ID: 963093186

View in Genome Browser
Species Human (GRCh38)
Location 3:141506249-141506271
Sequence TGATCTTGATTTATTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963093182_963093186 21 Left 963093182 3:141506205-141506227 CCTTTCTTCGTAGAGGAACAGTT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 963093186 3:141506249-141506271 TGATCTTGATTTATTGTTGAAGG 0: 1
1: 0
2: 0
3: 30
4: 289
963093181_963093186 24 Left 963093181 3:141506202-141506224 CCTCCTTTCTTCGTAGAGGAACA 0: 1
1: 0
2: 1
3: 7
4: 86
Right 963093186 3:141506249-141506271 TGATCTTGATTTATTGTTGAAGG 0: 1
1: 0
2: 0
3: 30
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963093186 Original CRISPR TGATCTTGATTTATTGTTGA AGG Intronic