ID: 963095934

View in Genome Browser
Species Human (GRCh38)
Location 3:141540421-141540443
Sequence ATCCACTGACCACTAGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963095934_963095936 1 Left 963095934 3:141540421-141540443 CCATGTGCTAGTGGTCAGTGGAT 0: 1
1: 0
2: 0
3: 7
4: 119
Right 963095936 3:141540445-141540467 AATACTGTGGTGATTTGAAAAGG 0: 1
1: 0
2: 2
3: 35
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963095934 Original CRISPR ATCCACTGACCACTAGCACA TGG (reversed) Intronic
905458145 1:38102699-38102721 AGCCACTGACCACCAGAAAAAGG - Intergenic
906764056 1:48410209-48410231 TTCCACAGATCTCTAGCACAGGG + Intronic
910460689 1:87445194-87445216 TTCCACAGATCTCTAGCACAGGG + Intergenic
910715465 1:90225102-90225124 TTCCACAGACCTCTAGGACAGGG - Intergenic
911066912 1:93797915-93797937 ATCCACTTACCTCCAGCTCAGGG - Intronic
911708283 1:101040402-101040424 ATCCACTGACAGCTTGCACTGGG - Intergenic
914317931 1:146531490-146531512 TTCCACAGATCTCTAGCACAGGG + Intergenic
914496425 1:148201868-148201890 TTCCACAGATCTCTAGCACAGGG - Intergenic
914690507 1:150021686-150021708 ATTCACTGAGCACTAGAACTTGG - Intergenic
921484872 1:215703763-215703785 ATCCACTGAGCAAGACCACACGG + Intronic
1063336215 10:5217092-5217114 ATCTACTGTCCACTAGGCCACGG - Intronic
1064278684 10:13931282-13931304 ATCCACTGACCTCCAGCTCTAGG + Intronic
1064806194 10:19136688-19136710 ATGCACTGGCCACTAGTGCAAGG - Exonic
1065164167 10:22957403-22957425 TTCCACTGACCCCTCGCACAGGG - Intronic
1067137576 10:43624934-43624956 ATCCACTGACCAAAAACATAAGG - Intergenic
1068086114 10:52375178-52375200 ATCCACTGAGCAAGAGCACTTGG + Intergenic
1069176914 10:65302056-65302078 ATCCACTGCCCACTATGATATGG + Intergenic
1073396769 10:103224432-103224454 TTCCACAGACCCCTAGGACAGGG + Intergenic
1076265419 10:129105969-129105991 ATCCAATGACCACACTCACAGGG + Intergenic
1076458232 10:130619490-130619512 ATTCATTGACCACTTGCTCAGGG + Intergenic
1081782552 11:45723216-45723238 GTCCACTGTCCACTCACACAGGG + Intergenic
1083441055 11:62676867-62676889 AGCCACTGAGCAATTGCACAGGG + Exonic
1086413343 11:86565063-86565085 AACCAATGGCCAATAGCACATGG + Intronic
1088301867 11:108366740-108366762 ATATTCTGCCCACTAGCACAAGG - Exonic
1098495386 12:71129006-71129028 TCCCACTGAAAACTAGCACAGGG - Intronic
1098686885 12:73433703-73433725 TTCCACAGACCTCTAGGACAGGG - Intergenic
1100123458 12:91395445-91395467 ATCCACTGACAGCTTGCACTAGG + Intergenic
1100713626 12:97283378-97283400 ATACACTGATAACTGGCACAAGG - Intergenic
1102539098 12:113605595-113605617 GTACACTGGCCACTAGCACGAGG - Intergenic
1109951971 13:69511182-69511204 ATCCACTGACAGCTTGCACCTGG + Intergenic
1114727001 14:24948587-24948609 GTCCTCTGACCATGAGCACATGG + Intronic
1119428430 14:74550740-74550762 ATCCTATGACCCCTGGCACATGG - Intronic
1120714120 14:87822030-87822052 ATCCCCTCTCCACTAGCAGAGGG - Intergenic
1121147056 14:91593311-91593333 ATCCACTGACAGCTTGCACCTGG + Intronic
1121982770 14:98469078-98469100 ATCCAATGTCCTCTAGCACCTGG - Intergenic
1123404011 15:20009872-20009894 CTCCCCTGACCACTTACACATGG - Intergenic
1123513350 15:21016518-21016540 CTCCCCTGACCACTTACACATGG - Intergenic
