ID: 963096115

View in Genome Browser
Species Human (GRCh38)
Location 3:141542763-141542785
Sequence GGTTATGACTATAAAGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963096115_963096118 -1 Left 963096115 3:141542763-141542785 CCCATAGCTTTATAGTCATAACC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 963096118 3:141542785-141542807 CACTCCTCTCTTCTAACCCTTGG 0: 1
1: 0
2: 2
3: 15
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963096115 Original CRISPR GGTTATGACTATAAAGCTAT GGG (reversed) Intronic
909149520 1:71984174-71984196 AGTTAGGATTATAAGGCTATGGG - Intronic
910419160 1:87038049-87038071 ATTTATGACTAAAAAACTATTGG - Intronic
916353303 1:163876471-163876493 GCTTATGCATATAGAGCTATGGG - Intergenic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
920130502 1:203728395-203728417 GATTAAAACAATAAAGCTATGGG - Intronic
923684839 1:236146796-236146818 GAGTATGACTAGAAAGCCATAGG - Intronic
1062861020 10:809552-809574 GGTTATGAAAATAAAGATTTAGG - Exonic
1068075996 10:52255286-52255308 GAATATGACTATAAGGCAATGGG - Intronic
1070079694 10:73173470-73173492 GGATATAACTATAAAGGGATAGG - Intronic
1070637530 10:78141204-78141226 GATTATGACGATAAGGGTATAGG - Intergenic
1072601413 10:96934415-96934437 GCTTATGACTCTATAGCTCTAGG - Intronic
1073133953 10:101209214-101209236 GGTTATGACCTTAAAGGAATGGG + Intergenic
1075150164 10:119921913-119921935 GGAAATGACTATAAAGTCATAGG + Intronic
1079645245 11:22855895-22855917 GTTTATGAGCATAGAGCTATTGG - Intronic
1081443796 11:43109740-43109762 AGTTATGACAATAAAGCTAAAGG + Intergenic
1081852703 11:46284925-46284947 GGTTTTGCCCATAAAGCTCTAGG - Intronic
1082140832 11:48606931-48606953 GATTATAATTATAAATCTATTGG - Intergenic
1082568006 11:54703701-54703723 GATTATAATTATAAATCTATTGG - Intergenic
1082569607 11:54721812-54721834 GATTATGATTATAAATTTATTGG - Intergenic
1082617990 11:55385377-55385399 GATTATGATTATAAATCTATTGG - Intergenic
1082621403 11:55427147-55427169 GCTTATTATTATAAATCTATTGG - Intergenic
1087519282 11:99210017-99210039 AGTTCTGACTATGGAGCTATAGG - Intronic
1090133820 11:124174062-124174084 GGTCCTGACTATAGAGCTAATGG - Intergenic
1091517979 12:1204895-1204917 GGTTTCTTCTATAAAGCTATAGG - Intronic
1096211930 12:49773260-49773282 GGATATGAATCTAAAGCTAAGGG + Intergenic
1097480548 12:60119198-60119220 GTATATGACTATAAAGCTCCGGG - Intergenic
1097984164 12:65765873-65765895 ATTTATCATTATAAAGCTATGGG - Intergenic
1099564334 12:84222120-84222142 GGTTAGGAGTACAAAGATATAGG - Intergenic
1108107003 13:47021454-47021476 AGTGATGATCATAAAGCTATGGG + Intergenic
1108367300 13:49728647-49728669 GGTAATGACTAAAAAGTTTTTGG + Intronic
1108859991 13:54844486-54844508 GTTTATGACAATAAACCTAAAGG + Intergenic
1110050693 13:70894662-70894684 GGTTATATCTAGAAATCTATTGG - Intergenic
1110420460 13:75301748-75301770 AATTATGACTATACACCTATAGG - Intronic
1111448715 13:88386154-88386176 GATCATGACAATAAAGTTATTGG - Intergenic
1112252545 13:97795922-97795944 GGTGAAAACTATAAATCTATAGG - Intergenic
1113351546 13:109534171-109534193 TGTTATGATTAAAAATCTATGGG - Intergenic
1114388483 14:22280598-22280620 GGTTATGATAATACAGGTATTGG - Intergenic
1114562425 14:23603002-23603024 AGTGATGACTAAAAAGCTACAGG + Intergenic
1115380896 14:32737834-32737856 AGTTCTGTCTACAAAGCTATGGG - Intronic
1118549869 14:66938719-66938741 GATTATGCTTATTAAGCTATAGG - Intronic
1124876995 15:33604320-33604342 GGTTGTAACTAGAAAGCTAAGGG - Intronic
1126166644 15:45659239-45659261 GGATATGACTATCAAGCAATGGG + Intronic
1127215438 15:56818558-56818580 CTGTATGACTATAAAGCAATGGG + Intronic
1127285816 15:57532838-57532860 GGTTATGAATAACAATCTATTGG - Intronic
1127340462 15:58038068-58038090 GGATATGTCTCTTAAGCTATGGG + Intronic
1132001481 15:98184853-98184875 AATTATGAATATAAAACTATTGG - Intergenic
1135268589 16:21049636-21049658 GGTTTGGATTACAAAGCTATGGG - Exonic
1139452749 16:67044238-67044260 GTTTATGACTTTAAAGATAAGGG + Intronic
