
1080887672 11:36381629-36381651 TCATTCCCCAGATGTCTTTGAGG + Intronic
1081185533 11:40037931-40037953 TTCTTCCCCAGATAGCTACATGG - Intergenic
1081197348 11:40177561-40177583 TCTTCCCCCAGATAGCTATAGGG + Intronic
1082801997 11:57421538-57421560 GGCTTCCCCAGATATCTCTGTGG + Intronic
1082812645 11:57487828-57487850 TTCTTCTCCAGATATCTGCAAGG - Intronic
1083637908 11:64130152-64130174 TCCTTCCCCACAAATCTCTCAGG + Intronic
1085101724 11:73806371-73806393 TCTTTCCTCAGATATCCATATGG + Intronic
1085950058 11:81319530-81319552 CCCACCCCCAAATATCTGTATGG + Intergenic
1086086446 11:82959979-82960001 TTCTTCCACAGATTACTGTAAGG + Intronic
1086221607 11:84451899-84451921 TCTTTCCCCAGATATCTTCCTGG - Intronic
1086980751 11:93195770-93195792 TCGTTCCCCAGATATCCATTTGG + Intronic
1087430913 11:98053938-98053960 TGCTTCCCCAGATGTCAGAAAGG - Intergenic
1087517329 11:99180723-99180745 GCCTTCCCTATGTATCTGTAAGG - Intronic
1088169772 11:106982681-106982703 TCTTTCCCCAGATGTTTGCACGG - Intronic
1089658247 11:119968037-119968059 TTCTTCCCCAGATGTCTGCATGG - Intergenic
1089696986 11:120221996-120222018 TCCTTGCCCAGGAATCTGTTGGG - Intronic
1090027559 11:123180770-123180792 TCTTTCCCCAGATGGCTGCAAGG - Intronic
1091050411 11:132363366-132363388 TTCTTCCCCAGATATCCGCAAGG - Intergenic
1091638887 12:2219222-2219244 TCCTTCCCCAAATCCCTGCATGG - Intronic
1091679418 12:2516170-2516192 TCCTTTCCCAACTATCTGCATGG - Intronic
1091922184 12:4313973-4313995 TCTTTCCCAAGATATTTGCATGG - Intergenic
1092392009 12:8088875-8088897 TTTTCCCCCAGACATCTGTATGG + Intronic
1092860189 12:12713474-12713496 TCTTTCCCCAGATAGCTGTATGG + Intergenic
1093379213 12:18471171-18471193 TCCTTCCCCTGGCATCTTTATGG - Intronic
1093489510 12:19688816-19688838 TCATCCCCCAGATATCCATATGG + Intronic
1094185404 12:27636954-27636976 TCTTTCGCCAGATATTTGCATGG + Intronic
1094192584 12:27712140-27712162 TCTTTCCCCATATCTCTGCATGG - Intronic
1096319701 12:50600828-50600850 CTCTTCCCAAGATATCTGTAGGG + Intronic
1096595138 12:52690391-52690413 GCCCACACCAGATATCTGTAAGG - Exonic
1097067280 12:56330038-56330060 TCCTTCCCCAGATATCTACATGG + Intronic
1097680712 12:62646598-62646620 AGCTACCCCAGATATCTCTATGG - Exonic
1097813574 12:64046063-64046085 TCCTTCCCCAGATAGCTGCATGG - Intronic
1098312481 12:69161410-69161432 TTCTTCCCCAAATGTCTGTGTGG + Intergenic
1098650679 12:72963427-72963449 TCCTTTCCCATATATCAGGATGG + Intergenic
1099605552 12:84797588-84797610 TCCTTCCCAGGATATATCTAGGG - Intergenic
1099920813 12:88954903-88954925 ACCTTCCTCATAAATCTGTATGG - Intergenic
1099945081 12:89234848-89234870 TCTTCCCCCAGATATCTGCCTGG + Intergenic
1100042194 12:90333502-90333524 TCCTTTTGCAGATACCTGTAAGG - Intergenic
1100313002 12:93414662-93414684 TCCTCCCCAAGATATCCATATGG + Intronic
1100657241 12:96660160-96660182 TCTTTCCCTAGATCACTGTATGG - Intronic
1101180571 12:102212420-102212442 TCTTTCCTCAGATATCTGCCTGG + Intergenic
1101748439 12:107562409-107562431 TCTTTCCTCAGATATCCATATGG - Intronic
1102557347 12:113735933-113735955 TCCCACCCCAGACATCTGCATGG - Intergenic
1102698045 12:114815354-114815376 TACCTCCCCAGATATCTACATGG - Intergenic
1103122812 12:118395109-118395131 TCCCTCTCCAGATATTTGTGTGG - Intronic
1103294722 12:119876705-119876727 TCTTTCCCCAGATATCAACATGG - Intronic
1103968278 12:124653646-124653668 TCCTTCCCTACATCTCTGTGAGG + Intergenic
1106309593 13:28542716-28542738 GCCTTCCAGACATATCTGTAGGG + Intergenic