1125273942 15:37970963-37970985 ATCCACTGACAGCTTGCACAAGG - Intergenic
1126424613 15:48513623-48513645 ATACACTCACCACCAGCACAGGG + Exonic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128723637 15:69971742-69971764 ACCCAGTGACCATTAGCACTAGG + Intergenic
1128835756 15:70807871-70807893 TTCTCCTGACCACTTGCACAAGG + Intergenic
1129711491 15:77822516-77822538 AGCCTCTGGCCACCAGCACAAGG - Intergenic
1129984486 15:79905408-79905430 GGCCACTGACTACTAGCATAAGG + Intronic
1131575396 15:93585041-93585063 ATCCACATGCCACTAACACAGGG - Intergenic
1132108347 15:99082859-99082881 ATCAATTGACCATTAGTACAAGG - Intergenic
1133730031 16:8570788-8570810 AGCCACTGACCAGTTACACATGG + Intronic
1135150200 16:19998812-19998834 ATCTCCTGACTCCTAGCACAGGG + Intergenic
1144635047 17:16900748-16900770 AGACACTGACCACAGGCACATGG - Intergenic
1149212987 17:54325156-54325178 AGCCACTTATCACTAGCAAAGGG + Intergenic
1149216163 17:54357304-54357326 ATCCACTGACAGCTTGCACTGGG - Intergenic
1155087338 18:22471255-22471277 ATCCCCTGACCATTCCCACATGG + Intergenic
1157941040 18:51929549-51929571 TTCCACAGATCTCTAGCACAGGG - Intergenic
1162183974 19:8890296-8890318 ATATAATCACCACTAGCACATGG + Intronic
1163103013 19:15108977-15108999 ACCCACTGATCAATTGCACAGGG + Intronic
1166893263 19:46007660-46007682 ATCCAGTGGCTACTAACACATGG - Intronic
926252486 2:11163440-11163462 TTCCACTGACTTTTAGCACAGGG + Intronic
930411447 2:51030591-51030613 ACACACTGCCCACTAGCAAAAGG + Intronic
931508055 2:62954010-62954032 ATGTACTGAGCACTGGCACATGG - Intronic
933921160 2:87047797-87047819 ATCCATTCACCTCTAACACAAGG - Intergenic
934001806 2:87721788-87721810 ATCCATTCACCTCTAACACAAGG + Intergenic
936362655 2:111819448-111819470 ATCCATTCACCTCTAACACAAGG - Intronic
937479665 2:122245030-122245052 ATCCACTGGCCACAGCCACATGG - Intergenic
937979314 2:127605185-127605207 CTCCTCTGGCCACTAGCCCAGGG - Intronic
942990385 2:182193411-182193433 ATCCCCTGACCACAGGGACAGGG + Intronic
944304600 2:198165145-198165167 AGTCACTTACCACTAGCAAAAGG - Intronic
944847753 2:203685859-203685881 AACCAATGACAACTTGCACAAGG - Intergenic
947053118 2:226069457-226069479 ATCAACTTACTACTAGAACAAGG + Intergenic
947830665 2:233139372-233139394 ATCCACAGATCACCAGCACTGGG + Intronic
948948617 2:241234749-241234771 CCCCACTAACCTCTAGCACAGGG - Intronic
1168856415 20:1012510-1012532 ATCTACTGAGCACTGGCCCAAGG + Intergenic
1174675109 20:52346237-52346259 ATCCACTTATCACTAGAACCTGG + Intergenic
1179830720 21:43994402-43994424 CTCCCCTGCCCACCAGCACACGG + Intergenic
1182438265 22:30345317-30345339 ATGCACACACCACTAGCACTTGG + Intronic
1182615727 22:31588408-31588430 CTGCTCTGACCAATAGCACATGG - Intronic
1184591338 22:45485480-45485502 AGCAACTGACCTCCAGCACAAGG - Intergenic
950581643 3:13866170-13866192 ATCCACTGAGCACCTCCACAGGG + Intronic
950680161 3:14579803-14579825 ATCCATTGACCACGAGACCAGGG + Intergenic
954005813 3:47589553-47589575 AACCACTGACCACTAGCTTAAGG + Intronic
954155272 3:48681847-48681869 ATCCCCTGTCCCCTAACACAGGG + Intronic
955465216 3:59230163-59230185 ATCCACTGACAGCTTGCACTGGG - Intergenic
956169494 3:66421633-66421655 ATCCACTGACAGCTTGCACCGGG - Intronic
