ID: 963097330

View in Genome Browser
Species Human (GRCh38)
Location 3:141557849-141557871
Sequence TTCCAGATTTGGAACCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963097330_963097339 23 Left 963097330 3:141557849-141557871 CCCCCAAGGTTCCAAATCTGGAA 0: 1
1: 0
2: 0
3: 18
4: 162
Right 963097339 3:141557895-141557917 AAAATAAAAGTGGCTTAGTTTGG 0: 1
1: 0
2: 1
3: 58
4: 718
963097330_963097338 13 Left 963097330 3:141557849-141557871 CCCCCAAGGTTCCAAATCTGGAA 0: 1
1: 0
2: 0
3: 18
4: 162
Right 963097338 3:141557885-141557907 GGGAAGAAGGAAAATAAAAGTGG 0: 1
1: 0
2: 17
3: 194
4: 1641
963097330_963097336 -7 Left 963097330 3:141557849-141557871 CCCCCAAGGTTCCAAATCTGGAA 0: 1
1: 0
2: 0
3: 18
4: 162
Right 963097336 3:141557865-141557887 TCTGGAAAAATAGAAGAGTAGGG 0: 1
1: 0
2: 6
3: 60
4: 574
963097330_963097335 -8 Left 963097330 3:141557849-141557871 CCCCCAAGGTTCCAAATCTGGAA 0: 1
1: 0
2: 0
3: 18
4: 162
Right 963097335 3:141557864-141557886 ATCTGGAAAAATAGAAGAGTAGG 0: 1
1: 0
2: 5
3: 52
4: 599
963097330_963097337 0 Left 963097330 3:141557849-141557871 CCCCCAAGGTTCCAAATCTGGAA 0: 1
1: 0
2: 0
3: 18
4: 162
Right 963097337 3:141557872-141557894 AAATAGAAGAGTAGGGAAGAAGG 0: 1
1: 0
2: 4
3: 86
4: 942

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963097330 Original CRISPR TTCCAGATTTGGAACCTTGG GGG (reversed) Intronic
904629259 1:31829198-31829220 GTCCAGATCTGGAAGCTGGGAGG + Intergenic
904644856 1:31958048-31958070 ATCAAGATTGGGAACCTAGGAGG - Intergenic
905353609 1:37364996-37365018 TTCCAGCTTTTGATTCTTGGTGG - Intergenic
907836984 1:58119513-58119535 TTCCCTATTTGAAACCTTAGGGG - Intronic
908329112 1:63052886-63052908 TTCCAGCTGTGTGACCTTGGAGG - Intergenic
910075850 1:83277898-83277920 TCCCAGATTTGGAAGAGTGGAGG + Intergenic
910648027 1:89533994-89534016 TTCCAGATTTAGCAACTTGTAGG + Intronic
911027015 1:93447233-93447255 TCCCAGTATCGGAACCTTGGAGG - Intergenic
913145446 1:115985293-115985315 TTACAGATTTGTAGCCTAGGAGG + Intronic
913988360 1:143585804-143585826 TGCCACAGTGGGAACCTTGGGGG - Intergenic
915770909 1:158422137-158422159 TACCAGATTTTGTACCTTTGAGG + Intergenic
921186796 1:212677490-212677512 TTCCAGCTTGGGAAGCTGGGTGG + Intergenic
923931940 1:238710894-238710916 TTCCAGATTTGGAGGCTAGGAGG - Intergenic
1064739066 10:18413563-18413585 TTTCAGATTTGGAAGGATGGAGG - Intronic
1073257313 10:102161195-102161217 TTCCAGTTGTGGAAACTGGGAGG + Intronic
1074729173 10:116350116-116350138 ATCCAGATTTAAAACCTTGTGGG + Intronic
1076090840 10:127684293-127684315 TTCCAGAGTTGGCAGCTTTGGGG - Intergenic
1076378069 10:130004915-130004937 TTCCAGATATGCAAGTTTGGGGG + Intergenic
1077846999 11:6036381-6036403 TTCCATCTTGGGAAACTTGGTGG + Intergenic
1078857021 11:15214671-15214693 TTCCAGCATATGAACCTTGGAGG - Intronic
1080425878 11:32153894-32153916 TTACAGATTCAGAAACTTGGAGG - Intergenic