1106330088 13:28732183-28732205 TGCTTTCCCAGCTATCTGGATGG - Intergenic
1107462287 13:40615703-40615725 CTCTTCCCCAGATGTCTGTCTGG - Intronic
1107859832 13:44650248-44650270 TCCTTTCACAGATATCTGATTGG + Intergenic
1108333986 13:49420104-49420126 TCCTTTCACAGATATCTAAATGG - Intronic
1109833114 13:67819610-67819632 TCCTTTAACAGATATATGTATGG - Intergenic
1111139077 13:84090793-84090815 TCCATTCCCACATAGCTGTAAGG + Intergenic
1112639644 13:101258405-101258427 TCCTTGCCCAGCGATCTGCACGG + Intronic
1112953089 13:105026620-105026642 TCCCTTCCCACATATTTGTATGG - Intergenic
1114151641 14:20047022-20047044 CCCTTCCCCAGCTATCTTGAAGG + Intergenic
1114159296 14:20145074-20145096 TCTGTCCCCAGATATTTGCATGG - Intergenic
1114254263 14:20988492-20988514 CCATTCCTCAGATATCTCTAGGG + Intergenic
1116023742 14:39491476-39491498 TCCTTCTCAAGATTTCTGCACGG + Intergenic
1116390793 14:44386574-44386596 TCCTTGCCCAGATATTTCAAAGG + Intergenic
1117063519 14:51986343-51986365 TCTTTCCCCAGATATTTGTGTGG + Intergenic
1117201043 14:53390422-53390444 TCTTTCCTAAGATATTTGTATGG + Intergenic
1118514220 14:66508584-66508606 TCCTCCCCCGGTTACCTGTAAGG - Exonic
1120316101 14:82895414-82895436 TGCTTCCCCAGATGTCTATAAGG - Intergenic
1121063016 14:90933917-90933939 TCCTTCCTGAGATATCTACATGG + Intronic
1121087249 14:91155983-91156005 TCCTTCCACAGATGTCTATGTGG + Intronic
1121661035 14:95635300-95635322 TGCCTCCCCAGATATCTGCCTGG + Intergenic
1123501187 15:20882603-20882625 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1123558439 15:21456308-21456330 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1123594670 15:21893583-21893605 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1124440637 15:29683574-29683596 TACTTACCCATATATATGTATGG + Intergenic
1125260575 15:37820141-37820163 TGCTTCCCAAGACTTCTGTATGG - Intergenic
1126298972 15:47174219-47174241 TCCTTCCCCAGCTATATGCATGG - Intergenic
1127563065 15:60159665-60159687 TCCTCTCCCAGATATCTGTGTGG - Intergenic
1128427677 15:67558772-67558794 TCTTTCCCCAGATATCAGCAAGG + Intronic
1130024504 15:80259924-80259946 TCTTTCTCCAGAGATCTGCAAGG + Intergenic
1130688164 15:86057209-86057231 TCTTTCCCCAGATGTCAGTAAGG + Intergenic
1131290813 15:91105357-91105379 TCTTTCCCCAGATAACTGTCTGG - Intronic
1131910572 15:97195755-97195777 TCCTTTCCAAGAATTCTGTATGG + Intergenic
1202966789 15_KI270727v1_random:183458-183480 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1133403366 16:5504719-5504741 TCCTTCCCCACAGAGCTGCAGGG - Intergenic
1133842021 16:9418521-9418543 TTCTTTCCCAGATATCTGCATGG + Intergenic
1134074253 16:11279577-11279599 TCCTTCCCCAGATCTCACTGGGG + Intronic
1136007467 16:27340862-27340884 GCCTTCCCCAGACATCTGCACGG - Intronic
1136043103 16:27595869-27595891 TCCTTTCCCAGAGATCTGCGTGG - Intronic
1136182355 16:28562420-28562442 TCCTTTCCCTGATGGCTGTATGG + Intronic
1137859499 16:51831904-51831926 TCCTTCAACAGATATTTGTGGGG - Intergenic
1137869299 16:51934102-51934124 TCTGTCCCCAGATATCTTTATGG - Intergenic
1138873210 16:60917887-60917909 CTCCTCTCCAGATATCTGTAAGG + Intergenic
1139838039 16:69855662-69855684 TCTTTCCCCAGATATCCTCATGG - Intronic
1141155034 16:81591454-81591476 TCCTCCCCCAGATGCCAGTATGG - Intronic
1141255861 16:82401904-82401926 TCCTCCCCCAGATATCTGCAGGG - Intergenic
1141325280 16:83051304-83051326 TCCTTCCACATCTATCTCTAAGG + Intronic