960197508 3:114787559-114787581 ATCCTCTCACCACTAACTCATGG - Intronic
960671048 3:120155596-120155618 TTCCACAGATCTCTAGCACAGGG + Intergenic
963095934 3:141540421-141540443 ATCCACTGACCACTAGCACATGG - Intronic
966733313 3:183168523-183168545 ATCCACTGACAGCTTGCACTGGG - Intergenic
968732750 4:2278017-2278039 ATCCACTGCCCATAAGCATATGG - Intronic
969615612 4:8251033-8251055 ATCACCTGCCCACCAGCACAGGG + Intergenic
971939719 4:33199455-33199477 TTCCACTGACCTCTAGGTCAGGG - Intergenic
973258232 4:48135031-48135053 ATACACTGACCATTAGGACAGGG + Intergenic
974573645 4:63688534-63688556 TTCCACCGATCTCTAGCACAGGG - Intergenic
974881667 4:67766103-67766125 ATCCCCTGATGACAAGCACATGG - Intergenic
976312205 4:83623359-83623381 ATCCACTGACAGCTTGCACCTGG + Intergenic
985381784 4:189402889-189402911 TTCCACAGATCTCTAGCACAGGG - Intergenic
988061506 5:26175912-26175934 ATCCACTGACAGCTTGCACCAGG + Intergenic
988366704 5:30309883-30309905 TTCCACAGATCACTAGGACAGGG - Intergenic
988411472 5:30891369-30891391 ATCCACAGACCACAACCATATGG + Intergenic
996897560 5:128503603-128503625 TTCCACAGACCTCTAGGACAGGG - Intronic
998932939 5:147201209-147201231 ATCTACTGACCACTGGCCAAGGG - Intergenic
999687899 5:154118676-154118698 ATCTGCTGACAGCTAGCACAGGG - Intronic
1001211510 5:169814121-169814143 ATCCACTGATTAATGGCACAGGG + Intronic
1002017844 5:176339943-176339965 ATCCACAGACCACTCGCAGAAGG - Intronic
1003844278 6:10156560-10156582 AAACACTGACAACTAGCACCTGG + Intronic
1012564313 6:100627952-100627974 ATACAATGACCTCTAGAACAGGG + Exonic
1012569116 6:100700510-100700532 ATCCACTGACAGCTTGCACCAGG + Intronic
1014116100 6:117670215-117670237 ATCCACTGACAGCTTGCACCAGG + Intergenic
1015713195 6:136163753-136163775 TTCCACTGATCTCTAGAACAGGG + Intronic
1019497538 7:1347490-1347512 TTCCACTGATCACAAGCACTGGG + Intergenic
1023548758 7:41346397-41346419 GTCAACTGACCACATGCACAAGG - Intergenic
1027726110 7:81808022-81808044 ATCCACTGTCCACTTGCTAAAGG + Intergenic
1031013862 7:116551247-116551269 CTCCATTCAGCACTAGCACAGGG - Intronic
1031260551 7:119513743-119513765 GTCATGTGACCACTAGCACAAGG - Intergenic
1031677949 7:124634309-124634331 ATCCACTGACAGCTTGCACTGGG + Intergenic
1040926011 8:52683937-52683959 CTCCATTGACCACCAGCACCTGG + Exonic
1042331766 8:67587971-67587993 TTTCAATGATCACTAGCACAGGG + Intronic
1049955106 9:685947-685969 ATCCACTGTCCATTAGGCCAAGG + Intronic
1050576064 9:6996683-6996705 CTATACTCACCACTAGCACATGG - Intronic
1056768335 9:89459137-89459159 AACCACTGACCACAGGCACATGG - Intronic
1057174597 9:92986826-92986848 TTCCCCTGACTACTGGCACATGG - Intronic
1059040388 9:110808400-110808422 AACCACTCACCACTCGCACTTGG + Intergenic
1059045518 9:110861981-110862003 ATCCACTGACAGCTTGCACCAGG + Intergenic
1059946062 9:119409556-119409578 CTCCACAGACAACCAGCACATGG + Intergenic
1187619103 X:21030519-21030541 ATCCACTGACAGCTTGCACTGGG - Intergenic
1189623240 X:42866434-42866456 TTCCACTGACCACCAGCATTGGG - Intergenic
1194395378 X:93377298-93377320 AACCACTGACATCTGGCACATGG + Intergenic
1197843096 X:130771298-130771320 ATCCTCTTTCCACTAACACATGG - Intronic
1200976797 Y:9219946-9219968 ATCCACTGACCTTAATCACAGGG - Intergenic