1081187108 11:40057360-40057382 TCCCAGGTATGGAAACTTGGTGG - Intergenic
1081678872 11:44987931-44987953 ATCCAGATCTCCAACCTTGGAGG + Intergenic
1082022154 11:47543426-47543448 TTCCAGATTTGTAAAGTTTGGGG - Intronic
1082778047 11:57263148-57263170 TTCCAACTCAGGAACCTTGGTGG + Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1092174690 12:6395218-6395240 TTCCAGAGCAGGGACCTTGGTGG - Intergenic
1092956313 12:13553540-13553562 TTCCACATTTGTGGCCTTGGGGG - Exonic
1094605404 12:31944896-31944918 TTCCAATTTGGGATCCTTGGTGG - Intergenic
1094723928 12:33092859-33092881 GTCCAGATTGGGACCCTTGAGGG + Intergenic
1095538279 12:43277666-43277688 ATCCAAATTTGAAATCTTGGTGG - Intergenic
1104729498 12:131097239-131097261 TTCCAGACCAGGAACCCTGGGGG - Intronic
1106287232 13:28328613-28328635 TTCCCGTTCTGGAACCTAGGGGG - Intronic
1108179808 13:47829403-47829425 TTCCAGATGTGGAGCCGTGGTGG - Intergenic
1111641251 13:90973407-90973429 TTCCAGTTTGAGAAACTTGGAGG + Intergenic
1112258723 13:97858428-97858450 ATCCAGATTTGTAACCCAGGCGG + Intergenic
1119117373 14:72037498-72037520 TTCAAGAATTGGGACCTTCGTGG - Intronic
1119579835 14:75767915-75767937 TTTCACATTTGGAAACTTGGTGG + Intronic
1121586032 14:95063734-95063756 TTCCAAGTTTGGAAGCTGGGTGG + Intergenic
1121832985 14:97067815-97067837 TTCCAGATAGGGAACCTCAGTGG + Intergenic
1122399691 14:101459191-101459213 TTCCAGATTTGCAACCTCAGAGG - Intergenic
1124568201 15:30835312-30835334 TTCTAGATTTGTGACCTTTGGGG + Intergenic
1127508772 15:59619916-59619938 TTCCAGGTTTGGTAGCGTGGAGG + Exonic
1127535557 15:59886718-59886740 TTCCAGGTTTGGAAGCATCGGGG + Intergenic
1130217568 15:81986707-81986729 TTCTAGTTATGGAAGCTTGGTGG - Intergenic
1130222567 15:82032918-82032940 TTGCGGATTTAGAACCTTGGTGG - Intergenic
1130933255 15:88447856-88447878 TTCCTGACCTGGAACCTTTGGGG + Intergenic
1135867403 16:26116875-26116897 TTTCAGATTTGGGATTTTGGGGG + Intronic
1135974380 16:27098044-27098066 TTCCATATTTGGAACCCTTGTGG - Intergenic
1137778212 16:51074160-51074182 GGCCAGATTCAGAACCTTGGAGG - Intergenic
1139289353 16:65843548-65843570 TTCCAGATGTGGAAGCTGAGAGG + Intergenic
1142930715 17:3281981-3282003 TGCCAGATTTGCAGCCTGGGAGG + Intergenic
1143090659 17:4447589-4447611 AGCCAGATTTGGAATTTTGGGGG + Intronic
1144790412 17:17855278-17855300 TTCCAGAGTAAGAGCCTTGGGGG + Intronic
1144940037 17:18932579-18932601 TTCCAAATGTGGAAACTGGGTGG - Intergenic
1149436961 17:56641175-56641197 ATCAAGATTTGGAACCTGGCTGG - Intergenic
1153388072 18:4522235-4522257 TTCCAAATTTTGAACCTGGGAGG + Intergenic
1154388082 18:13913543-13913565 TTCCAAATTTTGTACCCTGGCGG + Intronic
1155735355 18:29215948-29215970 TTCAAGATTGGGAATCTGGGTGG + Intergenic
1157013715 18:43683146-43683168 TTCCAAGTTGGGACCCTTGGTGG - Intergenic
1157505625 18:48224282-48224304 TTCTAGATTTGGGACCTTCATGG - Intronic