1141433093 16:83981019-83981041 TCCTTCCCCAGATTACTTTGTGG + Exonic
1141882200 16:86867523-86867545 CTCTTCCCCTGATATCTCTATGG + Intergenic
1141969463 16:87471034-87471056 TCCTTCCACACATATCTCGAGGG + Intronic
1143364813 17:6399900-6399922 TGCTTCCCCAGGTATCTGCATGG - Intronic
1143896080 17:10137245-10137267 TTCTTCCCCAGATTTCCATATGG + Intronic
1145266404 17:21381578-21381600 TTCTTTCCCAGATCTCTGCACGG + Intronic
1145841478 17:27998918-27998940 TCTTCCTCCAGATATCTGCATGG - Intergenic
1146173808 17:30652046-30652068 TCCTCCCCCAGATATCCACATGG + Intergenic
1146184092 17:30713682-30713704 CCCTTCCCCAGATATTTGCGAGG + Intergenic
1146328819 17:31910490-31910512 CTCTTCCCCAGATAAATGTATGG + Intergenic
1146347264 17:32068067-32068089 TCCTCCCCCAGATATCCACATGG + Intergenic
1146543926 17:33721775-33721797 TCCTAACCCAGATATCTGGATGG - Intronic
1146805467 17:35861650-35861672 TCTTCTCTCAGATATCTGTAAGG + Intronic
1146903941 17:36606153-36606175 TCTTGCCCCAGATGTCTGCACGG + Intronic
1147570526 17:41567792-41567814 TCCATCCTCATATATGTGTATGG - Intronic
1147697586 17:42367567-42367589 TCTTTCCCTAGATATCTCCATGG + Intronic
1148494011 17:48041531-48041553 TGCTTCCTCAGATGTCTGCATGG - Intergenic
1148999317 17:51740792-51740814 TCCTTCCCCAGACATCTCCCTGG + Intronic
1149348098 17:55758928-55758950 TCTTTCACCAGATTGCTGTATGG + Intronic
1150227515 17:63531914-63531936 TCTTTCCCCTGAGATCTGTCAGG - Intronic
1151519791 17:74619739-74619761 TCCTTCCCCAGGTCTCTATTGGG + Intronic
1151621468 17:75248055-75248077 TCCCTCCCCAGATCTCTATGAGG + Intronic
1153306458 18:3636081-3636103 TCTTTTCTCAGATATGTGTATGG + Intronic
1154246738 18:12705738-12705760 TTCTTTCCCAGATCTCTGTACGG + Intronic
1155910026 18:31496408-31496430 GCCTTCCCCATGTATCTGTAGGG + Intergenic
1156705883 18:39881617-39881639 TCCTTTACCAGATATGTGTTTGG - Intergenic
1157336046 18:46738324-46738346 ACCTTCCTCAGATATCTCTCAGG - Intronic
1158422586 18:57309049-57309071 TCTTCACCCAGATATCCGTATGG - Intergenic
1158604876 18:58887014-58887036 TCCTTTACCAGATACCTGCAGGG + Intronic
1159201202 18:65187087-65187109 TACTTCCTCAAATATCTGTGGGG + Intergenic
1159556887 18:69955237-69955259 TGCTTCCCCAGATGTCTCTATGG + Intronic
1159693397 18:71521512-71521534 TTCTTCCCCATATTTCTTTATGG + Intergenic
1161313373 19:3606983-3607005 GCCTTCCCCAGAAGGCTGTAGGG - Intergenic
1161414724 19:4139593-4139615 ACCTTTCCCTGATATCTGTGGGG - Intergenic
1161457551 19:4377092-4377114 TCCCTCCCCAGAGAGCTGCAAGG + Intronic
1162309152 19:9894917-9894939 CCCTGCCCCAGATATCTCTAAGG + Intronic
1162576668 19:11503323-11503345 CTCTTCCCCAGAGATCTGCATGG + Intronic
1162850975 19:13430908-13430930 TCTTCCCCCAGATATCTGCTTGG - Intronic
1163888629 19:19991437-19991459 GCCTTCCCCTTGTATCTGTAAGG - Intergenic
1163897620 19:20073437-20073459 GCCTTCCCTATGTATCTGTAAGG - Intergenic
1164393910 19:27847511-27847533 GCCTTCCCCATGTATCTGTAAGG - Intergenic
1166979806 19:46625659-46625681 TCCTTCCTCAGCTTTCTGGAAGG - Intergenic
1167201354 19:48067673-48067695 TCCTTCCCCAGAGCTTTGGAGGG - Intronic
1167704360 19:51070205-51070227 TCTTCCCCCAGATGTCTGCATGG + Intergenic
1168367062 19:55797339-55797361 TCTTTCCCCAGATAGCTGCATGG + Intronic
925250679 2:2434588-2434610 TGCTTCCTCTGAAATCTGTAGGG + Intergenic
928983047 2:37156128-37156150 TTCTTCCCCAGATAACTGCATGG - Intronic
930039862 2:47113389-47113411 TCTTTGCCCAGTTATCTGTTGGG - Intronic
930989782 2:57639334-57639356 TTTTTCTCCAGAGATCTGTAGGG - Intergenic