1151392809 17:73799135-73799157 GGTTATTACTATAGAGCCAGAGG + Intergenic
1155404917 18:25477123-25477145 AGTTATGTATATTAAGCTATGGG - Intergenic
1165558638 19:36658796-36658818 GATTATGACTATCATGCCATAGG + Intronic
930488495 2:52039108-52039130 GGTAATGACTATGAAGTTGTGGG - Intergenic
933394546 2:81714228-81714250 GGTGATGACTATAATGGTAAAGG - Intergenic
936640438 2:114305713-114305735 GTTTATGTCTATAAAAATATTGG + Intergenic
941445734 2:165596895-165596917 GATAATGTCTATAAAGCTATTGG - Intronic
943230128 2:185239986-185240008 TGTTAAAACTATAAATCTATTGG - Intergenic
944346159 2:198668430-198668452 GGTGATGACTAGTAAGCTGTTGG - Intergenic
945459616 2:210090417-210090439 GGTTAAGACTATAAATTTTTTGG + Intronic
1176251753 20:64125580-64125602 GTATTTGAGTATAAAGCTATAGG - Intergenic
1178247785 21:30970838-30970860 GGTGAAGACTATATATCTATGGG - Intergenic
1183825148 22:40380636-40380658 TTTTATGATTATAAAGTTATAGG - Intronic
951510049 3:23490194-23490216 GGTTATGATTATAAAGACTTTGG - Intronic
951648714 3:24924077-24924099 GTTTATGACTAGAAGGCTATGGG - Intergenic
952231529 3:31435931-31435953 GGTTATAATTATAAACCTGTGGG - Intergenic
955360631 3:58271210-58271232 GATTATGATTATATAACTATTGG - Intronic
963096115 3:141542763-141542785 GGTTATGACTATAAAGCTATGGG - Intronic
965191908 3:165541540-165541562 AGCTTTGACTATATAGCTATAGG - Intergenic
966092424 3:176156262-176156284 AGTCATGACTTTTAAGCTATTGG - Intergenic
975126710 4:70790598-70790620 AGATATGAGTATGAAGCTATGGG - Intronic
976684729 4:87800069-87800091 TGTTCTGACTTTAGAGCTATAGG - Intronic
978436062 4:108685780-108685802 GGGTATGAATATATAGCTAGAGG - Intergenic
982137083 4:152282060-152282082 GATAAAGACTATAAAGCAATTGG + Intergenic
982955704 4:161763512-161763534 AGTCATGGCTATGAAGCTATGGG + Intronic
985345860 4:189003349-189003371 GGTTACTACTATAAATCTTTTGG + Intergenic
986880329 5:12161966-12161988 GGTTAAGACTTTGAGGCTATTGG + Intergenic
988142892 5:27265903-27265925 GTTTATGAATTTAAATCTATTGG - Intergenic
990640202 5:57774783-57774805 GGTTATGACTATACAGCCTATGG + Intergenic
994580537 5:101635810-101635832 GGTTCTGAATATAAAGATAAAGG + Intergenic
997395901 5:133559712-133559734 GGTTATGACGGGCAAGCTATAGG - Intronic
998753290 5:145348475-145348497 GGTGATGACTGTAATGCTACTGG - Intergenic
999283749 5:150381859-150381881 TGCTATGACCATAAAGCTAGTGG - Intronic
1000918065 5:167106109-167106131 GATAATGCCTATAAAGCTCTTGG + Intergenic
1003786674 6:9494415-9494437 TGTTAAGACTAGAAAGCTTTTGG - Intergenic
1011010569 6:82699011-82699033 GGCTATGACTATAAGACTAATGG + Intergenic
1014653911 6:124075159-124075181 CGTTAAGTCTATAAACCTATTGG + Intronic
1015383051 6:132591613-132591635 GATTATGACTTTTAAGCTAAAGG - Intergenic
1015508356 6:134012280-134012302 GGTTTTGACTAGAAATCTTTAGG - Intronic
1016234301 6:141844171-141844193 GGTTAAGACTTCAAAGGTATAGG - Intergenic
1016635643 6:146287116-146287138 AGTTTTGATTATGAAGCTATTGG + Intronic
1021513133 7:21455790-21455812 GGTTATGAAGACAAAGATATAGG - Intronic
1021788653 7:24178097-24178119 AGATATGACTTTAAAGCTATGGG - Intergenic
1032233322 7:130096469-130096491 GGTTAAGAAGATAAAGCAATGGG - Intronic
1037168136 8:15856206-15856228 GTTCAAGACTATATAGCTATTGG - Intergenic
1042585409 8:70332917-70332939 GTTAATGACTATAAAGTTCTAGG - Intronic
1042784010 8:72526461-72526483 GGTTGTGACTTCAAAGCTAGTGG + Intergenic
1048087374 8:131198149-131198171 ATTTATGACTAAAAAGCTAAAGG - Intergenic
1052548668 9:29917430-29917452 AAATATGACTATAATGCTATAGG + Intergenic
1060958753 9:127664187-127664209 GGTTATCACTGGAAACCTATGGG + Intronic
1061713633 9:132504859-132504881 GGCTATTACTTTAAAGTTATGGG + Intronic
1188065518 X:25654849-25654871 GGTGATCACTATAGAGCTAAAGG - Intergenic
1196586641 X:117436934-117436956 GGCTATGACTAGAGTGCTATTGG - Intergenic
1197436866 X:126439925-126439947 AAATATGAATATAAAGCTATTGG - Intergenic
1198251533 X:134883748-134883770 GGATATGAGTACATAGCTATTGG - Intergenic