ID: 963103074

View in Genome Browser
Species Human (GRCh38)
Location 3:141623840-141623862
Sequence AAGTCCTTACTGAGGCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963103074_963103086 12 Left 963103074 3:141623840-141623862 CCGCCCAGCCTCAGTAAGGACTT No data
Right 963103086 3:141623875-141623897 CCTCTCTCAGGTGACTCACTGGG No data
963103074_963103087 19 Left 963103074 3:141623840-141623862 CCGCCCAGCCTCAGTAAGGACTT No data
Right 963103087 3:141623882-141623904 CAGGTGACTCACTGGGCACCCGG No data
963103074_963103080 0 Left 963103074 3:141623840-141623862 CCGCCCAGCCTCAGTAAGGACTT No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103074_963103084 11 Left 963103074 3:141623840-141623862 CCGCCCAGCCTCAGTAAGGACTT No data
Right 963103084 3:141623874-141623896 GCCTCTCTCAGGTGACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963103074 Original CRISPR AAGTCCTTACTGAGGCTGGG CGG (reversed) Intergenic
No off target data available for this crispr