932089344 2:68791037-68791059 TCTTTCCCCAGGTAGCTGCATGG + Intronic
933125924 2:78605700-78605722 TCTTTCCACAGCTATCTGGAAGG + Intergenic
935186393 2:100737439-100737461 TCCTTCCCCCAATTTCTGAAAGG - Intergenic
936400928 2:112163946-112163968 GCCCTCCCCAGACATCTGTCTGG + Intronic
936712225 2:115144354-115144376 TCCTTCCCCATGTACCTGTTAGG + Intronic
937486218 2:122317604-122317626 TCTTTCCTCAGATATCTGTGTGG - Intergenic
938777779 2:134557064-134557086 TCCTTCCCCAGGTAACAGCATGG - Intronic
939232466 2:139447541-139447563 TTCTTTCCCATGTATCTGTATGG + Intergenic
939574842 2:143883433-143883455 GCTTTCCCCAGATCTCTGTATGG + Intergenic
940659305 2:156527026-156527048 TCTTTGCCCAGATACCTGTTTGG + Intronic
942486007 2:176440571-176440593 TGCTTCCCCTGAAACCTGTATGG + Intergenic
942488771 2:176468529-176468551 TCCTTCACAAGATTGCTGTAAGG - Intergenic
943703371 2:191011008-191011030 TCCTTCCCCAGAGGTCTGGCAGG - Intronic
944019744 2:195087808-195087830 TTCTTTCCCATATATATGTATGG - Intergenic
945766426 2:213984869-213984891 CCCTTCCACAGATATCTACATGG + Intronic
946981190 2:225217682-225217704 TTCCTCCCCAGATATTTGTAAGG + Intergenic
947221789 2:227800757-227800779 TCTTTCTCCAGATGTCTGCACGG + Intergenic
1169018642 20:2311902-2311924 TCTTTCCCAAGATCTCTGTCTGG - Intronic
1169415744 20:5414830-5414852 TCCCACCCCTGATATTTGTAGGG + Intergenic
1171951056 20:31422942-31422964 TTCTTCCCAACATATCTGTACGG + Intergenic
1172026005 20:31949195-31949217 TCTTTCCCCAGATGTCTGCAGGG - Intronic
1172121699 20:32602534-32602556 CCCTTCCTCAGATGTCTGCAGGG + Intronic
1172973334 20:38888978-38889000 TCCTTCCCCAGGGCTCAGTAGGG + Intronic
1173148610 20:40546744-40546766 TACTTCCCCAGATATCTGTTTGG - Intergenic
1173385593 20:42584435-42584457 TCCTCCCCCAGATGTCAGCACGG + Intronic
1173512810 20:43643637-43643659 TCCTCCCCCAGATATCTGCATGG - Intronic
1173834028 20:46113451-46113473 TCCTCCCCAAGATTGCTGTATGG - Intergenic
1174043261 20:47714861-47714883 ACCTTCCTCAGATACCTGCATGG + Intronic
1174044995 20:47727136-47727158 TCCTTGCCCAGGTACCTGTGAGG + Intronic
1174117622 20:48238037-48238059 CTCTTCCCCAGATATCTGCCTGG + Intergenic
1174163890 20:48571110-48571132 CTCTTCCCCAGATATCTGCCTGG - Intergenic
1174165973 20:48583876-48583898 TCTTCCCCCAGACATCTGCACGG - Intergenic
1174193478 20:48756723-48756745 TCTTTCTCCAGATATCTGCAGGG + Intronic
1174515825 20:51091757-51091779 TCCCTCCCCACCTACCTGTAGGG - Intergenic
1175166487 20:57047992-57048014 CCCTTCCCCAGATACCTGCCTGG - Intergenic
1175202919 20:57290382-57290404 TCCTCCCCCAGAGGTCTGGAGGG - Intergenic
1175682505 20:61000515-61000537 TCATTCCCAGGATATTTGTATGG + Intergenic
1176347598 21:5764412-5764434 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
1176354412 21:5884996-5885018 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
1176497229 21:7560043-7560065 GCTTTCCCCAAGTATCTGTAAGG - Intergenic
1176541919 21:8162482-8162504 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
1176560870 21:8345527-8345549 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
1177046007 21:16171236-16171258 TCCTTTCACAGATTTCTCTATGG + Intergenic
1179507005 21:41847847-41847869 TCCCTCCCCAGATTCCTGTGTGG - Intronic
1180284577 22:10731894-10731916 TCCTTCCTCAGATATCCAAATGG + Intergenic
1182754321 22:32666531-32666553 TCTTTCCCCAGGAATCTGGAAGG + Intronic
1183517428 22:38274924-38274946 TGTTTCCCCAGATACCTGAATGG + Intergenic