1158414731 18:57239952-57239974 TTCTAGCTTGGGAACCTGGGTGG + Intergenic
1161414938 19:4140683-4140705 TTCCAGAGTTGGGGGCTTGGAGG + Intergenic
1161832582 19:6618372-6618394 TTCCAGATTTGGAAATTTTGGGG - Intergenic
1162807691 19:13146875-13146897 TTCCAGATGTGCTGCCTTGGGGG - Intronic
1165177979 19:33943911-33943933 TTCCAAATTTGGTAACTTTGTGG - Intergenic
1166316069 19:41991076-41991098 TTCCAGTTTGGGAGCCTGGGCGG + Intronic
1167423931 19:49420056-49420078 TTAAAGATTTGGAGCCTGGGAGG + Intergenic
924979941 2:210345-210367 TGCCAGATTTGCACCCTGGGAGG - Intergenic
925131922 2:1499860-1499882 TTTCACATTTGAAACCGTGGAGG - Intronic
925753703 2:7112376-7112398 TTCCAGATTTTGGAGCTTTGTGG - Intergenic
929943983 2:46356626-46356648 TTCCAGATTTGGAGGCAGGGAGG - Intronic
931825699 2:65998244-65998266 TTCCAGACCTGGAACCCTGTTGG + Intergenic
932181803 2:69653095-69653117 TTCCAGATTTGGCTCCTGTGTGG - Intronic
935538685 2:104324310-104324332 TCCAAGATTTGGAACTGTGGTGG - Intergenic
936654887 2:114473644-114473666 TCCCAGATATTGAACCTTAGAGG + Intronic
936677567 2:114732900-114732922 TACCAGTTTTGTGACCTTGGGGG - Intronic
937541716 2:122963920-122963942 TTTTATATTTGGAAGCTTGGGGG + Intergenic
939530118 2:143348863-143348885 TTCCTTATTTGGAAGATTGGAGG - Intronic
945187724 2:207156603-207156625 TTCCATATTTGGAAACTTTGTGG - Intronic
946025627 2:216670270-216670292 TTTTAGATGTGGAATCTTGGGGG + Intergenic
948776495 2:240291584-240291606 TTCCAGTTTAGGAACATTTGTGG + Intergenic
1168857141 20:1016691-1016713 TTCCAGAGTTGGAAGCCTGCAGG - Intergenic
1168935520 20:1661968-1661990 TTCCAGATGTGGCACATTTGAGG + Intergenic
1169616889 20:7457839-7457861 TTCATGTTTTGGAAACTTGGTGG + Intergenic
1170369087 20:15628720-15628742 TCCCAGGTCTGGCACCTTGGTGG + Intronic
1170681306 20:18528112-18528134 GTCCAGATTTGCAGCCTTAGGGG + Intronic
1172265450 20:33608712-33608734 TTCCATATTTGGCTGCTTGGCGG + Intronic
1174170300 20:48613631-48613653 TTCCAGATGTGGAGACTTGGGGG - Intergenic
1175290243 20:57870611-57870633 TTTCAGCTTTGGAACCTAAGTGG - Intergenic
1177120486 21:17132234-17132256 ATCCAGATGGGGAGCCTTGGGGG - Intergenic
1177480677 21:21683124-21683146 TAGCAGATTTCTAACCTTGGGGG - Intergenic
949524676 3:4891464-4891486 TCCCAGATTTGTAACCTGGGAGG - Intergenic
950311944 3:11966559-11966581 TTCCAGTTTAGCAACCCTGGTGG + Intergenic
950439896 3:13004466-13004488 CACCAGATCTGGAGCCTTGGAGG + Intronic
950874449 3:16257414-16257436 TTCTACATTTGGAAACTTAGTGG - Intergenic
951080002 3:18443282-18443304 TTCCATGTTTGCATCCTTGGAGG - Intronic
952055611 3:29441541-29441563 ATCCAGATTTTGAATCCTGGTGG - Intronic
954666901 3:52259394-52259416 AACCACATTTGGAAGCTTGGTGG - Intronic
956343264 3:68249609-68249631 ATCCAGATTTGGTAGATTGGTGG - Intronic
959606864 3:108250537-108250559 GTCTTGATTTGGAACCTGGGTGG + Intergenic
