ID: 963103080

View in Genome Browser
Species Human (GRCh38)
Location 3:141623863-141623885
Sequence GGCCCCAAGAGGCCTCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963103065_963103080 25 Left 963103065 3:141623815-141623837 CCTTCCTCCCTCCAGCAGGGCCT No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103073_963103080 1 Left 963103073 3:141623839-141623861 CCCGCCCAGCCTCAGTAAGGACT No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103060_963103080 30 Left 963103060 3:141623810-141623832 CCCCTCCTTCCTCCCTCCAGCAG No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103067_963103080 18 Left 963103067 3:141623822-141623844 CCCTCCAGCAGGGCCTCCCCGCC No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103066_963103080 21 Left 963103066 3:141623819-141623841 CCTCCCTCCAGCAGGGCCTCCCC No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103063_963103080 28 Left 963103063 3:141623812-141623834 CCTCCTTCCTCCCTCCAGCAGGG No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103078_963103080 -8 Left 963103078 3:141623848-141623870 CCTCAGTAAGGACTTGGCCCCAA No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103068_963103080 17 Left 963103068 3:141623823-141623845 CCTCCAGCAGGGCCTCCCCGCCC No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103074_963103080 0 Left 963103074 3:141623840-141623862 CCGCCCAGCCTCAGTAAGGACTT No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103077_963103080 -4 Left 963103077 3:141623844-141623866 CCAGCCTCAGTAAGGACTTGGCC No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103069_963103080 14 Left 963103069 3:141623826-141623848 CCAGCAGGGCCTCCCCGCCCAGC No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103070_963103080 5 Left 963103070 3:141623835-141623857 CCTCCCCGCCCAGCCTCAGTAAG No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103076_963103080 -3 Left 963103076 3:141623843-141623865 CCCAGCCTCAGTAAGGACTTGGC No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103072_963103080 2 Left 963103072 3:141623838-141623860 CCCCGCCCAGCCTCAGTAAGGAC No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data
963103061_963103080 29 Left 963103061 3:141623811-141623833 CCCTCCTTCCTCCCTCCAGCAGG No data
Right 963103080 3:141623863-141623885 GGCCCCAAGAGGCCTCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963103080 Original CRISPR GGCCCCAAGAGGCCTCTCTC AGG Intergenic
No off target data available for this crispr