1183602282 22:38846891-38846913 TCTTTCCCCAGACTTCTGCATGG - Intergenic
1183950104 22:41347980-41348002 TCCTTCCCCAGCTAGCTGTGTGG + Intronic
1183980536 22:41537243-41537265 TCCTTCATCAAATATCTGTGAGG - Intronic
1184581394 22:45420277-45420299 TCTTTCCCCAGATATCTGTAGGG + Intronic
1203246861 22_KI270733v1_random:78901-78923 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
949500689 3:4677490-4677512 CCTTTCCCAAGATATCTGTGTGG - Intronic
950714519 3:14838198-14838220 TCCTTCCCCTGTTTTCTGCATGG + Intronic
952035872 3:29200245-29200267 TTCTTCCCCAGATAACTTTTTGG - Intergenic
955138328 3:56243205-56243227 TCATTTCCCAGACATCTGTTGGG + Intronic
955469891 3:59275331-59275353 TCTTTTCCCTGATATCTGAAGGG + Intergenic
955749741 3:62175828-62175850 TTCTTCTCCAGATCTCTGTGGGG - Intronic
955786723 3:62548762-62548784 TCTTTCCTCAAATATCTGTGGGG + Intronic
957468151 3:80622160-80622182 TTCTTAGGCAGATATCTGTAGGG - Intergenic
959408316 3:105989140-105989162 TATTTTCCCAGATATCTTTATGG + Intergenic
959842254 3:110991101-110991123 TCTTTTCCCAGTTATCTGCATGG - Intergenic
961102882 3:124216634-124216656 TCCTTCTCCAGAATTCTGGAGGG - Intronic
962230347 3:133660141-133660163 TTCTTCTCCAGATATCTGCAAGG + Intronic
962293813 3:134161957-134161979 TGCTTCCCCGGAAACCTGTAGGG + Intronic
963093088 3:141504951-141504973 TCCTTCCCCAGATATCTGTATGG + Intronic
964149149 3:153503110-153503132 TCCTTCTACAAATATCTGCATGG - Intergenic
964612596 3:158630202-158630224 CTCTTCCCCAGATATCAGCATGG - Intergenic
966173796 3:177113294-177113316 TCCTTGCCCAGATTGCTGTCAGG - Intronic
966526322 3:180923332-180923354 CCCTTCTCGAGATCTCTGTATGG - Intronic
967123297 3:186402801-186402823 TCTCTCCCCAGATATCTCTCAGG - Intergenic
968417726 4:454637-454659 GCCTTCCCCATGTATCTGTAAGG + Intronic
968862510 4:3184204-3184226 TCCTTCCCCAGGTATCTCCTAGG - Intronic
969136630 4:5034455-5034477 TCCTTCATCAAATATTTGTAGGG - Intergenic
969194057 4:5546894-5546916 TCCTTCCCCACCAATCTGGAAGG - Intronic
969245393 4:5928817-5928839 TCTTTCACCAAATATCTCTAAGG - Intronic
970377423 4:15473425-15473447 TTTTTCCCAAGATATCTGCATGG - Intronic
971531289 4:27692600-27692622 TCATCCCCAAGATCTCTGTATGG + Intergenic
973007244 4:45028367-45028389 TCCTCCCCAAGATATTTGCATGG - Intergenic
974729821 4:65847696-65847718 TCTTTCTCCATATATATGTAAGG + Intergenic
975135602 4:70871192-70871214 TCTTCTCCCAGATATCTGCAAGG - Intergenic
975359300 4:73448747-73448769 TCTTCCCCCAGATATTTGCATGG + Intronic
975587597 4:75965945-75965967 TCAATCCCCAGATATCTGCTTGG + Intronic
975620815 4:76294794-76294816 TCCTTCCACAGATATCAGACAGG - Intronic
975919638 4:79369810-79369832 TCTTTCCCCAGATGGCTATAGGG - Intergenic
976100964 4:81562919-81562941 TCTTTCTCAAGATATCTGTGAGG + Intronic
977419995 4:96787364-96787386 TCTTTCTCCAGATAGATGTATGG - Intergenic
978292734 4:107164505-107164527 TCCTTCCCCATCTATCTTTTTGG - Intronic
978364794 4:107970122-107970144 TCCTTTCCTAGATATCTACAGGG - Intergenic
978399686 4:108317278-108317300 TCTTTCCCAAGATATCTTCAAGG - Intergenic
978875616 4:113637026-113637048 TCCTCCCTCAGGTATCTGCAAGG + Intronic
979433387 4:120659788-120659810 TGCTTGCCCAGATCTCTGTGGGG + Intergenic
980606490 4:135098285-135098307 ACCTTCCCCAGAGATGTGGACGG + Intergenic
982850219 4:160305481-160305503 ACTTTCCACAGATATCTGTGTGG + Intergenic
982929842 4:161390897-161390919 TCCTTTCCCAGCTGTTTGTATGG - Intronic