962477544 3:135769488-135769510 TTCCAGCTTTGAAATCTTGGAGG - Intergenic
963097330 3:141557849-141557871 TTCCAGATTTGGAACCTTGGGGG - Intronic
965765774 3:172128539-172128561 TTGGAGATTGGGAATCTTGGGGG + Intronic
967285960 3:187870615-187870637 TTACACATTTGAAACCATGGTGG - Intergenic
968113240 3:196067399-196067421 TTCCACATTTGGGAATTTGGAGG - Intronic
969272863 4:6114564-6114586 TCCCAGATTTTGTAGCTTGGAGG - Intronic
972268711 4:37488321-37488343 ATCAAGATTTGGAACATTGTAGG + Intronic
972985360 4:44756838-44756860 TTCCAGTTTTGGAAAGATGGGGG - Intergenic
973344052 4:49035524-49035546 TTCTAGATTTGGTTCCGTGGCGG + Intronic
974190326 4:58495486-58495508 TTCCAACTTGGGACCCTTGGAGG - Intergenic
974664827 4:64947059-64947081 TTACAGATTTGGAAACTGAGAGG - Intergenic
979788661 4:124750399-124750421 TTGCAAATTAGGAACCTTGTAGG - Intergenic
983847738 4:172540667-172540689 TTCCAGATGTGGCACCTTTTTGG - Intronic
985569348 5:636076-636098 TTCCAGCTTAGGAACTTTGGGGG + Intronic
987764617 5:22209063-22209085 TTCCAGATTTGGGAACATGTTGG + Intronic
991094495 5:62725169-62725191 TTTCAGATTTGAAACTTTGATGG + Intergenic
991491185 5:67184151-67184173 TTCCAAAGTTTGAACTTTGGAGG - Exonic
991899356 5:71442213-71442235 TTCCAGATTTGGGAACATGTTGG + Intergenic
992608014 5:78481248-78481270 TTCCAGAATTGGAACATAAGAGG + Intergenic
993876488 5:93313462-93313484 TTTCAGATTTTGAATTTTGGGGG + Intergenic
1001891773 5:175345376-175345398 TTCCAGAGCTGGAACCAGGGAGG - Intergenic
1002664328 5:180811177-180811199 TTCCGGTTTTCGAACCGTGGGGG - Intronic
1005252881 6:23967577-23967599 TTCTTGATTTGGAGCCTTTGTGG - Intergenic
1006445268 6:34076503-34076525 TTCCAGCTGAGGAAGCTTGGTGG - Intronic
1007580905 6:42959467-42959489 TTCCAACTTGGGACCCTTGGTGG - Intergenic
1009865856 6:69397183-69397205 ATCCAGAATTGGCCCCTTGGAGG + Intergenic
1012627831 6:101425992-101426014 TTTCAGACTTGAAAGCTTGGAGG + Intronic
1013439690 6:110150692-110150714 TTGAAGATTTTGAACTTTGGTGG + Intronic
1015078096 6:129187810-129187832 TTCAAAATTTGAAACTTTGGGGG - Intronic
1015279400 6:131417197-131417219 TTCCAAAATTGGAACCCTCGAGG - Intergenic
1016374140 6:143403305-143403327 TTCCTGTTTTGTAACTTTGGTGG - Intergenic
1016665485 6:146634820-146634842 TTCTATATTTGGAAATTTGGGGG - Intronic
1016833509 6:148455223-148455245 ATCCAGATGTGGAACCCTGGAGG + Intronic
1017285174 6:152666750-152666772 CCCCAGATTTGGAACCTTTTTGG + Intergenic
1017557776 6:155590715-155590737 TTTCACATTTGGAACAATGGTGG - Intergenic
1018882989 6:167903847-167903869 TGCCAGATTTGGGACCTGGGAGG - Intronic
1022123047 7:27328714-27328736 CTCCAGATTTGGACCCGTGAAGG - Intergenic
1023876986 7:44291845-44291867 TTCCAAACTTGGAATCTGGGTGG + Intronic
1024599187 7:50964552-50964574 TTCCAACTTGGGACCCTTGGTGG + Intergenic
1026225243 7:68434593-68434615 TTCCAGATTTGCCACCAAGGAGG - Intergenic