983181660 4:164655936-164655958 TCCTTCCCAGGATGTATGTAGGG - Intergenic
983365750 4:166786189-166786211 TCTTCCCCCAGGTATCTGTATGG - Intronic
983525381 4:168755362-168755384 TCTTCCCCCAGATTTCTGCATGG - Intronic
984016064 4:174428473-174428495 TCTTTTCCCAGATATGTGTATGG - Intergenic
984073769 4:175149966-175149988 TCCATCCCCAGCCATCTGAATGG + Intergenic
984490979 4:180433969-180433991 TTCTTCCCCAGATATCCCTTTGG + Intergenic
985090671 4:186359671-186359693 GTCTTCCCCATGTATCTGTAAGG - Intergenic
986688407 5:10294026-10294048 TCTTCCTCCAGATATCTGCAGGG - Intronic
986964387 5:13252996-13253018 TCCTTCTCCAGATACATGTGGGG - Intergenic
987095476 5:14545715-14545737 TCCTTCCCCTTCTATCTGTTGGG - Intergenic
987405424 5:17519276-17519298 CCCTTCCCAGGAGATCTGTATGG + Intergenic
987405869 5:17522710-17522732 CCCTTCCCAGGAGATCTGTATGG + Intergenic
987406317 5:17526144-17526166 CCCTTCCCAGGAGATCTGTATGG + Intergenic
987406765 5:17529578-17529600 CCCTTCCCAGGAGATCTGTATGG + Intergenic
987407380 5:17584827-17584849 CCCTTCCCAGGAGATCTGTATGG - Intergenic
987408082 5:17590029-17590051 CCCTTCCCAGGAGATCTGTATGG - Intergenic
987408527 5:17593463-17593485 CCCTTCCCAGGAGATCTGTATGG - Intergenic
987408982 5:17596897-17596919 CCCTTCCCAGGAGATCTGTATGG - Intergenic
987444602 5:18002189-18002211 TCTTCCCCCAAATATCTGTAAGG - Intergenic
988057006 5:26110518-26110540 TCCTTCTCCATAAATCTGTGTGG - Intergenic
989512324 5:42302471-42302493 TCCTTTCCCTGACATCTGTTAGG - Intergenic
989637400 5:43550923-43550945 TCTTTCCTTAGATATTTGTATGG - Intronic
989702666 5:44289025-44289047 TCTTCCCCAGGATATCTGTATGG - Intergenic
992062976 5:73075334-73075356 ACTTTCCTCAGATATCTGCATGG - Intronic
992352830 5:75948670-75948692 CCCTTCTCCAGATATTTGCATGG - Intergenic
993604719 5:89974849-89974871 TACTTCCTCAAATCTCTGTATGG + Intergenic
994041047 5:95260118-95260140 GCCTTCCCCATGTATCTGTAAGG + Intronic
994070704 5:95598870-95598892 CCTTTCCCCAGATAACTGTAGGG + Intronic
995345852 5:111116418-111116440 ACCTTCCACAGAAATCTTTAAGG - Intronic
995551583 5:113287066-113287088 TCCTCCCCCATATATCTGCCCGG - Intronic
995787430 5:115844487-115844509 TCTTCCCCCAGATATCTGCAAGG - Intronic
997281624 5:132651854-132651876 TCTTCCCCCAAATATCTGCATGG + Intergenic
997349273 5:133218670-133218692 TTCTTCCCCAGATATCTACAGGG + Intronic
997458798 5:134038279-134038301 TCTTTCCCCAGATATTTATGTGG - Intergenic
997702964 5:135917780-135917802 TCTTTCCACAGTTATCTGTGAGG - Intergenic
998514187 5:142737827-142737849 TTCCTGCCCAGATATCTGCATGG - Intergenic
998657180 5:144194426-144194448 TCCTTCCCTTCACATCTGTAAGG + Intronic
998881937 5:146653795-146653817 TCCATCCCCAGATACCTACACGG - Intronic
999067910 5:148711310-148711332 TCTTCTCCCAGATATCTATAAGG - Intergenic
999535169 5:152508443-152508465 TTCTTTACCAGATATCTGCATGG + Intergenic
1000002377 5:157151315-157151337 GACTTTCCCAGATAACTGTAGGG - Intronic
1000004557 5:157170935-157170957 TCTTTCCCCAGACATCTTCATGG - Intronic
1001034054 5:168284323-168284345 TTCCTACCTAGATATCTGTAGGG + Intergenic
1003729107 6:8800802-8800824 TCCTTCCTGAGAATTCTGTAGGG + Intergenic
1004061081 6:12198751-12198773 TCTTTCCCCGGAGATCTGCATGG - Intergenic
1004735912 6:18406340-18406362 TCTTCTCCCAGATATCTGTATGG - Intronic
1004903877 6:20218461-20218483 ACCTTCCCCAGATTACTGTTCGG + Intergenic
1006166004 6:32065344-32065366 TCTTTCCCCAGATATCTTCATGG + Intronic
1006797367 6:36740360-36740382 CCCTTCCCCAGATATCAGCGTGG + Intergenic
1007511839 6:42380086-42380108 TCTTCCCCCAGGTATCTGCATGG - Intronic
1007648954 6:43405155-43405177 CACATCCCCAGATATCTGCATGG - Intergenic
1009456733 6:63865669-63865691 TTTTTCCCCAGCTATCTGTATGG + Intronic
1009980802 6:70723446-70723468 TCTTTCCCCAGATAGCTGCATGG + Intronic
1011710088 6:90044293-90044315 TCTTTTCCCAGATATCTGCATGG - Intronic
1012914740 6:105157273-105157295 TCTTCCCTCAGATATCTGCATGG + Intergenic
1013254098 6:108366944-108366966 TGTTTCTCCAGATATCTGCATGG + Intronic
1013460656 6:110372079-110372101 TCCTTCCCCAGATATTCACATGG + Intergenic
1015144477 6:129970410-129970432 CCCTCCCCCAGACATCTGCATGG - Intergenic
1015686886 6:135874146-135874168 TCTTTCCCCAGGTATCTGCATGG - Intronic
1016304851 6:142673127-142673149 TCTTTCCCTAGATATCTTAAGGG + Intergenic
1016342732 6:143080863-143080885 TCCTTCCCAGGATGTGTGTAGGG + Intronic
1017289205 6:152715735-152715757 TATTTCCTCAGCTATCTGTATGG - Intronic
1017871697 6:158492183-158492205 TCCTTTGTCAGATATCTGTATGG + Intronic
1018229398 6:161661402-161661424 TCCCCTCCCAGATATCTGTGTGG + Intronic
1018539106 6:164857946-164857968 TCCTTCCAGAGATATCTAGAAGG - Intergenic
1019813159 7:3179796-3179818 TCCGTCCCCAGATCCCTGCATGG + Intergenic
1020435621 7:8159301-8159323 TCCATCCCCAAATTCCTGTATGG - Intronic
1020903743 7:14038956-14038978 TGCTTCCTCTGAAATCTGTAGGG - Intergenic
1022799227 7:33759784-33759806 TCCTTCCCCAGAGCTGTGTCTGG + Intergenic
1023374436 7:39541859-39541881 TCTTTCTCCAAATATCTCTATGG + Intergenic
1023498425 7:40822782-40822804 TCCTTCCCCATATCTCTTTCAGG - Intronic
1024300178 7:47881429-47881451 TCCTCCCCAAGAGGTCTGTAAGG + Intronic
1024968705 7:55049481-55049503 TCCTTCTCCAGAGATGTTTAAGG - Intronic
1027776668 7:82473632-82473654 TCTTCCCCCAGATTGCTGTATGG - Intergenic
1028239307 7:88399693-88399715 TCAAACCCCAGATATCTGTGCGG + Intergenic
1030185588 7:106758650-106758672 TCTTCCTCCAGATATCTGTGTGG + Intergenic
1030206933 7:106960159-106960181 CCTTTCCCCAGTTACCTGTAAGG + Intergenic
1030366620 7:108654122-108654144 TCCTTCCTCAGATATCTATATGG - Intergenic
1030554668 7:111008397-111008419 TCTTCCCCCAGATATCTTCATGG + Intronic
1031091452 7:117360158-117360180 TTTACCCCCAGATATCTGTATGG + Intergenic
1031126699 7:117781756-117781778 TCCATCCCCAGATTTCTCCAGGG + Intronic
1031575364 7:123409644-123409666 TCCACCCCCAGGTATCTGTCTGG + Intergenic
1032098618 7:128954075-128954097 TCCATCCCCAGATGTCTATCAGG + Intergenic
1032331765 7:130987127-130987149 TCCTTCCGGAGATGTCTGCATGG - Intergenic
1032663496 7:134011933-134011955 TCTTTCCCTAGATAGCTGCATGG - Intronic
1033151703 7:138920216-138920238 CCCTTCCCCAGCTCTCTATATGG + Intronic
1033655601 7:143371771-143371793 TTCTTCCACAGACATCTGTATGG - Intergenic
1034075254 7:148225374-148225396 TCATTCCCCAGGTCTCTGCATGG - Intronic
1034610394 7:152362229-152362251 TTTTCTCCCAGATATCTGTATGG - Intronic
1034891138 7:154840213-154840235 TCCATTCTCAGCTATCTGTAAGG - Intronic
1037267999 8:17089008-17089030 TCCTTCTCCATATATTTGAAAGG - Intronic
1037357307 8:18035008-18035030 TCTTTCCTCAGATATTTTTATGG + Intergenic
1037679072 8:21078500-21078522 TCTTTCCCTAGATATCTGCTTGG - Intergenic
1037812416 8:22094936-22094958 TCCTACCCCAGATCTCTACAAGG - Intronic
1038080265 8:24126831-24126853 TCCTTGCCAAGAGATATGTAAGG - Intergenic
1038712772 8:29963261-29963283 TCATCCCCCTGGTATCTGTAGGG - Intergenic
1039144275 8:34428205-34428227 CATTTCCCCAGATATCTGTTTGG + Intergenic