1027293568 7:76742766-76742788 TCCCAGATTTGGAAGAGTGGAGG + Intergenic
1028393448 7:90340835-90340857 CTCTAGATTTGGAGCATTGGAGG - Intronic
1028477608 7:91267472-91267494 CTCCAGATTTGGAAGGTTTGTGG - Exonic
1028963954 7:96780664-96780686 TTCAAGGTTTGGAACTTTGCTGG - Intergenic
1032988097 7:137361310-137361332 TTCCAGATATGGACCCTCAGTGG - Intergenic
1033257754 7:139816842-139816864 ATCCAGGCTTGGAACCCTGGAGG + Intronic
1034541080 7:151758630-151758652 TTCGGGGTTTGGAACCTTTGGGG - Intronic
1035390831 7:158503486-158503508 TTCCAGTTTGGGAAACCTGGTGG - Intronic
1036031179 8:4975547-4975569 TTCCAGTTTTGGGACCTTCCTGG - Intronic
1036081510 8:5561801-5561823 TTCCAAATTTGGAGCCCTGGAGG + Intergenic
1036159853 8:6377253-6377275 TTTCTCATGTGGAACCTTGGAGG + Intergenic
1038998451 8:32952523-32952545 TTCCTGATTTGCTATCTTGGTGG + Intergenic
1039401689 8:37275253-37275275 TTGCATATTTTGAAGCTTGGGGG + Intergenic
1042217312 8:66439230-66439252 TTCCAGATTTGAATTTTTGGCGG + Intronic
1042680406 8:71377273-71377295 TTTCATATCTGGTACCTTGGTGG - Intergenic
1042945067 8:74146165-74146187 TTAAAGATTTGGAAACTTGTAGG + Intergenic
1043966310 8:86481670-86481692 TTCCAAATTTGGATTCTTGCTGG + Intronic
1045176761 8:99733592-99733614 TCCTAGATTTTGAATCTTGGAGG + Intronic
1046383996 8:113485857-113485879 TTGTAGATTTAGCACCTTGGTGG + Intergenic
1046499443 8:115056783-115056805 TTCCAAAATTGGTACCTTTGAGG - Intergenic
1046693316 8:117310469-117310491 TACCAGATTTGACTCCTTGGAGG - Intergenic
1050668045 9:7963671-7963693 TTCAAGCCTTGGAGCCTTGGGGG - Intergenic
1051679745 9:19595094-19595116 TTTCTGATATGGAACCTTTGTGG - Intronic
1051710095 9:19922698-19922720 TTCCATATTTGGAGTCTAGGTGG - Intergenic
1052195926 9:25714789-25714811 TTGCAGAGTGGGAACCTTTGCGG - Intergenic
1052243843 9:26309391-26309413 ATTCAAATTTGGAACCTTGTAGG - Intergenic
1058015488 9:100027708-100027730 TTCCCCATTTGGAACCCTGCTGG - Intronic
1059119451 9:111628761-111628783 TTCCAAATTTGAAACCTTTGAGG - Intergenic
1059973466 9:119691453-119691475 TTCCATATTAGGTACCATGGAGG + Intergenic
1061262870 9:129489695-129489717 ATCCAGAATTTGAACCTAGGTGG - Intergenic
1061622626 9:131821513-131821535 TTCCAGCTTGGGCACCTGGGAGG - Intergenic
1185748380 X:2590326-2590348 TTACAGAGTTGGAGCCTTGGAGG - Intergenic
1186578770 X:10794275-10794297 TCTCAGACATGGAACCTTGGGGG - Intronic
1188748551 X:33877460-33877482 TTCAATATTTGGAAACTTCGAGG - Intergenic
1188810734 X:34651394-34651416 TCACAGGTTTGGCACCTTGGTGG - Intronic
1189203476 X:39217775-39217797 GTAGAGATTTTGAACCTTGGTGG + Intergenic
1189249615 X:39590150-39590172 TTCCAGAATTGCTACCTTGCCGG - Intergenic
1192559245 X:72114763-72114785 TCCCTGAGGTGGAACCTTGGCGG + Intergenic
1195130818 X:101849583-101849605 TTCCAGATTTGGAAAGTTTTTGG - Intronic
1197579625 X:128265052-128265074 TTACAGATGTAGAACCTTGATGG + Intergenic