1039399543 8:37257597-37257619 TTCTTCCCCAGACATCTGAGTGG + Intergenic
1042156177 8:65846412-65846434 TTCTTCCACAGATATCTGATAGG + Intergenic
1044778907 8:95723388-95723410 CTCTTCCCCAGATATCTGCATGG - Intergenic
1044789224 8:95829640-95829662 TCTTACCCCAGATCTTTGTATGG - Intergenic
1046941143 8:119932841-119932863 TCTTCCACCAGATATCTGCAAGG - Intronic
1047817633 8:128482240-128482262 GCCTACCCCCAATATCTGTAGGG + Intergenic
1049435247 8:142583472-142583494 TCCTTCCCCAGACCTCCGGAGGG + Intergenic
1051451915 9:17206595-17206617 GCCTTCCCCATGTATCTGTAAGG + Intronic
1053305400 9:36981088-36981110 TCCTCCCCCAGATATCTGCCTGG + Intronic
1053588715 9:39487961-39487983 TCCATCTCCAGATGCCTGTAAGG + Intergenic
1053650664 9:40165536-40165558 TCCTTCCCCAGATATTTGCATGG + Intergenic
1053755075 9:41298388-41298410 TCCTTCCCCAGATATTTGCATGG - Intergenic
1054533919 9:66210666-66210688 TCCTTCCCCAGATATTTGCATGG - Intergenic
1054577590 9:66877333-66877355 TCCATCTCCAGATGCCTGTAAGG - Intronic
1054912215 9:70465155-70465177 TTCTTTCCCAGAGATCTGGATGG + Intergenic
1055593565 9:77843241-77843263 TCTTCCCCCAGATATCCGCATGG - Intronic
1056904694 9:90635233-90635255 TCTGTCCCCAGATACCTGCATGG - Intronic
1057598270 9:96435279-96435301 TCCTTCCCCATATAGTTTTAGGG + Intergenic
1058767285 9:108194164-108194186 TCCTTCCACAGATCTTTGCATGG + Intergenic
1060313851 9:122489811-122489833 GCCTTCCCCATGTATCTGTAAGG - Intergenic
1061940647 9:133882081-133882103 GCCATCCCCAGATAGCTGTGTGG + Intronic
1062286502 9:135775299-135775321 TCCTGCCCCAGGTATGTGAAGGG + Exonic
1202798547 9_KI270719v1_random:150227-150249 TCCTCCCCCAGATATTTGCATGG + Intergenic
1203463194 Un_GL000220v1:61963-61985 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
1186133713 X:6496604-6496626 CCATTTCCCAGATATCTGCATGG + Intergenic
1189046608 X:37599400-37599422 CCCTACCCCAGATCTATGTAAGG - Intronic
1189608227 X:42703082-42703104 TATTTCCCTAAATATCTGTATGG - Intergenic
1189941885 X:46132922-46132944 TCTTCCCCCAGATAACTGAATGG - Intergenic
1190264158 X:48817564-48817586 TCCTTCCCCAGAAAGAAGTAAGG + Intronic
1190328603 X:49222059-49222081 TCTTCCCCCAGATATTTGCATGG + Intronic
1191141054 X:57117287-57117309 TCCTTCCCCAGACAGCTACAGGG + Intergenic
1191142654 X:57133003-57133025 TCCTTCCCCAGACAGCTACAGGG + Intergenic
1191953895 X:66623754-66623776 TTCTTCCCCAGATACCTGCATGG + Intronic
1191955879 X:66642042-66642064 TCTTCCCCCAGATATCAGCATGG + Intergenic
1193036871 X:76960769-76960791 TACTTCCCACCATATCTGTAAGG - Intergenic
1195960028 X:110376791-110376813 TCCTTCCCCACACCTCTGCAAGG - Intronic
1196504095 X:116420383-116420405 TCTTTTCTCAGATATTTGTATGG + Intergenic
1196692200 X:118571874-118571896 TCTTCCCTCAGATAGCTGTATGG - Intronic
1196886092 X:120246854-120246876 TTCTTCCCCAGATATTTATATGG + Intergenic
1197374222 X:125662751-125662773 TTCTTCCCTAGATATTTGCATGG + Intergenic
1198024773 X:132694356-132694378 TCTTCCCCTAGATATCTGCAGGG - Intronic
1198033216 X:132775474-132775496 TCCTACCTCAGATATGTGAAAGG + Intronic
1198428170 X:136540426-136540448 TCTTTCCCCAGATACCTGCATGG + Intronic
1198791334 X:140350050-140350072 TCTTTACCCAGATATTTGCAAGG + Intergenic
1199215494 X:145256218-145256240 TCCTTCTCCAGTGATCTGCAGGG + Intergenic
1200373759 X:155757328-155757350 GCCTTCCCCATATAGCTGGATGG + Intergenic
1201678432 Y:16615200-16615222 GCCTTCCCCATATATCTGTAAGG + Intergenic